ID: 1127332022

View in Genome Browser
Species Human (GRCh38)
Location 15:57948985-57949007
Sequence GTGCCAAGGCGGGTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127332022_1127332029 -10 Left 1127332022 15:57948985-57949007 CCTGTCCCCACCCGCCTTGGCAC No data
Right 1127332029 15:57948998-57949020 GCCTTGGCACACATAACTCAGGG No data
1127332022_1127332032 12 Left 1127332022 15:57948985-57949007 CCTGTCCCCACCCGCCTTGGCAC No data
Right 1127332032 15:57949020-57949042 GCTGGAAGCAGACTTGTTGCAGG No data
1127332022_1127332033 30 Left 1127332022 15:57948985-57949007 CCTGTCCCCACCCGCCTTGGCAC No data
Right 1127332033 15:57949038-57949060 GCAGGCTCTGAGAATGTTTGTGG No data
1127332022_1127332031 -6 Left 1127332022 15:57948985-57949007 CCTGTCCCCACCCGCCTTGGCAC No data
Right 1127332031 15:57949002-57949024 TGGCACACATAACTCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127332022 Original CRISPR GTGCCAAGGCGGGTGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr