ID: 1127333757

View in Genome Browser
Species Human (GRCh38)
Location 15:57963893-57963915
Sequence CTTTGACCCCACCACTGAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127333757_1127333760 2 Left 1127333757 15:57963893-57963915 CCTGCTCAGTGGTGGGGTCAAAG 0: 1
1: 0
2: 0
3: 21
4: 190
Right 1127333760 15:57963918-57963940 ACTCCCCACTACGCGCCTCTTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127333757 Original CRISPR CTTTGACCCCACCACTGAGC AGG (reversed) Exonic
900564930 1:3327537-3327559 ATTTGACCCCAGCACTGATCTGG + Intronic
901965766 1:12864467-12864489 CTTTTACCCCACCATTAGGCGGG - Intronic
901981166 1:13034844-13034866 CTTTTACCCCACCATTAGGCGGG - Intronic
902000920 1:13194085-13194107 CTTTTACCCCACCATTAGGCGGG + Intergenic
902020150 1:13339789-13339811 CTTTTACCCCACCATTAGGCTGG + Intergenic
902203448 1:14850999-14851021 CTCTGATCCCAGCACTGTGCAGG - Intronic
902892191 1:19452403-19452425 CTATGAGCCGACCACTGTGCCGG - Intronic
904263354 1:29303859-29303881 CAGTGACCCCACCGCTGCGCTGG - Exonic
904291397 1:29488357-29488379 CAGTGACCCCACCGCTGCGCTGG + Intergenic
904987504 1:34563929-34563951 CTTTGACCACACTTTTGAGCAGG + Intergenic
905123031 1:35696315-35696337 CTCTTTCCCCACCACTGACCTGG + Intergenic
905219155 1:36432059-36432081 CTGTTACCCCACACCTGAGCAGG + Intronic
905515235 1:38557842-38557864 CTGTGACCCCAGCTCAGAGCTGG - Intergenic
906580309 1:46930380-46930402 CCCTGACCCCAGCCCTGAGCTGG + Intronic
906603415 1:47148510-47148532 CCCTGACCCCAGCCCTGAGCTGG - Intronic
907477673 1:54716217-54716239 CTGTGACTCCACCACTTAACTGG + Intronic
908105131 1:60833523-60833545 CTATGACCCCTCCTCTAAGCAGG - Intergenic
909194963 1:72607664-72607686 CTTTGAATCCACCAATGACCTGG + Intergenic
912293681 1:108451987-108452009 CTTTCTCCCCATCCCTGAGCTGG + Intronic
915569377 1:156736023-156736045 CTTGGACCCCACCTTTGAGTAGG + Intronic
915737473 1:158094204-158094226 CTCAGACCCCACCCATGAGCAGG + Intronic
916387674 1:164294400-164294422 CTTTGATCACACCACTAAGCAGG + Intergenic
917968540 1:180193456-180193478 CTTTTACCCCTCCACGCAGCAGG - Intronic
919820313 1:201468344-201468366 CCTTGACCTCAGCACTGAGGTGG + Exonic
921729900 1:218566219-218566241 CCTTGTCCCCAGCACTGAGGCGG - Intergenic
922593944 1:226799311-226799333 CTGTGACCCCACCCCTGACCAGG + Intergenic
924272587 1:242349146-242349168 CTTTGACTCCACCTATGACCTGG - Intronic
1063374463 10:5545813-5545835 CTTTGAACCCAGCCCTGGGCAGG - Intergenic
1066712080 10:38246997-38247019 CTTTGACTCCACCTATGACCTGG + Intergenic
1070281293 10:75050835-75050857 CTTCGACCCCTCTGCTGAGCCGG + Intronic
1072926706 10:99622059-99622081 CTGTGACCCCAACACTGTGAAGG + Intergenic
1072950595 10:99843691-99843713 CTTTGTACCCAGCACTGTGCTGG - Intronic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1073449849 10:103602838-103602860 CCTTGAGCCCTCCACGGAGCTGG + Exonic
1074864634 10:117537622-117537644 CTTTAACCCCTCCACTGGCCTGG + Intergenic
1076645509 10:131951696-131951718 CTTTAATCCCACCACTCAGGAGG + Intronic
1076690717 10:132222736-132222758 CTGCGACCCCACCTTTGAGCTGG - Exonic
1077798899 11:5518650-5518672 TTTTGACACCACCACCGGGCAGG - Intronic
1078853837 11:15190233-15190255 CCTTGAACCCATCACTCAGCTGG + Intronic
1081980242 11:47261597-47261619 CTTTGCCCACTTCACTGAGCTGG + Exonic
1083452524 11:62755290-62755312 CTTTCATGCCATCACTGAGCCGG - Intergenic
1083468287 11:62864009-62864031 CTTTGACTCAAACTCTGAGCAGG - Intronic
1085294367 11:75422657-75422679 CTTTGACCCCAGCAGTGGGCAGG - Exonic
1088694639 11:112356198-112356220 CTTTGACCCCACCCATGGGCTGG + Intergenic
1089218952 11:116854686-116854708 CTGTGCCCCCACCACTCTGCAGG - Intronic
1089892574 11:121896127-121896149 CTTTCACCCCACCCCTGGGTTGG + Intergenic
1093764909 12:22952178-22952200 CTTTAGCCCCACCACTTGGCAGG + Intergenic
1096570332 12:52519396-52519418 CTTTGCAGCCACCCCTGAGCCGG - Intronic
1099345894 12:81499377-81499399 CTTTTACCCTACATCTGAGCAGG + Intronic
1100650720 12:96585656-96585678 CTTTGGCCCCACATCTGGGCAGG + Intronic
1100657088 12:96658969-96658991 ATTTCTCCCCACCACTAAGCAGG + Intronic
1103910822 12:124351143-124351165 CTGTGTCCCCACCACTGCGTGGG + Intronic
1104355388 12:128080635-128080657 CTTTGACTCCACCTATGACCTGG + Intergenic
1106458499 13:29948280-29948302 CTGTGAGCCCACCCCGGAGCCGG + Intergenic
1113928128 13:113952422-113952444 CTTGGAACCCAGCCCTGAGCAGG - Intergenic
1116492864 14:45526800-45526822 CTTTGTCCCCAGCAGTTAGCTGG - Intergenic
1118626594 14:67664986-67665008 CTGTAACCCCACCACTCAGGAGG - Intronic
1118674384 14:68167505-68167527 CTCTGTACCAACCACTGAGCTGG - Intronic
1118698192 14:68405927-68405949 CCTTGATCCCATCACTTAGCAGG + Intronic
1119377108 14:74203732-74203754 CTTTGTCCCCACCAGTAACCAGG + Intergenic
1120143595 14:80955528-80955550 CTGTGACCTCACCACTGTGGAGG - Exonic
1121582522 14:95041539-95041561 CTTTGTACCAGCCACTGAGCTGG + Intergenic
1122632107 14:103111845-103111867 GCTTGACCCCACCCCTGACCTGG + Intergenic
1123781686 15:23634497-23634519 CTTTTACCCCAGCTCTGTGCTGG + Intergenic
1124407113 15:29403078-29403100 CTTGGACCCCGTCACTGTGCAGG - Intronic
1124604219 15:31159055-31159077 CTTTGACCCCACCACAGCATGGG + Intronic
1124635831 15:31364766-31364788 CTCTTACCCACCCACTGAGCAGG - Intronic
1126851912 15:52802240-52802262 CTTTGACCACAGGACTGAGGAGG + Intergenic
1127333757 15:57963893-57963915 CTTTGACCCCACCACTGAGCAGG - Exonic
1129221646 15:74134847-74134869 CTGGGACTCCACCAGTGAGCAGG - Exonic
1129730948 15:77932566-77932588 CTTTGAACCCACCACTTGGAAGG + Intergenic
1130742213 15:86612929-86612951 CTTTGACTCCACCTATGATCTGG + Intronic
1132751070 16:1457973-1457995 CTGTGGCCTCAGCACTGAGCAGG + Intronic
1132957470 16:2603212-2603234 CTTTGACCCCGCCACGGAGTGGG + Intergenic
1133500074 16:6357422-6357444 CTTTACCCCCACCAATAAGCTGG - Intronic
1136289526 16:29262973-29262995 CTTTGAACCCACCTGTGACCAGG - Intergenic
1136374744 16:29858900-29858922 CTCGGACCCCAGGACTGAGCAGG + Exonic
1141233822 16:82197093-82197115 CTTTGTGCCCATCACTGTGCTGG + Intergenic
1141898094 16:86971510-86971532 GTTTGGCCCATCCACTGAGCAGG + Intergenic
1142095263 16:88235953-88235975 CTTTGAACCCACCTGTGACCAGG - Intergenic
1142904998 17:3035505-3035527 CTTTGTCCCTGCCTCTGAGCTGG + Exonic
1145416261 17:22716079-22716101 CTTTGACCCAAGCACTGTGCAGG + Intergenic
1146299673 17:31678317-31678339 CTTTGACCCAGACACTGGGCAGG - Intergenic
1148447859 17:47750775-47750797 TTTTGACCCCACCTCTGATGGGG + Intergenic
1148476646 17:47933081-47933103 CACTGACCCCTCCAGTGAGCAGG + Intergenic
1150611847 17:66739643-66739665 CTCTTCCCCCACCTCTGAGCCGG - Intronic
1151705804 17:75766400-75766422 CTTTGGGCACACCCCTGAGCAGG - Intergenic
1152216070 17:79033352-79033374 CCATGTCCCCACCACTGACCTGG - Intronic
1152458831 17:80430912-80430934 CTTTGCCCCCACTCCTCAGCTGG - Intronic
1155100773 18:22607868-22607890 CCCTGACCCCACCACTTTGCAGG - Intergenic
1155500587 18:26483200-26483222 CTGTGAGCCCACCACTCAGCAGG + Intronic
1158783056 18:60675218-60675240 CTTTGATCCCATCACTAAGGTGG - Intergenic
1158797894 18:60870803-60870825 CTTTGTCCCCAAAACTCAGCTGG + Intergenic
1160657452 19:280867-280889 CCTTGACCCCAGCACTGTGCTGG + Intergenic
1160836392 19:1126687-1126709 GTGTGAGCCCACCACTGTGCCGG + Intronic
1162052886 19:8045709-8045731 CTATGTGCCCAGCACTGAGCTGG - Intronic
1162377138 19:10311283-10311305 CTGTGACCCTATCACTGTGCTGG + Intronic
1162419383 19:10557551-10557573 CTTTGGCCTCAGCACTGAGGAGG - Exonic
1163021352 19:14482551-14482573 ATTGGCCCCCACCACTGAGTGGG + Intronic
1163548533 19:17952637-17952659 CTTTCCCCCCACCACTGAGGAGG - Intronic
1164473028 19:28551649-28551671 CTTTGACTCCACCTATGACCTGG + Intergenic
1167821647 19:51933694-51933716 CTTTAAGACCATCACTGAGCTGG + Intronic
924978183 2:196691-196713 CCTTGGCCCCACCTCTGAGGTGG - Intergenic
928337211 2:30408157-30408179 CTTGGAACCCAGCGCTGAGCTGG - Intergenic
932015494 2:68022768-68022790 CTTTGCCCAGACCACTGATCTGG + Intergenic
932259855 2:70318092-70318114 CTTTGGCCCCACCAAAGTGCTGG + Intergenic
936047778 2:109200489-109200511 CTTGGACCCGCCGACTGAGCAGG - Intronic
937748867 2:125449337-125449359 TCTTGATCCAACCACTGAGCTGG + Intergenic
941015688 2:160353537-160353559 CTTTGTCCTCTCCACTGGGCAGG - Intronic
942543774 2:177041592-177041614 CTTTGAATCCACCTCTGACCTGG + Intergenic
943888060 2:193248568-193248590 CTTTGCCCCCACCCCACAGCAGG + Intergenic
947678632 2:232008769-232008791 TTTTGAACCCACAACTGATCAGG - Intronic
947791595 2:232872124-232872146 GTTTGACCCCACCCCTGGGCTGG + Intronic
947996329 2:234530904-234530926 CTTTGAATCCACCAATGACCTGG + Intergenic
1169226363 20:3859563-3859585 CTTTGCCCCCACCCCTCATCAGG - Intronic
1171373228 20:24674990-24675012 CTTGGTCCCCACCACTCAGCTGG + Intergenic
1171519565 20:25765477-25765499 CTTTGACCCAAGCACTGTGCAGG + Intronic
1171557355 20:26091016-26091038 CTTTGACCCAAGCACTGTGCAGG - Intergenic
1173377386 20:42498808-42498830 CTTTGACTCCACCTATGACCTGG + Intronic
1173422094 20:42910372-42910394 CATTGATTCTACCACTGAGCTGG - Intronic
1174503278 20:51000941-51000963 CTCAGATCCCACCTCTGAGCAGG - Intergenic
1175576332 20:60063481-60063503 CTTGGAGCCCAAGACTGAGCTGG + Intronic
1175985450 20:62762108-62762130 CTCTGAGCCCACTCCTGAGCAGG - Exonic
1176284490 21:5012336-5012358 CTGTGGCCCCAGCACTGGGCAGG + Intergenic
1176653707 21:9571754-9571776 CTTTGACCCAAGCACTGTGCAGG + Intergenic
1177810966 21:25924605-25924627 CTTTCACCCCACCCCTGGACAGG - Intronic
1179872691 21:44251139-44251161 CTGTGGCCCCAGCACTGGGCAGG - Intronic
1180158771 21:45989978-45990000 CTTTCACCCCACCCCAGAGCAGG + Intronic
1182328935 22:29536580-29536602 CTTTGCCTTCACCACTGACCAGG - Intronic
1184322671 22:43754400-43754422 CTATGACCCCAACCCTGGGCAGG - Intronic
1184532750 22:45066788-45066810 CTTTGACCCATGCAATGAGCTGG + Intergenic
949403279 3:3687959-3687981 CTTTGAATCCACCAGTGACCTGG - Intergenic
950369353 3:12515248-12515270 CTTCCACCCCACCACTAACCCGG - Intronic
951596446 3:24323546-24323568 CATTGGCCCCACCAGGGAGCTGG - Intronic
953048491 3:39317351-39317373 CTTTGACTCCACCTTTGACCTGG + Intergenic
954369607 3:50163318-50163340 CTCTGGCCCTTCCACTGAGCAGG + Intronic
954487449 3:50866503-50866525 CTTTGACCAGACCAATGACCTGG + Intronic
960748429 3:120917146-120917168 CTTTGACCACTCCACAAAGCTGG - Intronic
960937237 3:122911685-122911707 CTCAGACCCCACCTCTGAGAAGG + Intronic
961821714 3:129578677-129578699 AATTGGCCCCACCACTGGGCGGG - Intronic
966320754 3:178699059-178699081 CATTGCCCCCACCACTGTGGTGG - Intronic
968561888 4:1288070-1288092 CTTTGAATCCACCTGTGAGCTGG + Intergenic
972635326 4:40878842-40878864 CTTTGGCCCCACGTCTGATCTGG + Intronic
973637957 4:52877298-52877320 TTTTCACCCCTCCACAGAGCAGG - Intronic
977608937 4:99012895-99012917 CTTTGAACCCACCTATGACCTGG - Intronic
984550548 4:181154024-181154046 TTTTGACCCCACCACTCCCCAGG + Intergenic
984759841 4:183354156-183354178 CTTTGAGACCACGAGTGAGCAGG + Intergenic
988525488 5:31983407-31983429 CAGTGACCCCAGCACTGAGCTGG + Exonic
988860635 5:35274195-35274217 CTCTGACCCTCCCACTGATCTGG + Intergenic
991521687 5:67505796-67505818 CTTTGCCCCCACCAAAGTGCTGG + Intergenic
991935909 5:71799953-71799975 CCTTGACCCCACCCCTCAACAGG - Intergenic
996415177 5:123202885-123202907 CATTGACCCCACCTCTTAGTGGG + Intergenic
997439548 5:133899558-133899580 CTTTCTCCCCTCCCCTGAGCAGG + Intergenic
997580033 5:135011414-135011436 CTTTGACCCTACACCTGTGCAGG + Intronic
998865709 5:146498965-146498987 CTTAGAAGGCACCACTGAGCAGG - Intronic
999273808 5:150314833-150314855 CTCTGAACCCAGCACCGAGCGGG + Intronic
999551434 5:152691845-152691867 CTTTTTCCCCCCCACTGAGATGG + Intergenic
999798844 5:155014021-155014043 GTTTGACCCCTGTACTGAGCAGG + Exonic
1002094463 5:176822916-176822938 CTGTGACCACATCTCTGAGCTGG + Intronic
1002330040 5:178434827-178434849 CTTTGAAACCAGCCCTGAGCTGG - Intronic
1005143849 6:22664897-22664919 CATTGTCCCCATCACTGAGGAGG - Intergenic
1005502009 6:26436877-26436899 CTTTGATCAAACCACTAAGCTGG - Intergenic
1007128299 6:39446068-39446090 CCTTTCCCCCACCACTGAACAGG - Intronic
1008553009 6:52651111-52651133 CTTTGGCCCCACATCTGGGCAGG + Intergenic
1011705937 6:90001659-90001681 CTTTGTCCCATCCACTTAGCTGG - Intronic
1012519933 6:100109246-100109268 TTTTGTCCCCAACACTGAGGAGG - Intergenic
1015714863 6:136182107-136182129 ATTTGACCTCCCCACAGAGCTGG - Intronic
1016433186 6:144008546-144008568 CTTTGCCCCCACCGGTGACCCGG - Intronic
1018066934 6:160131117-160131139 CTCTGTCTCCACCTCTGAGCTGG - Intronic
1018530327 6:164756225-164756247 CTCTGACCTCATCACTCAGCTGG - Intergenic
1019209740 6:170395296-170395318 CTGTGACTCCACTCCTGAGCCGG + Intronic
1019557531 7:1640141-1640163 CTGTGACGCCACCACTGCACTGG - Intergenic
1021842243 7:24730102-24730124 CTCTGAACCCTCCAGTGAGCTGG - Intronic
1022963830 7:35454906-35454928 CTCTGACCCCAACTCTGAGCAGG + Intergenic
1023344506 7:39257549-39257571 CTTTGACACCCACCCTGAGCTGG - Intronic
1024224197 7:47313263-47313285 CTGTGTCCCCAGCACTGGGCTGG + Intronic
1025280054 7:57620412-57620434 CTTTGACCCAAGCACTGTGCAGG + Intergenic
1025304681 7:57845089-57845111 CTTTGACCCAAGCACTGTGCAGG - Intergenic
1027011140 7:74745829-74745851 CTGTGAGGCCACCACTGTGCTGG + Intronic
1027601577 7:80246738-80246760 CTTTGACTCCACCTATGACCTGG - Intergenic
1030164052 7:106535241-106535263 CTTTGACCCCATCACTGTCAGGG - Intergenic
1030410843 7:109178282-109178304 CTCTTACCCCACCCCTCAGCAGG + Intergenic
1034708495 7:153170127-153170149 CTCTCACACCACCACTGAACAGG - Intergenic
1034993806 7:155565770-155565792 CGGAGACCCCACCACTGGGCAGG + Intergenic
1037672281 8:21025322-21025344 CTGTGATCCCATCACAGAGCAGG + Intergenic
1037825604 8:22158876-22158898 CTTTGAACCTGCCACTGGGCAGG - Intronic
1042979074 8:74505623-74505645 CTTTGAACCCACCTATGACCTGG + Intergenic
1044819854 8:96148649-96148671 CTTTGAATTCACCACTGAGTAGG + Intronic
1047227803 8:122971227-122971249 TTTTGACCATGCCACTGAGCAGG + Intronic
1048282524 8:133115631-133115653 CTTTGGCCCCACTTCTCAGCTGG + Intronic
1049006356 8:139858051-139858073 CTTTGGTCCCACTTCTGAGCAGG - Intronic
1056954615 9:91072269-91072291 CTTTGACCCCCCCACTCTCCTGG + Intergenic
1057829715 9:98397109-98397131 CTTTTACCCCCATACTGAGCAGG + Intronic
1061031220 9:128084534-128084556 CTTTGAACCCACCTATGATCTGG + Intronic
1061386750 9:130295055-130295077 CTTTGGCCCCAAGACTGAGGTGG + Intronic
1061499338 9:130993231-130993253 CTCTGACCCCACCACAGACGAGG - Intergenic
1203631428 Un_KI270750v1:75201-75223 CTTTGACCCAAGGACTGTGCAGG + Intergenic
1186340839 X:8644816-8644838 CTTTGAACCCACCTATGACCTGG + Intronic
1186463259 X:9765295-9765317 CCCTCACCCCAGCACTGAGCAGG + Intronic
1189882716 X:45508813-45508835 TTTGTACCCCACCACTGAGAAGG - Intergenic
1190774673 X:53543303-53543325 CCGGGACCCCAACACTGAGCTGG + Intronic
1192170790 X:68853215-68853237 CTCAGACCCCACCAATGGGCAGG - Intergenic
1192587015 X:72327147-72327169 CTTTGGGCCCAGCACTGAGCAGG + Intergenic
1193850928 X:86536643-86536665 CTTTGAATCCACCAATGACCTGG + Intronic
1195966332 X:110433214-110433236 CTATGTGCCCACCACTGTGCTGG + Intronic
1199687584 X:150278098-150278120 CTTTGATCCAACCACACAGCTGG + Intergenic
1199725561 X:150576609-150576631 CTTTCACCCCATCTCTGACCAGG + Intronic
1200009568 X:153110981-153111003 CTTTGATCCCTCCACTGTGTGGG + Intergenic
1200030032 X:153288941-153288963 CTTTGATCCCTCCACTGTGTGGG - Intergenic
1200943129 Y:8805791-8805813 CTTAGGTCCCCCCACTGAGCAGG - Intergenic
1202073453 Y:21015983-21016005 TTTTAATCCCACCACTCAGCGGG + Intergenic
1202078153 Y:21057837-21057859 TTTTAATCCCACCACTCAGCGGG + Intergenic