ID: 1127333911

View in Genome Browser
Species Human (GRCh38)
Location 15:57965189-57965211
Sequence GGTATGAGTAGTCCTAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127333911 Original CRISPR GGTATGAGTAGTCCTAAAGC TGG (reversed) Intronic
912437289 1:109670660-109670682 AGTTTGTGTATTCCTAAAGCAGG - Intronic
917562581 1:176174824-176174846 GGTATGAGTAGGCATGAAGTAGG - Intronic
917922004 1:179758480-179758502 AGTATGAGCAGACATAAAGCTGG - Intronic
920148195 1:203881153-203881175 GGTATGGGTAGTTATAAAGTTGG - Intergenic
924821824 1:247499864-247499886 GCTATTATTATTCCTAAAGCAGG - Intergenic
1064786156 10:18898213-18898235 GGTATGAGTAGGCGTAAACAGGG - Intergenic
1070484662 10:76918316-76918338 GGAATGAGAAGTCCTCAATCAGG + Intronic
1074005008 10:109412872-109412894 GGTATGAATAGTCCAAAGGATGG - Intergenic
1083778799 11:64907503-64907525 GGTATGAGAGGTGCTAACGCTGG - Exonic
1088781381 11:113137087-113137109 GCTTAAAGTAGTCCTAAAGCAGG + Intronic
1091629562 12:2149514-2149536 GCTATGAGCATTCCTAAAGCGGG - Intronic
1099333218 12:81318452-81318474 AGTAAGTATAGTCCTAAAGCTGG + Intronic
1104521101 12:129476112-129476134 GGTATGAGCAGACAGAAAGCAGG - Intronic
1105660304 13:22487074-22487096 TGTATGGCTATTCCTAAAGCTGG + Intergenic
1109022035 13:57109350-57109372 TGTATTAGTACTCCTAAACCTGG + Intergenic
1127333911 15:57965189-57965211 GGTATGAGTAGTCCTAAAGCTGG - Intronic
1127832789 15:62765574-62765596 CGTATGAATAGTCCTACAGAGGG + Intronic
1129704082 15:77784713-77784735 GGCATGAGTAGTCTTACACCTGG + Intronic
1130734903 15:86537810-86537832 AGTATAAGAAGTCCTAAAGGAGG - Intronic
1130898135 15:88186487-88186509 GGTCTGAGTTTTCCTAAATCAGG + Intronic
1148220411 17:45857935-45857957 GGTATCAGAAGTCCTGCAGCTGG - Intergenic
1150224614 17:63517218-63517240 GGTATGTGAAGTCCTAAGCCTGG - Intronic
1151111414 17:71682526-71682548 GGTATGAGAAGTTCAAAAGCAGG - Intergenic
1153071278 18:1107341-1107363 GGTAAGAGTAGTTCTAACGCAGG + Intergenic
1167160110 19:47761864-47761886 GGTATTATTTTTCCTAAAGCGGG + Intergenic
925076998 2:1025177-1025199 GGTCTGAGTAGTGCTTGAGCAGG + Intronic
926964969 2:18399856-18399878 GTTACAAGTAGTCCTAAAGGAGG + Intergenic
932917822 2:75876409-75876431 GGTTTCTGTACTCCTAAAGCTGG - Intergenic
939085910 2:137717905-137717927 GGTATGAGTAGTCTCAAATCTGG + Intergenic
944034142 2:195272749-195272771 GCTATGATTAGTCATAAAGTTGG - Intergenic
945689510 2:213015868-213015890 GAAATGAGTAGTCCAAAACCTGG + Intronic
1173503923 20:43572305-43572327 GGTCTCAGCAGTCCTAGAGCTGG - Intronic
1177880048 21:26682512-26682534 GGTAGGAGTAGTCATAATCCTGG - Intergenic
1182660144 22:31919330-31919352 GGAAGGAGTCTTCCTAAAGCAGG + Intergenic
1184747016 22:46462015-46462037 GGTATGAGCAGGCCTGAACCAGG - Intronic
1203288343 22_KI270735v1_random:5821-5843 TGTTTGAGTATTCTTAAAGCAGG - Intergenic
952672372 3:35985770-35985792 GAAAAGAGTAGACCTAAAGCAGG - Intergenic
954409542 3:50364493-50364515 GGGATGGGGAGTCCCAAAGCGGG - Intronic
955462840 3:59203803-59203825 TGTATCAGTAGTCCAAAAACTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
981279443 4:142940527-142940549 GGTATGTGCAGTCAGAAAGCTGG - Intergenic
981295065 4:143122394-143122416 TGTATGGGTAGTTATAAAGCTGG - Intergenic
982353836 4:154445093-154445115 TGTATGAGTAGAATTAAAGCAGG - Intronic
985246816 4:187987195-187987217 GGTATTAGTAGCCCTAATGTTGG - Intergenic
986611158 5:9568915-9568937 GATATGAGTATTCCTCAGGCAGG + Intergenic
997155904 5:131557064-131557086 TGTATGAGAAGTACTTAAGCTGG - Intronic
997307500 5:132849822-132849844 AGTAGGAGTATTCCTAAGGCAGG - Intergenic
997377189 5:133405660-133405682 GGTATAAGTTATCTTAAAGCGGG - Intronic
999053231 5:148546473-148546495 GGTATGAGTTGTCATGAAACAGG - Intronic
999613209 5:153393618-153393640 CGTATGAGTAGCCCTCAATCAGG - Intergenic
1001763961 5:174230365-174230387 GGGAAGAGTAGTTCTAAAGAGGG - Intronic
1015588199 6:134797480-134797502 GGTATGTGTATTTCCAAAGCTGG + Intergenic
1027530971 7:79332166-79332188 GGGATGATTAGTGCAAAAGCAGG + Intronic
1028019291 7:85750206-85750228 GGTGTGGGCAGTGCTAAAGCAGG + Intergenic
1033851372 7:145499662-145499684 GGTATGAGCAATGCTAATGCTGG + Intergenic
1040452681 8:47563687-47563709 GGTAAGAATACTCCTAAAGATGG + Intronic
1051776114 9:20635976-20635998 GGTATGGGCAGTCCTAGAGAAGG - Intergenic
1054711336 9:68514167-68514189 AGTTTGAGAAGTCCTAATGCTGG + Intronic
1055163311 9:73158544-73158566 GGTATCAGAATTCCTCAAGCAGG + Exonic
1189726835 X:43975794-43975816 GGGATGGGTAGTCCCAAAGCAGG + Intergenic
1190932718 X:54963121-54963143 GGTAGCAGTAGTCCTAATGCTGG + Intronic