ID: 1127334119

View in Genome Browser
Species Human (GRCh38)
Location 15:57966880-57966902
Sequence GTGGAGTCGCATCCTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127334119_1127334122 1 Left 1127334119 15:57966880-57966902 CCTACAACAGGATGCGACTCCAC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127334119 Original CRISPR GTGGAGTCGCATCCTGTTGT AGG (reversed) Intronic
901052000 1:6429947-6429969 GTCGAGTCACATGCTGCTGTGGG - Intronic
902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG + Intergenic
903215997 1:21843534-21843556 ATGTAGGCGCATCCTGTTGGAGG + Intronic
906178950 1:43801489-43801511 GTGCAGTCACATCCTGTTCCAGG - Intronic
915508406 1:156371947-156371969 GTGGACTTGGATACTGTTGTGGG + Intronic
916118437 1:161507628-161507650 GTGGAGTCGCTTTCTGTTGATGG + Intronic
917600944 1:176573071-176573093 GTGCTGAGGCATCCTGTTGTGGG + Intronic
922726164 1:227924002-227924024 GTGGAGTGGCCTCCTGTAGGAGG - Intronic
1069796440 10:71055224-71055246 GTGGAGTGGTATCTTATTGTTGG - Intergenic
1070996043 10:80783630-80783652 GTGGATTCACATGCAGTTGTAGG + Intergenic
1071761693 10:88615602-88615624 GTGGAGTCTCACACTGTTGCTGG - Intergenic
1084399745 11:68936735-68936757 GTGGACCCGCAGCCTGTCGTGGG - Exonic
1091801753 12:3328833-3328855 GTGGAGTCCCATGCTCATGTGGG - Intergenic
1095529185 12:43164839-43164861 GGGGAGTTGCATCCTGTTCTAGG + Intergenic
1096472970 12:51890457-51890479 ATAGAGTCCCATCCTGTTGAAGG - Intronic
1102069319 12:110004132-110004154 ATGGAGTCTCATACTGTTGCCGG - Intronic
1113314126 13:109160545-109160567 GTTCAGTGGCATCCTGTGGTTGG - Intronic
1116684662 14:48022694-48022716 GTGGAGTGGTATTCTGTTCTTGG + Intergenic
1121510753 14:94511572-94511594 GTGGTGTCGGTTCCTGTTCTGGG - Intronic
1122908107 14:104811965-104811987 GTGTAGTGGTATCTTGTTGTGGG - Intergenic
1126255737 15:46623173-46623195 GTGGACTCACATCCTGTTTTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1130005014 15:80087359-80087381 GTGGAGTGGTATTCTATTGTGGG + Intronic
1139496444 16:67322995-67323017 GTGAAGTAGTATTCTGTTGTGGG - Intronic
1149017107 17:51920726-51920748 GTGCAGAAGCATTCTGTTGTGGG - Intronic
1151510759 17:74558177-74558199 CTGGAGTGGCATTCTGTGGTAGG + Intergenic
1152415804 17:80160997-80161019 GTGGAGTCGTATCCCTTGGTGGG + Intergenic
1158077218 18:53544791-53544813 GTGGAGTAGCCTCCTGCTTTGGG - Intergenic
1158218808 18:55128904-55128926 GTGGAGTCCCAGTCTGTTGATGG + Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1165764000 19:38338901-38338923 ATGGAGTCTCACTCTGTTGTTGG + Intronic
934517062 2:94995326-94995348 GTGGATTCTCATAGTGTTGTGGG - Intergenic
935259826 2:101344507-101344529 CTGCAATCCCATCCTGTTGTCGG + Intergenic
936252215 2:110875675-110875697 GTGGAATTGCATCCTGCAGTGGG + Intronic
941197032 2:162465752-162465774 GTAAAGGTGCATCCTGTTGTGGG + Intronic
942534398 2:176948282-176948304 GAGGAGTCACATACTGTGGTAGG - Intergenic
1175811111 20:61857702-61857724 GTAGAGTCACATGCAGTTGTAGG + Intronic
1178489182 21:33037173-33037195 GTGGAATCATATTCTGTTGTGGG + Intergenic
1182714022 22:32340771-32340793 GTGGGGTCAGATCATGTTGTTGG + Intergenic
951906492 3:27712771-27712793 CTGGAGTCCCATCGTCTTGTTGG + Intergenic
960821722 3:121740346-121740368 GTAGAGTCACATGCAGTTGTAGG - Intronic
969336752 4:6515134-6515156 CTGTATTAGCATCCTGTTGTGGG - Intronic
971174335 4:24266301-24266323 GAGGAGTTGCTTCGTGTTGTAGG + Intergenic
974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG + Intronic
986749721 5:10776143-10776165 GTGGAGTCCACTCCTGCTGTGGG - Intergenic
996295041 5:121903138-121903160 GGAGAGTGGCATCCTGCTGTAGG + Intergenic
1003554752 6:7129722-7129744 GAGGGGTAACATCCTGTTGTCGG + Intronic
1006148384 6:31972481-31972503 GTGGAGTCGGATCCTCTTCGGGG + Exonic
1012298729 6:97557564-97557586 GTGGAGTAGCAGCCTGTCTTTGG + Intergenic
1012743307 6:103049038-103049060 ATGGAGTTGCATCCTGTTCAGGG + Intergenic
1056599705 9:88036997-88037019 GTGGTGTTGGATCCTGTTGGGGG + Intergenic
1057025093 9:91728850-91728872 GTGGAGTGGCATGCAGCTGTGGG - Intronic
1060387459 9:123245136-123245158 GTGGATTCACATGCTGTTGTAGG - Intronic
1061473157 9:130843628-130843650 AAGGAGAAGCATCCTGTTGTGGG + Intronic
1185855626 X:3532215-3532237 GTAGAGTGGCATCCAGTTGGTGG - Intergenic
1193483240 X:82053596-82053618 GTGGAGTCTCATCCTTTATTTGG - Intergenic
1196769729 X:119281631-119281653 GTGGAGGGGCAGCCTGGTGTGGG - Intergenic