ID: 1127334119

View in Genome Browser
Species Human (GRCh38)
Location 15:57966880-57966902
Sequence GTGGAGTCGCATCCTGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127334119_1127334122 1 Left 1127334119 15:57966880-57966902 CCTACAACAGGATGCGACTCCAC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127334119 Original CRISPR GTGGAGTCGCATCCTGTTGT AGG (reversed) Intronic