ID: 1127334122

View in Genome Browser
Species Human (GRCh38)
Location 15:57966904-57966926
Sequence GGAGAGCACATATCACTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127334115_1127334122 15 Left 1127334115 15:57966866-57966888 CCCTGGGAACCTAACCTACAACA 0: 1
1: 0
2: 6
3: 31
4: 168
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174
1127334116_1127334122 14 Left 1127334116 15:57966867-57966889 CCTGGGAACCTAACCTACAACAG 0: 1
1: 1
2: 12
3: 34
4: 190
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174
1127334119_1127334122 1 Left 1127334119 15:57966880-57966902 CCTACAACAGGATGCGACTCCAC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174
1127334118_1127334122 6 Left 1127334118 15:57966875-57966897 CCTAACCTACAACAGGATGCGAC 0: 1
1: 0
2: 1
3: 0
4: 30
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174
1127334114_1127334122 26 Left 1127334114 15:57966855-57966877 CCGTGAATGCTCCCTGGGAACCT 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127334122 Original CRISPR GGAGAGCACATATCACTTTA TGG Intronic
901327484 1:8376729-8376751 GCAGAGCCCGTATCTCTTTAGGG - Intronic
902868253 1:19295446-19295468 GGAGAGCACATGGCATTTAAAGG - Intergenic
903594524 1:24484103-24484125 GGAGAGAAAATGTCACATTAAGG - Intergenic
904662668 1:32096788-32096810 GGATTGCACATTTCACTGTATGG - Intronic
905880194 1:41458060-41458082 GGAGAGCACACAGCACTGGAGGG + Intergenic
906009696 1:42511789-42511811 GGAGAGCACATGGCATTTCAAGG - Intronic
906472432 1:46142374-46142396 GGAGAGCACATCGCTCTTTGAGG + Intronic
907610599 1:55866114-55866136 GGAGAGAAAGTATTACTTTAAGG + Intergenic
908457386 1:64317260-64317282 GGAGTGCAGATATCTCTTTGGGG + Intergenic
908935151 1:69366539-69366561 GGAAAAGGCATATCACTTTATGG + Intergenic
910287314 1:85570039-85570061 GGAGGGCACATCTCAGTTTCTGG + Intronic
911649204 1:100368341-100368363 GGAGAGTACAGATCAACTTAAGG + Intronic
911686671 1:100785475-100785497 GAAGAGCAAATCTCACTTAAAGG - Intergenic
911714800 1:101119576-101119598 GCAGAGCACAGATAATTTTAGGG - Intergenic
912975182 1:114323262-114323284 AGAGAGCATATATCAATTTATGG + Intergenic
918941847 1:191010225-191010247 TCAGAGCACATATTATTTTAGGG - Intergenic
920830064 1:209456497-209456519 GGAGAGCACAGATGACTTTAGGG - Intergenic
921106029 1:211979443-211979465 GGAGAACACATTTCATTATAGGG + Intronic
921576944 1:216846265-216846287 GGAGAGCGTATTTCACTATAGGG + Intronic
923511076 1:234654198-234654220 GGAGAGCAGGTATCTCTGTAAGG - Intergenic
924580593 1:245320584-245320606 GGACAACACATCTCACTTTGGGG - Intronic
924653384 1:245950052-245950074 GGAGTGCAGACATCAATTTAAGG + Intronic
1065017099 10:21471953-21471975 GAAGTGAACCTATCACTTTAAGG + Intergenic
1068725971 10:60303765-60303787 GGAGTGCAAATATCTCTTTGAGG - Intronic
1071723092 10:88166981-88167003 AGAAAGTATATATCACTTTATGG + Intergenic
1075025331 10:118979768-118979790 GGTGAGCACTGATCACTTGAAGG - Intergenic
1075256079 10:120926832-120926854 GGAGGGCACATGCCACTTGAGGG + Intergenic
1084588697 11:70078278-70078300 GGAGAGCGCTTATATCTTTAAGG + Intergenic
1085684521 11:78609694-78609716 GGACAGGTCATATCACTCTAAGG + Intergenic
1085761813 11:79247851-79247873 GGAAAGAACATATAACTCTAAGG - Intronic
1088139526 11:106598985-106599007 TGAGATCACATATGACTTTGAGG - Intergenic
1088424018 11:109681387-109681409 GGAAAGCAAATATTACATTAAGG - Intergenic
1090292055 11:125554258-125554280 GGTGAGCACATAACACTTCCAGG - Intergenic
1091099654 11:132859172-132859194 TGAAAGCACATATCACTTTGGGG + Intronic
1092273913 12:7044894-7044916 GGAGAGAACCTATATCTTTATGG - Intronic
1092631848 12:10388202-10388224 AGAGAGTAGGTATCACTTTATGG + Intronic
1093336515 12:17912004-17912026 GGGCAACACATATAACTTTATGG + Intergenic
1094050359 12:26213713-26213735 AGGGAGAACATATCACTTTAAGG + Intronic
1097721108 12:63022539-63022561 TGAGAGTACTTATCACTTCAAGG + Intergenic
1097988563 12:65810051-65810073 GGAGAGCCATTATCACTCTAGGG - Intergenic
1098518558 12:71408256-71408278 GGAGTGCAGATATCTCTTCAAGG - Intronic
1098673052 12:73254373-73254395 GCTGTGCACATCTCACTTTATGG - Intergenic
1099036612 12:77595084-77595106 GGAGTGCAGATATCTCTTTGAGG - Intergenic
1101838204 12:108309898-108309920 GGAGAGCACGTATGTCTTTGTGG + Intronic
1103283026 12:119776187-119776209 GGTGACCACATATGACTTTATGG - Intronic
1104278667 12:127353757-127353779 GAAGAGCAGATATCATTTTCTGG + Intergenic
1108379144 13:49840146-49840168 GGATAGGACATTTCTCTTTAAGG + Intergenic
1109196559 13:59384026-59384048 AGAGAAGACATACCACTTTAGGG - Intergenic
1109243837 13:59928471-59928493 GGTGCACAGATATCACTTTAGGG - Intronic
1109574434 13:64234788-64234810 GGAGTGCAGATATCACTCCAGGG - Intergenic
1110248394 13:73353865-73353887 TGAGACCATATATCAATTTATGG - Intergenic
1111556527 13:89888457-89888479 GAAGTGCACATAAAACTTTAAGG + Intergenic
1111910777 13:94309637-94309659 GGATAACACAAACCACTTTAGGG - Intronic
1112106560 13:96246818-96246840 GGAGAGGATTTATAACTTTATGG + Intronic
1114682524 14:24498290-24498312 GGAGTGCATATATCACGTTTTGG + Intergenic
1116103995 14:40476220-40476242 GGAGAGCACATAGCATGTCAAGG - Intergenic
1116236892 14:42289762-42289784 GCAGTGCATATATCTCTTTAAGG + Intergenic
1117287744 14:54303527-54303549 AGAGAGCAAATGTCACTTAAAGG - Intergenic
1118500702 14:66359769-66359791 GGAGATCTCACATCACTTTAGGG + Intergenic
1119774168 14:77238290-77238312 GGAGAGCAGAAATCACTGTGGGG + Intronic
1120508407 14:85381750-85381772 TGAGAGCACATAGCTCTTGAGGG - Intergenic
1120600411 14:86498039-86498061 GGAGTACATATATCCCTTTAAGG - Intergenic
1121347818 14:93149171-93149193 GGAGAACACATGTCCCTCTATGG + Intergenic
1121582658 14:95042397-95042419 GGAAAACATATATAACTTTAAGG - Intergenic
1122665235 14:103325205-103325227 TGAGAGAACATATCGCTTTGGGG - Intergenic
1126283623 15:46986406-46986428 GGTGTGCACATCACACTTTATGG - Intergenic
1126292282 15:47095299-47095321 GGAATGCAAATATCACTTCAAGG - Intergenic
1127334122 15:57966904-57966926 GGAGAGCACATATCACTTTATGG + Intronic
1130036656 15:80367269-80367291 GGAGAGCACATGGCATTTCAAGG + Intronic
1133284788 16:4685602-4685624 GGAGAGCACATGTGCCTTTGGGG + Intronic
1133678748 16:8100382-8100404 GGAGAGCACATACAAACTTACGG + Intergenic
1134299539 16:12977300-12977322 GGAGAGCACAGTTCAACTTAGGG + Intronic
1134661966 16:15991098-15991120 GGAGTGCAGATATCTCTTCAGGG + Intronic
1137754557 16:50891227-50891249 GGAGAGGACACAGCACTTTGGGG - Intergenic
1138982324 16:62284637-62284659 CCAAAGCACATATCTCTTTAGGG + Intergenic
1139074259 16:63424443-63424465 GGAAAATACATATCACTTTATGG - Intergenic
1140565227 16:76034578-76034600 GGAGTGCAGATATCTCTTCAAGG - Intergenic
1141081467 16:81056803-81056825 GGAGAGCACATATGCCTTCTGGG + Intronic
1145899578 17:28481538-28481560 GGGGAGCACATTTCGCTTTCTGG + Intronic
1147365337 17:39955186-39955208 AGAGAGCACACAAGACTTTAGGG + Intergenic
1148466920 17:47870597-47870619 GGAGAGATCAGATCAGTTTACGG + Intergenic
1148982722 17:51592627-51592649 GGAGAGCAAAAAACCCTTTATGG + Intergenic
1149851358 17:60037373-60037395 GGAGTTCACATACAACTTTAGGG + Intergenic
1149852310 17:60045300-60045322 GGAGAGCACACATCAAGTGAGGG - Intronic
1151441448 17:74131972-74131994 GAAGAGCACCTCTCACATTAGGG + Intergenic
1151689568 17:75673601-75673623 GGAGGGTACATAACACTTAACGG + Intronic
1153567835 18:6437338-6437360 GTAGAGAAAATATCACTTAAGGG - Intergenic
927108762 2:19849450-19849472 GGAGTGCACAGAGCCCTTTAAGG + Intergenic
927321301 2:21748905-21748927 GGAGAGCAAAGATCACCTGATGG - Intergenic
929338274 2:40779895-40779917 GGGGTGCAGATATCACTTTGAGG - Intergenic
930350042 2:50239826-50239848 GAAGAGCAAATGTCACTTTATGG - Intronic
933575344 2:84060880-84060902 GGACAGCACTCATCACTTTAAGG + Intergenic
934669947 2:96205349-96205371 GGAAAACACATGCCACTTTAAGG + Intronic
936899858 2:117470441-117470463 GGAGAGCACATGGCATTTTAAGG - Intergenic
936899873 2:117470525-117470547 GGAGAGCACTTAGCACTTCCAGG - Intergenic
939086938 2:137731519-137731541 GCAAAGCACATATCAATTAAGGG - Intergenic
940990204 2:160088563-160088585 GGAGAGCACATGGTATTTTAAGG - Intergenic
941047936 2:160697302-160697324 AGAGAGCATATAGCACTTCACGG - Intergenic
942822489 2:180132183-180132205 GGAGAGCAAATTTCTCTGTAAGG + Intergenic
944487187 2:200219177-200219199 GTAGAGCATAAATCAATTTATGG + Intergenic
944870449 2:203906373-203906395 GGAGAGCACAGATAATTTTTAGG + Intergenic
945410650 2:209502550-209502572 GGAGTGCAGATATCTCTTCAAGG + Intronic
946609927 2:221447097-221447119 GGAGAATATATATCACTTAAAGG + Intronic
947055887 2:226103207-226103229 GGAGTGCACATATCTCTTCGAGG - Intergenic
947166470 2:227267409-227267431 GGAGAGAGCATATTTCTTTATGG - Intronic
1170161593 20:13318890-13318912 GCAGAGCACAGAACACTTTCAGG + Intergenic
1173181541 20:40809903-40809925 GGAGAACAGAAATCACTCTAGGG - Intergenic
1173680764 20:44879745-44879767 GCAAAGCACATATCACCTAAAGG + Intergenic
1178758468 21:35376603-35376625 GGAGAGCAAATATCTCTCTGAGG + Intronic
1179369072 21:40787236-40787258 GAAGAGCACAAAACAATTTAAGG + Intronic
949508087 3:4745253-4745275 GGAGAGCAGAGATGACTCTAGGG - Intronic
950803137 3:15571586-15571608 GGAATGCACATGTCACATTACGG + Intronic
951322363 3:21260927-21260949 GGAGAGCATATGTCACTTACCGG - Intergenic
954120323 3:48494726-48494748 GGAGAGCAGGTATCTCTTTGGGG + Intronic
954240203 3:49287702-49287724 CGAGAGGGCAGATCACTTTAGGG - Intronic
957294414 3:78318746-78318768 GGAAAGCACTTATCACATTAGGG + Intergenic
958624608 3:96607942-96607964 GGAGAGCACAGATGATTTTTAGG - Intergenic
960978604 3:123201368-123201390 GGAGTGGACATAACACTTGATGG - Intronic
961952333 3:130762734-130762756 GGAGAGCACATTTCCCTTAAGGG + Intergenic
963174036 3:142280152-142280174 GGAGAGCACGTGGCATTTTAAGG + Intergenic
964800169 3:160547690-160547712 GGAGAGCACAGAGGATTTTAGGG - Intronic
968952875 4:3703625-3703647 GGAGAGCTCCCATCACTGTAAGG + Intergenic
969475173 4:7418276-7418298 GGACAGCTCATATCACTGAATGG - Intronic
972260276 4:37401167-37401189 AGAGAGCACAGATAAGTTTAGGG - Intronic
972804920 4:42519413-42519435 GGAGAGCAGACATCATTGTAGGG - Intronic
973718072 4:53697326-53697348 GGAGTGCAGATATCTCTTTGAGG + Intronic
976989360 4:91345807-91345829 GGAGAGCACAGGGCAATTTAGGG - Intronic
978019089 4:103786212-103786234 GGAGAGCATATGGCACTTCAAGG + Intergenic
978879436 4:113683439-113683461 GAAGAGCACATGACACTTAAGGG + Intronic
981043491 4:140244651-140244673 GGAGACCACACATCATGTTATGG + Intergenic
981408933 4:144404987-144405009 GCAAAGTACATTTCACTTTATGG + Intergenic
983164773 4:164461504-164461526 GAAGACCACATATCATTTCAAGG + Intergenic
983744061 4:171172547-171172569 GGAGTGCAAATATCACTTCGTGG + Intergenic
984027733 4:174564730-174564752 GTAGAGCACAGGTCACTTTTAGG - Intergenic
986467011 5:8035758-8035780 GGAGATCACGTCTCATTTTAGGG + Intergenic
987629223 5:20446175-20446197 ACCGAGCACATGTCACTTTAGGG + Intronic
989148985 5:38279394-38279416 GGAGTGCAGATATCTCTTCAAGG - Intronic
994588669 5:101745626-101745648 GGAGTGCAAATATCTCTTTGAGG + Intergenic
994787071 5:104179259-104179281 GGCGAGCACATAGCATTTCAAGG + Intergenic
995122701 5:108552717-108552739 GGAGAGCACATGTGTTTTTATGG - Intergenic
997871762 5:137512071-137512093 GCAGAGCACAGAGCATTTTAGGG + Intronic
998571656 5:143264681-143264703 GGTGAGAAGATCTCACTTTAGGG + Intergenic
999494968 5:152087737-152087759 TGAGAGCACATTTCACTTTTTGG + Intergenic
1002091475 5:176809344-176809366 GGAGAGCTCATATCTCTTTGTGG + Intergenic
1002833009 6:841282-841304 AGAGAGCACATACCACGGTATGG - Intergenic
1005181887 6:23115587-23115609 GGAGAGCACATAGCATTTCCAGG - Intergenic
1006215848 6:32442092-32442114 TGAGAGAACATTTCTCTTTAGGG + Intronic
1007482028 6:42156567-42156589 GGAGAGCACGTTTCCCTTTGGGG - Intronic
1007546323 6:42697510-42697532 GGAGATCACCTGGCACTTTAGGG + Exonic
1009833062 6:68963734-68963756 GGAGAGCAGACATCTCTTAATGG - Intronic
1010574328 6:77512791-77512813 GGAGAGCACATGGCACTTTCAGG - Intergenic
1011715006 6:90096365-90096387 GGAGAGGACAGAGCACATTAAGG - Intronic
1012641118 6:101615590-101615612 GGAGAGCAATTATCTCTTCATGG + Intronic
1013389319 6:109667229-109667251 GAAGTGCACATATCTCTTCAGGG + Intronic
1014331320 6:120068503-120068525 GGAAAGGACATATTACTTTTAGG + Intergenic
1014376516 6:120681550-120681572 GGAGAGCAAAGATCACCTGATGG - Intergenic
1014504952 6:122243350-122243372 AGAGATCACACATCACTTTAGGG - Intergenic
1016078251 6:139823872-139823894 GGAGAAATCATATCACTTTCAGG + Intergenic
1018622153 6:165740138-165740160 GGAGTGCAGATATCTCTTCAAGG - Intronic
1020579932 7:9984361-9984383 GGAGTGCAGATATCTCTTTGAGG + Intergenic
1020718966 7:11717304-11717326 GAAAAGCACAGATCACTTAAGGG - Intronic
1026499337 7:70929917-70929939 GGAGTGCAAATATCTCTTCAAGG + Intergenic
1028351682 7:89857420-89857442 AGAGAGCACATAGCAGTTGAAGG + Intergenic
1030523541 7:110627570-110627592 GGAGAGAACAGAGCACTTTGAGG + Intergenic
1030536238 7:110770836-110770858 GTGTAGCACATGTCACTTTATGG + Intronic
1035898177 8:3428182-3428204 GTAGCTCACATATCACTTTTAGG - Intronic
1038172278 8:25146866-25146888 GGAGTGCATATATCTCTTCAAGG - Intergenic
1039183415 8:34891303-34891325 GGAGAGCACATGGCACTTTCAGG + Intergenic
1039683531 8:39769769-39769791 GGAGAGCCAATAAAACTTTATGG - Intronic
1040127795 8:43758104-43758126 TGGGAGCCCATATCAGTTTAGGG + Intergenic
1042066637 8:64884167-64884189 GAAGAGCACATATCACCATGAGG - Intergenic
1045992061 8:108319606-108319628 GTAGAGCACAGATAACTTTTAGG - Intronic
1046857549 8:119050394-119050416 GAAGAAATCATATCACTTTAAGG - Intronic
1047632202 8:126720607-126720629 GGAGAGCACACAGTACATTAAGG + Intergenic
1048671329 8:136725425-136725447 GGAGTGCAAATATCTCTTTAAGG - Intergenic
1050237037 9:3592846-3592868 GGAGAAAACAAATCACTTCAAGG + Intergenic
1052089287 9:24307682-24307704 GGAGTGCACATATCTCATCAAGG - Intergenic
1052381505 9:27775814-27775836 GTAGAAATCATATCACTTTATGG + Intergenic
1052627673 9:30998769-30998791 AGAATGCAGATATCACTTTAGGG - Intergenic
1052642172 9:31182355-31182377 GGAGTGCAAATATCTCTTCAAGG - Intergenic
1054896503 9:70318987-70319009 GGAGAGCACAAATTACTGTATGG + Intronic
1056292180 9:85154777-85154799 GCAGAGCACAGATGACTTTCAGG + Intergenic
1058279855 9:103100496-103100518 GAAGAGCATGTACCACTTTATGG - Intergenic
1203562455 Un_KI270744v1:70732-70754 GGAGAGCAAAGATAACTTTCTGG - Intergenic
1187448797 X:19379122-19379144 TGAGAGAACTTATAACTTTAAGG + Intronic
1188848338 X:35101766-35101788 TGAGAACACATATCATCTTAAGG - Intergenic
1189347048 X:40249618-40249640 GGACAGCAGATATCATATTAAGG + Intergenic
1189759753 X:44309428-44309450 AGAGAGCCCATTTGACTTTACGG - Intronic
1190100847 X:47521912-47521934 GGTGTGCAAATATCACTTCAAGG - Intergenic
1191832328 X:65429309-65429331 GGAGAGCCCATATCAATTGGGGG - Intronic
1193751284 X:85348036-85348058 GGAAAGCACACATCACTAGAGGG + Intronic
1193790779 X:85813177-85813199 GGAGAGCACATGGCATTTCAAGG + Intergenic
1197356184 X:125439372-125439394 GGAGAGCACACATCATCTCAAGG - Intergenic
1199812447 X:151363788-151363810 GGAGTGCAGATATCTCTTTGAGG + Intergenic