ID: 1127337789

View in Genome Browser
Species Human (GRCh38)
Location 15:58006789-58006811
Sequence TGATGCACAAATTCTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127337786_1127337789 4 Left 1127337786 15:58006762-58006784 CCAAAGCAGGGAAAATTTTGAGT 0: 1
1: 0
2: 0
3: 20
4: 243
Right 1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 171
1127337784_1127337789 6 Left 1127337784 15:58006760-58006782 CCCCAAAGCAGGGAAAATTTTGA 0: 1
1: 1
2: 3
3: 36
4: 309
Right 1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 171
1127337785_1127337789 5 Left 1127337785 15:58006761-58006783 CCCAAAGCAGGGAAAATTTTGAG 0: 1
1: 0
2: 4
3: 35
4: 300
Right 1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127337789 Original CRISPR TGATGCACAAATTCTCAGCT GGG Intronic
900789803 1:4672470-4672492 AGATGGGGAAATTCTCAGCTTGG + Intronic
902960842 1:19961899-19961921 TGATTAACATGTTCTCAGCTTGG + Intergenic
904432283 1:30472095-30472117 TGATGCACTCATGCTCAGCCTGG - Intergenic
904739145 1:32658813-32658835 TGAGGCACAAATACTCTGATTGG + Intronic
907873555 1:58465048-58465070 TTCTGCACACATTCTCAGCCTGG + Intronic
908712920 1:67038328-67038350 TGCTGCACAAATTGTCTGCCTGG - Intronic
912216936 1:107625207-107625229 TGATCCACAAATTCTTAATTAGG + Intronic
915203115 1:154248519-154248541 TGATTTAAAAATTCTCGGCTGGG + Intronic
915582368 1:156822196-156822218 TGAAGCCCAAATTATCATCTGGG - Intronic
917365265 1:174224357-174224379 TCCTGCCCAGATTCTCAGCTGGG - Intronic
919595595 1:199557670-199557692 TGATCCAAAAATTCCCTGCTGGG + Intergenic
919836932 1:201581353-201581375 TGATGCTCATTTTCTCAGATGGG - Intergenic
922185212 1:223268470-223268492 TGATGCTTCAGTTCTCAGCTGGG - Intronic
922480471 1:225937164-225937186 CAATGCACACATTTTCAGCTGGG - Exonic
923449940 1:234107096-234107118 TGATGCAGAGGTGCTCAGCTCGG - Intronic
1064173123 10:13051399-13051421 TGAAGCCCAAAATCTAAGCTGGG - Intronic
1066444744 10:35471476-35471498 TGATCCACAATTGCTCATCTTGG - Intronic
1066669074 10:37817794-37817816 TGTAGCACAAAGGCTCAGCTGGG - Intronic
1067514757 10:46929112-46929134 ATATTCTCAAATTCTCAGCTGGG - Intronic
1067647498 10:48122701-48122723 ATATTCTCAAATTCTCAGCTGGG + Intergenic
1069916618 10:71790635-71790657 TGGTGCACGAACTCTCAGCCTGG + Intronic
1072310056 10:94145949-94145971 TGCTGCACACATTCTCACCCTGG - Intronic
1073438227 10:103535401-103535423 GGATGCACAGTTGCTCAGCTTGG + Intronic
1074889025 10:117720016-117720038 GGGTGCACAAATTCTAAGGTAGG + Intergenic
1074997217 10:118768117-118768139 TGATGCTTAAACTCTCACCTCGG - Intergenic
1075959262 10:126553589-126553611 AGATACACAAATTCTTAGCCGGG + Intronic
1077749025 11:4943055-4943077 TAATTCACATATTCTCTGCTTGG + Intronic
1078365393 11:10702144-10702166 TGATGCACCAGTTCTCAAATTGG + Intergenic
1078510527 11:11981149-11981171 TGCTGCATAACTTCACAGCTGGG + Intronic
1081218162 11:40427525-40427547 TGAATCACAAATTCTCAGGTAGG + Intronic
1081341118 11:41928815-41928837 TGATTAAAAAGTTCTCAGCTTGG - Intergenic
1084522897 11:69675310-69675332 TCAGGCACAAATGCTCCGCTTGG + Exonic
1084574444 11:69979852-69979874 TCATGGAGAAAGTCTCAGCTTGG + Intergenic
1085452012 11:76639829-76639851 AGATGCAGAAAGTCACAGCTTGG + Intergenic
1085659868 11:78353957-78353979 TGAATCACAAATTCTAGGCTGGG - Intronic
1087108346 11:94434582-94434604 TCATGCCCTTATTCTCAGCTGGG + Intronic
1089762772 11:120740488-120740510 TGATGCTCAGAGTCCCAGCTGGG - Intronic
1091147729 11:133294587-133294609 GGATGCCTAAATTATCAGCTTGG - Intronic
1092022533 12:5214439-5214461 TGATGCACAAGTCCTGGGCTTGG + Intergenic
1092266933 12:6988747-6988769 TGAGGATAAAATTCTCAGCTTGG + Intronic
1093709830 12:22317831-22317853 TGATGCACAACCTCTAAGATGGG - Intronic
1094277943 12:28699986-28700008 AGATGCAAAAATTCTCACCATGG + Intergenic
1094749095 12:33384702-33384724 AGATGCACAAATTTTTAGTTAGG + Intronic
1097721377 12:63025225-63025247 TGCAGGCCAAATTCTCAGCTTGG - Intergenic
1097898010 12:64845131-64845153 TGATCCAAAAATTCCCTGCTGGG - Intronic
1098098318 12:66984939-66984961 TTATCCACATATTGTCAGCTGGG + Intergenic
1099300655 12:80890784-80890806 AAATGCATAAAATCTCAGCTTGG - Intronic
1099653826 12:85463923-85463945 TGATGGTCAAATTCTCACCCTGG + Intergenic
1101888510 12:108690444-108690466 TGATGCAAAAATTATTTGCTTGG - Intronic
1102246117 12:111357120-111357142 TGATGCAGCAATTCACTGCTTGG - Intergenic
1106158897 13:27183302-27183324 TGATGCTTAAATTTCCAGCTTGG - Intergenic
1108543061 13:51462235-51462257 TAATGCAGAAATTGTCAACTGGG - Intergenic
1110178715 13:72589496-72589518 TGATGCTTAAATTGTCATCTTGG - Intergenic
1112887393 13:104191490-104191512 AGATGCATAAATTCCCAGGTAGG - Intergenic
1113452988 13:110425366-110425388 AGCTGCACAAATGCTCAGCAGGG - Intronic
1113503413 13:110796100-110796122 TGATGCTCCCATACTCAGCTTGG - Intergenic
1113776421 13:112948307-112948329 AGATTTAAAAATTCTCAGCTTGG - Intronic
1116946357 14:50838922-50838944 TCATGTACAAATTCTCGTCTTGG - Intergenic
1117098371 14:52320357-52320379 TAATGCACAAATTCTCTTTTGGG - Intronic
1119104424 14:71910760-71910782 AGATGCCCAAATTTCCAGCTTGG + Intergenic
1123938806 15:25206869-25206891 CGATGCACCAAGTCTCAGATGGG - Intergenic
1127337789 15:58006789-58006811 TGATGCACAAATTCTCAGCTGGG + Intronic
1130527582 15:84720643-84720665 TGATACACAAATTCTAGGCTAGG + Intergenic
1130542895 15:84834815-84834837 ACATGCACAAATGCACAGCTGGG + Intronic
1131341902 15:91610356-91610378 TCATCCACAAATTCTCAACATGG - Intergenic
1131680789 15:94720788-94720810 TGATGTACATATTCTCATTTAGG + Intergenic
1132034610 15:98472043-98472065 TAAGGCACACATTCTCAGCAAGG - Intronic
1132540509 16:506470-506492 TCTTCCACATATTCTCAGCTCGG + Intronic
1133028647 16:2999335-2999357 AGAGGGACAAACTCTCAGCTAGG + Intergenic
1133405766 16:5523318-5523340 TGATGTACCAATTTCCAGCTGGG + Intergenic
1133968800 16:10551963-10551985 TGATGCACAGAATCACAGCCAGG - Intronic
1134464233 16:14459004-14459026 TGATGCTCTGATTTTCAGCTTGG - Intronic
1136155330 16:28378257-28378279 TTATAAACAAATTCACAGCTGGG - Intergenic
1136207753 16:28737031-28737053 TTATAAACAAATTCACAGCTGGG + Intergenic
1138217341 16:55215752-55215774 TCAAGCAGAAATTCTCAACTGGG + Intergenic
1139929888 16:70517652-70517674 TGCTGGACACATTCTCAGCCAGG + Exonic
1140249108 16:73279151-73279173 TTTTGCACAAATTTTAAGCTAGG + Intergenic
1144093036 17:11874891-11874913 AGAAGCAGACATTCTCAGCTGGG - Intronic
1144757492 17:17688537-17688559 TGCTGCACAGTTCCTCAGCTGGG + Intronic
1146580822 17:34037147-34037169 TGTAGCACAAAGGCTCAGCTGGG - Intronic
1149627989 17:58093532-58093554 TGATGCACAAAGGCTTAACTGGG + Exonic
1150122160 17:62613025-62613047 TGTAGCACAAAGGCTCAGCTGGG + Exonic
1150708157 17:67507207-67507229 TTCTGCACACATTCTCAGCGTGG - Intronic
1151025961 17:70677321-70677343 TGATGCCCAAGTTTTCAGTTTGG + Intergenic
1156081615 18:33342540-33342562 TGCTGCTCAAAGTGTCAGCTTGG - Intronic
1157908299 18:51589825-51589847 TGATGCACAGGTTCCCAGCTAGG + Intergenic
1159814803 18:73059549-73059571 TGATGCCGAAAGTCTCAGCAGGG - Intergenic
1161154952 19:2727699-2727721 TGTTGCACAAGTTATTAGCTCGG - Intronic
1162212420 19:9102967-9102989 TGATGCTCCGATTCTGAGCTTGG + Exonic
1167829279 19:52005607-52005629 TTCTGCACAAATTCACAGTTGGG - Intronic
930258810 2:49121577-49121599 TGATACACAGAACCTCAGCTAGG - Intronic
933187712 2:79297079-79297101 AGATGCCCAAATTCTCAGTAAGG - Intronic
933687727 2:85156804-85156826 TGATGAATAAGTTCTCAGCTTGG + Intronic
941274217 2:163470403-163470425 TCAAGCACAAATTCTTACCTAGG - Intergenic
941294399 2:163718008-163718030 AGATGCACAGATTGTCTGCTTGG - Intronic
944327198 2:198419766-198419788 TGATTCAAAAAATTTCAGCTGGG - Intronic
947811279 2:233005393-233005415 TTCTGCCCAGATTCTCAGCTGGG + Intronic
1170778766 20:19404586-19404608 TCATGCCCAAATCATCAGCTAGG - Intronic
1170979458 20:21197572-21197594 TGATGTTCAAATCCACAGCTGGG - Intronic
1173720683 20:45254935-45254957 TATTGCACAAAGTCTCAGCAGGG - Intergenic
1176980174 21:15372731-15372753 TGATGCACAAACACTCATCTAGG + Intergenic
1177014797 21:15773145-15773167 GGAGGCTCAAATTCCCAGCTGGG + Intronic
1178477239 21:32947661-32947683 TGATGAAAATATTCTCAACTTGG - Intergenic
1178495470 21:33082168-33082190 TGATTAACAAATTCTCACATGGG - Intergenic
1182806209 22:33072698-33072720 TGATGGAGCACTTCTCAGCTTGG + Intergenic
1183017245 22:34999300-34999322 TGATGCTCAAATGCTAGGCTTGG + Intergenic
949649110 3:6134432-6134454 TTGTGCTCAAATTCTCATCTTGG + Intergenic
953370900 3:42387722-42387744 TGAGGCAGAATTTCTGAGCTTGG - Intergenic
955712005 3:61789935-61789957 TGATGCACAAGATCTCAACCAGG - Intronic
955719096 3:61862973-61862995 TGATGCCTAAACTCTCATCTAGG + Intronic
956090756 3:65664143-65664165 TGCTGAACAAATTGTCACCTAGG + Intronic
958456678 3:94340465-94340487 TGATCCAAAATTTCTTAGCTTGG - Intergenic
958645521 3:96867215-96867237 TTATGCACAAATACTCATCGAGG - Intronic
959217356 3:103468805-103468827 TGATGGAAAAATTCACACCTAGG - Intergenic
959884892 3:111488144-111488166 TGGTGCCCACCTTCTCAGCTTGG - Intronic
960151155 3:114250205-114250227 TGAGTGACAAGTTCTCAGCTGGG - Intergenic
960568432 3:119160597-119160619 TAATGCAAAAATTCTTAACTTGG + Intronic
961630403 3:128294453-128294475 TGACACATAAATTCTCTGCTAGG + Intronic
962223498 3:133584712-133584734 TGAAGCATGAATTCTCAGCAGGG + Intronic
963297899 3:143566850-143566872 TGACCCCCAAAGTCTCAGCTGGG + Intronic
963354477 3:144193398-144193420 TGATGCAAAAATTCTCAGCAAGG - Intergenic
964895988 3:161596313-161596335 AGATGCAAAAATTCTAAGCGAGG - Intergenic
965866282 3:173207884-173207906 TTATGCACAAATTCACATATAGG - Intergenic
967075912 3:186001836-186001858 TGAAGCACACACTCTCAGCTGGG - Intergenic
967251153 3:187540429-187540451 TGACGCTCAAATTCCCAGTTTGG - Intergenic
967826948 3:193884627-193884649 AGATACAGAAATTCTCTGCTCGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969502101 4:7559426-7559448 TCCTGCATAATTTCTCAGCTAGG - Intronic
973028957 4:45310957-45310979 GGATGCACACCTGCTCAGCTAGG - Intergenic
974321435 4:60354911-60354933 TGTAGCACAAAGGCTCAGCTGGG - Intergenic
976424704 4:84888780-84888802 TGTTGCAAATATTCTCACCTTGG - Intronic
978380490 4:108123189-108123211 TGTTGAGGAAATTCTCAGCTTGG + Intronic
980956637 4:139435302-139435324 TGATGCAAAAATCCTCAGAAAGG - Intergenic
981838198 4:149079991-149080013 TGATGCACTCATTCTCAACTTGG + Intergenic
990554164 5:56913347-56913369 TGAAGCATAAATGCTGAGCTGGG - Intronic
991664148 5:68980740-68980762 TGATGCAGCAATTCACTGCTGGG + Intergenic
993655511 5:90573513-90573535 AGATACACAAATTCTTACCTTGG - Intronic
994111089 5:96005253-96005275 TGGTGAAGAAAATCTCAGCTAGG + Intergenic
994258380 5:97627817-97627839 TAAAGCACAGATTCTAAGCTTGG - Intergenic
994943321 5:106353021-106353043 AGATGCAAAAATTCTCAGCCTGG - Intergenic
996135767 5:119840390-119840412 TGATGCACTCATCATCAGCTGGG + Intergenic
999466034 5:151805992-151806014 AGATGCAGCAATCCTCAGCTTGG + Exonic
1000536299 5:162482573-162482595 TAGTGCAAAAATGCTCAGCTGGG - Intergenic
1002162456 5:177323592-177323614 TGATGCAAAGATCCTCAGCAGGG + Intergenic
1003774829 6:9348583-9348605 TGATGCACAAATGCTCGGCTCGG + Intergenic
1006206571 6:32349031-32349053 TGAGGGACAAAATCTCAGCAGGG + Intronic
1006262962 6:32892424-32892446 TGGTGAAAAAATTCTCAGCAAGG + Intergenic
1006387788 6:33741297-33741319 TGATGCACTAACTCACAGCCAGG + Intronic
1008153560 6:47987107-47987129 TAATGAACAAATTGTCACCTAGG + Intronic
1020119268 7:5493836-5493858 TTAAGCAGAAATTCTCAGCCAGG + Intronic
1022024730 7:26436955-26436977 TAATGCACTATTTCTCAGATTGG + Intergenic
1022213363 7:28233831-28233853 TGATACACATATTCTAGGCTAGG - Intergenic
1022551689 7:31246285-31246307 TGATATTCAAAATCTCAGCTTGG + Intergenic
1024528611 7:50371694-50371716 GGATGCACACTTCCTCAGCTTGG - Intronic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1033509709 7:142047709-142047731 TGATGGAAATATTCTCAGCTCGG + Intronic
1033512086 7:142069323-142069345 TGATTCCCAAAGACTCAGCTGGG + Intronic
1034231993 7:149537477-149537499 TCATACTCAAATGCTCAGCTAGG + Intergenic
1036413143 8:8521031-8521053 TGATGCTAAAAGTCTCACCTTGG - Intergenic
1036558577 8:9882844-9882866 ATTTGCACAAATTCTCATCTTGG - Intergenic
1038832340 8:31075289-31075311 TGATGAATAAATTCTAAGCAGGG + Intronic
1040307618 8:46220378-46220400 TGAGTCACAACTTCTCACCTAGG - Intergenic
1041407628 8:57517672-57517694 TTATGCACAAAATCCAAGCTGGG - Intergenic
1041416501 8:57615854-57615876 TGATCCAGCAATTCTCTGCTAGG + Intergenic
1043013955 8:74914666-74914688 TGAAGCACAACTTCACATCTTGG - Intergenic
1044598951 8:93984656-93984678 TGATGCACAAATCCTCATTAAGG - Intergenic
1045677020 8:104618490-104618512 TGATACCCAGATTCTCAGCTGGG + Intronic
1046584875 8:116139017-116139039 TGCTGCACTACTTCCCAGCTAGG + Intergenic
1046718875 8:117596737-117596759 AGAAGCACAAATTCCCATCTAGG - Intergenic
1051051185 9:12933344-12933366 TGCTACATAAATTCTCAGATGGG + Intergenic
1052873333 9:33530176-33530198 TGCTGCAGTATTTCTCAGCTAGG + Intronic
1053310649 9:37016816-37016838 AGATGCTGAAATTCTCAGCCTGG + Intronic
1053485263 9:38448592-38448614 AGATGCAAAAATTCTCAACAAGG - Intergenic
1054942779 9:70761633-70761655 TGATGAACAGATGCTGAGCTTGG + Exonic
1056082423 9:83109717-83109739 TGATTAACAAATTGTCAGCATGG - Intergenic
1058155676 9:101512072-101512094 TGATGCCCTAAGTCTCACCTGGG + Intronic
1059501481 9:114757588-114757610 GGATTCAGAAATGCTCAGCTTGG - Intergenic
1059926482 9:119214547-119214569 TGAAACACAAGTTCTGAGCTAGG + Intronic
1060067794 9:120518879-120518901 AAAAGCACAAATTCTCAGCTGGG + Intronic
1187581549 X:20612665-20612687 TGATGTGTAAGTTCTCAGCTGGG + Intergenic
1190596769 X:52059715-52059737 TCATGTACAATTTCTCATCTGGG - Intergenic
1190612055 X:52194358-52194380 TCATGTACAATTTCTCATCTGGG + Intergenic
1190906204 X:54730842-54730864 TGATGCCCAAAATCTCACCTCGG - Intergenic
1191082878 X:56532272-56532294 AGATGCACAAATACTCAGGCAGG + Intergenic
1195489059 X:105444801-105444823 TGATGCAAAAATCCTCAACAGGG - Intronic
1196922511 X:120599164-120599186 TGATGCAAAAATCCTCGGCCGGG + Intronic
1198009163 X:132533069-132533091 TCATGAACAAATTCTGAGGTTGG - Intergenic
1201182373 Y:11361057-11361079 TCATGCACAAATTCACACATAGG + Intergenic