ID: 1127342863

View in Genome Browser
Species Human (GRCh38)
Location 15:58065710-58065732
Sequence GCGAGCGCGCCCCCGGGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127342863_1127342871 5 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342871 15:58065738-58065760 TATAGGCAGGTGTCAAGCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 158
1127342863_1127342873 26 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342873 15:58065759-58065781 GGCTCTTCTTATTGGACGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1127342863_1127342870 4 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342870 15:58065737-58065759 ATATAGGCAGGTGTCAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 124
1127342863_1127342872 18 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342872 15:58065751-58065773 CAAGCTGGGGCTCTTCTTATTGG 0: 1
1: 0
2: 0
3: 6
4: 116
1127342863_1127342869 3 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342869 15:58065736-58065758 TATATAGGCAGGTGTCAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1127342863_1127342867 -8 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342867 15:58065725-58065747 GCGCTCGCCTGTATATAGGCAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1127342863_1127342874 27 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342874 15:58065760-58065782 GCTCTTCTTATTGGACGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127342863 Original CRISPR GCGAGCGCGCCCCCGGGCCG CGG (reversed) Exonic
901086732 1:6615195-6615217 TCCCGCGCGCCCCCGGCCCGAGG + Intronic
903349945 1:22711300-22711322 GCGAGCGCCGCCCAGGGCTGGGG + Intronic
905137025 1:35808056-35808078 GCGTGCGCGGCCCCGGGCGCGGG - Intergenic
905847017 1:41241941-41241963 GCGCCTGCTCCCCCGGGCCGGGG - Intronic
907442878 1:54489428-54489450 GCGCGGGAGCCCCCGGGCTGGGG + Intergenic
907486422 1:54781267-54781289 GCGAGGGCGCCAGCGCGCCGCGG - Exonic
909629876 1:77759906-77759928 GGGAGCCCGCCCCAGGGGCGGGG + Intergenic
910251177 1:85200855-85200877 CCGAGCCTGCCCCCGGGACGGGG - Exonic
913109174 1:115642238-115642260 GGGAGGGAGCCCCCGGCCCGAGG - Intronic
914702943 1:150150375-150150397 GCGGGGGCGCGGCCGGGCCGTGG - Intronic
915142379 1:153775635-153775657 TCGAGCTCGCGCCCTGGCCGCGG + Exonic
915224962 1:154405438-154405460 CCGAGCGCGGCGCGGGGCCGAGG + Exonic
915429769 1:155857223-155857245 GCGTGCGCGTCCCCGAGCCTCGG + Exonic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
918016004 1:180632586-180632608 GCGAGGGCAGCCCCGGGTCGCGG + Intronic
918058967 1:181045842-181045864 GCGAGCGGGAACCCGGGCTGCGG + Intronic
918215896 1:182391822-182391844 CCGGGGGCGGCCCCGGGCCGCGG - Exonic
1062843852 10:689890-689912 GCGCGCGCGTCACGGGGCCGCGG + Intergenic
1065687744 10:28302881-28302903 GCGAGTGCGCCTCCTGCCCGCGG - Intronic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1070162582 10:73874714-73874736 GCGAGGGCGGCTCCGGGGCGGGG - Intergenic
1072151703 10:92689751-92689773 GCAAGCGCGTCCCGGGGGCGGGG + Intergenic
1072151746 10:92689868-92689890 GCGAGCGCGGCCCCACCCCGCGG + Intergenic
1072555817 10:96513225-96513247 GAGAGGGCGCCCAGGGGCCGGGG - Intronic
1073363561 10:102918861-102918883 GCCCGCGCTCCCCCGGGCTGTGG - Exonic
1074951548 10:118342099-118342121 GCTTCCGCGGCCCCGGGCCGGGG + Intronic
1076166618 10:128287091-128287113 GCGCACGGGTCCCCGGGCCGCGG + Intergenic
1076793722 10:132789059-132789081 CTGACCGCGCCCCCAGGCCGGGG + Intergenic
1077253854 11:1572069-1572091 GGGAGCGCTCGCTCGGGCCGGGG + Intergenic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1082003703 11:47408539-47408561 CCGGGGGCGGCCCCGGGCCGGGG + Intronic
1084019475 11:66409218-66409240 GCGAGCCCCGCGCCGGGCCGGGG + Intergenic
1087761983 11:102111211-102111233 CCGAGCGCCCCCCCGGTCTGAGG - Intronic
1090285607 11:125496320-125496342 GCGGGCGCGCCCCCGGAGCCCGG - Intronic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1096106310 12:48998563-48998585 GCGGGCGGGGCCCCTGGCCGAGG - Exonic
1096668231 12:53181035-53181057 GAGAGCCCTCTCCCGGGCCGGGG - Intronic
1102144661 12:110645764-110645786 GAGAGCACGCCCCTGGGCCAGGG - Intronic
1102645427 12:114400625-114400647 GCGAGCGCGCCCGGAGGCGGAGG + Intronic
1103364067 12:120369460-120369482 GCGGCCGGGCCCCCGCGCCGGGG - Intergenic
1103764615 12:123271491-123271513 GCGCGCCCGGCCCCGGCCCGGGG - Intronic
1106109085 13:26760927-26760949 GCGAGGGCGGCCCAGGGGCGCGG + Intergenic
1106157292 13:27171175-27171197 CAGAGCGCGGCCCCGGGCCGGGG - Intronic
1107770933 13:43786985-43787007 GCGCGCGCGCCCACGGGGTGGGG + Intergenic
1108541709 13:51452364-51452386 GCCCGCGGGCCGCCGGGCCGGGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1113546358 13:111153996-111154018 GCGCGGGCGGCCACGGGCCGAGG + Intronic
1113820364 13:113209012-113209034 GCGCGCGCGCCCCGAGGCCCTGG - Intronic
1114989056 14:28264440-28264462 CCGGGAGCGCCCCCGGGCCGCGG + Intergenic
1115502257 14:34060319-34060341 TCCAGCGCAGCCCCGGGCCGAGG + Intronic
1121253007 14:92513631-92513653 GCGGCCGCGCCCCCGGGGCCGGG - Intergenic
1122220825 14:100238511-100238533 CCGAGTGCGGCCCCGGCCCGAGG + Intronic
1122880741 14:104689524-104689546 GCGAGCGCGGGCCGGGGGCGGGG - Intergenic
1122904593 14:104795869-104795891 GGGAGCGCGCGGCCGGGCTGAGG + Intergenic
1123037979 14:105479048-105479070 GTGAGTGCGCGCCCGGGCCCCGG + Intronic
1124469347 15:29969035-29969057 CGGAGCGCGCCGCCGGGCCACGG - Intergenic
1124629460 15:31328225-31328247 CTGAGCGCGCGCCCGGGCAGCGG - Intronic
1126746297 15:51829619-51829641 GCGTGCGCACTCCCGTGCCGCGG - Exonic
1126823698 15:52529027-52529049 GCGAGCGCTCCACCTGCCCGGGG + Exonic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1127342908 15:58065896-58065918 GCGCTCCCGCCCCCCGGCCGCGG + Exonic
1127674820 15:61228965-61228987 GGGAGCGGGCGCCCGGGGCGCGG - Intronic
1127867253 15:63042762-63042784 GCGAGCGCGCGGTCGGGCGGAGG - Exonic
1128424117 15:67521808-67521830 GCGGGCGCGTCCTCGGGCCTAGG + Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132251921 15:100341133-100341155 GCGGGCGCGGCCCGGCGCCGCGG - Exonic
1132544737 16:527958-527980 GCGAGCGGGCCCGGGGGCCGGGG + Exonic
1132744438 16:1430843-1430865 GCTGGCTCGCCCCCGGGCCCCGG - Intergenic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1133219917 16:4315644-4315666 GCGGCCCCGCCCCCGGCCCGAGG - Intronic
1136858631 16:33681125-33681147 GGGAGCGGGTCCCGGGGCCGGGG + Intergenic
1137683088 16:50368441-50368463 GCCGCCGCACCCCCGGGCCGGGG - Intronic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138660798 16:58515885-58515907 GCGAGCGAGCCGGCGGGCGGAGG + Exonic
1139465133 16:67150358-67150380 GCGAGCGCGCCGCGAGGGCGAGG - Exonic
1139597933 16:67968797-67968819 TCGGGCCCGCCCCCAGGCCGTGG - Intronic
1139776371 16:69319387-69319409 GCAAGCGCACCCCCTGGCGGGGG + Exonic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1142188483 16:88706144-88706166 GCGCGCCCGCCCAGGGGCCGCGG - Intronic
1142215534 16:88827910-88827932 GCGAGGGTGCCCCTGGACCGTGG - Intronic
1203120201 16_KI270728v1_random:1529619-1529641 GGGAGCGGGTCCCAGGGCCGGGG + Intergenic
1142611074 17:1109405-1109427 GCGAGCGCGAGCCCGAGCCCCGG - Intronic
1142671985 17:1491659-1491681 GGGAGAGTGCGCCCGGGCCGCGG - Intronic
1143016373 17:3893068-3893090 GCGAGCGCTGCCCGGAGCCGCGG - Intronic
1143321171 17:6070284-6070306 GCGACCCCTCCCCCGGGCGGCGG + Intronic
1145049509 17:19648584-19648606 CCGAGCGCGGCCACGGGCCAGGG - Intronic
1147612876 17:41811984-41812006 GCGGGCGCGCCGCCCGCCCGGGG - Exonic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1149663899 17:58352409-58352431 GTCAGCGGGCCCCCGGGGCGGGG + Intronic
1152706529 17:81846404-81846426 GCAGGCGCGTCCCCGGGCCAGGG - Intronic
1152744139 17:82031474-82031496 TCCAGCGCGACCCCGGCCCGGGG - Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152824961 17:82458838-82458860 GCGCGCGCCTCCCCGGCCCGCGG - Intronic
1153900553 18:9614348-9614370 GGGAAGGCGCCCCCGGGGCGGGG - Intronic
1154501079 18:14998342-14998364 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
1158435911 18:57435556-57435578 GCGAGCCCGCCCGCAGCCCGGGG + Intergenic
1160631214 18:80247435-80247457 GCGAGCGCGGGCCGGGGCCGGGG - Exonic
1160684455 19:427023-427045 GCTGGCGAGCCCCCGGTCCGGGG + Intronic
1160747979 19:720477-720499 GCGAGGGGGCGCCCGGGCCTGGG + Intronic
1161222070 19:3122427-3122449 GCGGGCTCCCCCTCGGGCCGTGG - Exonic
1161339015 19:3730521-3730543 ACGAGCGCTCCCGCCGGCCGAGG + Exonic
1161395858 19:4044535-4044557 GCGGGGGCGCCCGGGGGCCGGGG - Exonic
1161485813 19:4535118-4535140 GGGAGCGCCCCCCCGGGCTTAGG - Intronic
1163821544 19:19499137-19499159 GCGAGCCTGCCCCTGGGCAGTGG - Intronic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1166092517 19:40519528-40519550 GAGAGCGCGCCCCGGGCCGGCGG + Exonic
1166107744 19:40605689-40605711 GTGAGCGCGCCCCCGCGCGGAGG - Intronic
1166218808 19:41352809-41352831 GCGAGCACGGCCTCGGGCAGCGG + Exonic
1166538805 19:43592535-43592557 GCGAGCGCTCCCCCCAGCCCAGG - Exonic
1166807671 19:45496876-45496898 GCGCCCGCGACCCCGGGCCCAGG - Exonic
1167232137 19:48291411-48291433 GGGAGCGCGCCACCTGGCGGCGG + Intergenic
1167258393 19:48443979-48444001 GCGGGCGCCCCCTCGGGCCGTGG - Exonic
1167463855 19:49640047-49640069 GCGGGGGCGGCCCCGGGGCGGGG - Exonic
1168239527 19:55082187-55082209 ACGCGCCCGCCCCTGGGCCGGGG + Intronic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925730709 2:6917899-6917921 GCGCCCGCGCCCCAGGGCAGTGG + Intronic
926101663 2:10122285-10122307 GCGAGAGGATCCCCGGGCCGCGG - Intergenic
926216996 2:10912044-10912066 GCCTGCGCGCCCCGGGGCGGAGG + Exonic
926422867 2:12716649-12716671 GCGCCCGGGGCCCCGGGCCGCGG + Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
931517798 2:63059849-63059871 GTGAGTGCGCTGCCGGGCCGGGG + Intergenic
931602676 2:64019463-64019485 GCGGGCGCTCCCCCCGGCCCGGG - Intergenic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
932779114 2:74549086-74549108 CGGCGCGCGCCCCGGGGCCGAGG + Intronic
933847459 2:86337410-86337432 GCGCGCGCAGCCCGGGGCCGGGG + Intronic
935196816 2:100820855-100820877 GCGTGCGCGCCCTGGGCCCGCGG + Intronic
935255768 2:101308484-101308506 GAGAGCCCGGCCCCGGGCCCCGG + Exonic
937044256 2:118842912-118842934 GCGGGCGCGGCCCCGGCCTGTGG + Exonic
937951033 2:127388055-127388077 GCGGGCGCGCGCCCGGCCCAGGG + Intronic
938397841 2:130963936-130963958 GGGCGCGCGAGCCCGGGCCGGGG - Intronic
938500247 2:131828531-131828553 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
944495862 2:200306861-200306883 GCGACCGCGCCCCCGGGCCCCGG + Intronic
944770861 2:202912634-202912656 GCGAGCCCCGTCCCGGGCCGGGG - Intronic
945235020 2:207625440-207625462 GCGAGGGCGGGGCCGGGCCGTGG + Intronic
946219958 2:218217545-218217567 GTGAGCGCGCGCCCGGGGCCGGG + Intronic
946322241 2:218960832-218960854 GCGGGCGCGCCCCCGCTCGGTGG - Exonic
948824606 2:240568307-240568329 TCGAGCGCGGCGCGGGGCCGGGG - Intronic
1169214796 20:3786666-3786688 GCGGGCGCGTCGCCGGGCGGCGG + Exonic
1171896386 20:30813782-30813804 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1172064214 20:32207753-32207775 GCGAGCGGGCGCTCGGGTCGTGG + Exonic
1172146614 20:32762309-32762331 GCGGGGGCACCCCCGGGCGGGGG + Intergenic
1172702807 20:36863310-36863332 GCGGCCGAGCCCCCGGTCCGGGG - Exonic
1173807459 20:45935078-45935100 GCGCTCCCGCCCCCGGGCTGAGG - Intronic
1174287729 20:49484087-49484109 GAGAGCGCGCCCCGGCCCCGCGG - Intergenic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1174607057 20:51768505-51768527 GCGAGCTCGCCCCCTCGCTGCGG - Exonic
1175267002 20:57709319-57709341 GGGAGGGCGCGCCCGGGGCGCGG + Intronic
1175429602 20:58891946-58891968 GGGAGCGCGCGCCCGGGGCGGGG - Intronic
1176077298 20:63254297-63254319 GCGAACGGGCCCCGGGGCGGAGG + Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1178334675 21:31732292-31732314 GCGGCCGCGGCCGCGGGCCGGGG + Intergenic
1178416951 21:32412296-32412318 GCTGGGGCGCCCCCGGGGCGGGG - Intronic
1180042804 21:45288517-45288539 GCGAGGGGGCACCCGGGCTGAGG + Intergenic
1180699660 22:17774399-17774421 GCGCGGGCGCGTCCGGGCCGAGG + Intronic
1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG + Intronic
1181514369 22:23402677-23402699 GCGGGCGCGGGCCCGGGCTGGGG + Intergenic
1182603963 22:31489481-31489503 GGGACCGAGCCGCCGGGCCGGGG - Exonic
1183665014 22:39242197-39242219 GCGGGCGCGCGACCTGGCCGCGG + Intronic
1184663779 22:45977191-45977213 GCGAGCGCGCCCCAGGTAGGAGG + Intergenic
1184680750 22:46071214-46071236 TCCAGCGCGCCCCCGCCCCGCGG - Intronic
1184759516 22:46536843-46536865 GCGTGCGCGCCCGCAGGCGGCGG + Exonic
1184759799 22:46537754-46537776 GCGAGGGCGCGGCCGGGACGGGG + Intergenic
949559478 3:5188326-5188348 GGGCGCGCGGCCCCGGGCGGCGG - Intronic
952241367 3:31533461-31533483 CCGGGCGCGCCCCCTGCCCGTGG + Intronic
954327179 3:49869936-49869958 CCCAGCCCGCCCCCGGCCCGGGG - Exonic
954632826 3:52056372-52056394 GCGCGGGCGGCCCGGGGCCGGGG + Exonic
956061870 3:65356552-65356574 GCGTGCGCGCCTCCGGTCGGTGG + Exonic
956179084 3:66500918-66500940 GCGCGCGCGCTCTCTGGCCGCGG - Exonic
956658983 3:71581641-71581663 GCGAGCGAGCGAGCGGGCCGGGG - Intronic
956674923 3:71724969-71724991 GCGTCCTCGCCTCCGGGCCGGGG - Intronic
959067891 3:101676570-101676592 GCCAGCCCGCCCCCTCGCCGCGG + Intronic
966868586 3:184276092-184276114 GCTGGCCCGCTCCCGGGCCGCGG - Intronic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
968258194 3:197298013-197298035 GCGAGCGGGCCGGGGGGCCGCGG - Intronic
969344742 4:6563680-6563702 GTGAGCGCGGGCCCGGGGCGGGG + Intergenic
972686779 4:41360343-41360365 GCGCCCGCTCCCCCGGGCCCGGG + Intronic
975661072 4:76689526-76689548 GCCACCGCGCCACCGCGCCGCGG - Intronic
975986138 4:80202777-80202799 GGCAGCGGGCCCCCAGGCCGCGG - Exonic
979536202 4:121823477-121823499 GCCAGCGCGGCCCGGGTCCGCGG + Exonic
981348336 4:143700344-143700366 GAGAGCGCGCCCTTGAGCCGCGG + Exonic
984698225 4:182800129-182800151 GCGCGCGCTCGCCCGGGCCTGGG + Exonic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
986402718 5:7395861-7395883 GCGAGGACGACCCCGGGCCGGGG + Intergenic
990753223 5:59039886-59039908 GCGGGCGCGACCCCGGACGGCGG - Intronic
992473147 5:77077378-77077400 GCGAGCGCGCCCTGGAGCGGAGG - Exonic
992597317 5:78360061-78360083 GCGGCCGCGCCCCCGCCCCGGGG + Intergenic
999365447 5:151020742-151020764 GTGAGTGAGCCTCCGGGCCGGGG + Intronic
1001906570 5:175478490-175478512 GTGAGCGCGCGTCCGGGCCCGGG - Exonic
1002186137 5:177455641-177455663 GCGCGGGCGGCCCCTGGCCGGGG + Intronic
1002754711 6:148222-148244 GAGAGCACGCCGCCGGGCGGGGG + Intergenic
1006932423 6:37696290-37696312 GCGAGCCCGCCGCCCGGCCTTGG + Intronic
1008629370 6:53348735-53348757 GCGAGCGCGCGGCCGGGAAGCGG - Intronic
1014098201 6:117482670-117482692 ACGAGCGCGGCGCCGGGACGGGG - Exonic
1014798252 6:125749456-125749478 GCGAGCGCGGCCCCGCCCCCTGG + Intronic
1015366367 6:132401529-132401551 GCGGGCGCGCGGCCGGCCCGAGG - Exonic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1019765119 7:2844221-2844243 GCGAGGGCGAGCCCGGGCCGAGG + Exonic
1020136890 7:5592702-5592724 GCGGGAGGGGCCCCGGGCCGAGG - Intergenic
1022400100 7:30028583-30028605 GTGACCCCGCCCCCGGGCCGAGG + Exonic
1022715172 7:32891929-32891951 GCGCGCGCGTTCCCGGGCCGCGG - Intronic
1022750397 7:33218983-33219005 GCGAGCGGGAACCCGGGCTGCGG + Intronic
1029640228 7:101815799-101815821 GCGCGCGCGAGGCCGGGCCGCGG + Intergenic
1030121301 7:106112656-106112678 GCGTGGGCGCCCCCGGGTCAGGG - Intergenic
1031585944 7:123532822-123532844 GCGAGCCCCGTCCCGGGCCGGGG + Exonic
1032151647 7:129434491-129434513 GCGGGCGGGCCCCCGGTCCCAGG - Exonic
1033159073 7:138981199-138981221 GCCAGCGCGACCCCGGCGCGGGG + Exonic
1033220590 7:139524228-139524250 GGGAGCGCGGCGCCGGGACGCGG + Intronic
1034578843 7:152025617-152025639 GCGGCCCCGCCCCCGCGCCGCGG - Intergenic
1035265802 7:157689873-157689895 GGGAGCGCGCCTCCGAGCCATGG - Intronic
1035751962 8:2002510-2002532 GCGAAGGCGCCCCGGGGCAGCGG - Exonic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1037822500 8:22141719-22141741 GCGGGCGCGCCCCGCGGCCGGGG + Exonic
1038554069 8:28494358-28494380 GCGTGTGGGCCCCTGGGCCGGGG + Intronic
1039936593 8:42051627-42051649 GCGAGCGCGGGGCCGGGCGGCGG + Intronic
1040471419 8:47738234-47738256 GCGGGGGCGCCCCGGGGCCGCGG + Exonic
1041108822 8:54467005-54467027 CTGCGGGCGCCCCCGGGCCGCGG - Intergenic
1046547321 8:115668507-115668529 CCGAGCGGGCCGCGGGGCCGGGG - Intronic
1049268529 8:141682175-141682197 CCGAGCTCTCCCCCGTGCCGGGG + Intergenic
1052991821 9:34523032-34523054 GCGAGCGAGCGCCGCGGCCGCGG - Exonic
1053435194 9:38069366-38069388 GCGAGCCTGGCCCCGGGCCGCGG + Intergenic
1053749019 9:41235093-41235115 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1054254454 9:62799946-62799968 CTGAGCGTGCCCACGGGCCGCGG + Intergenic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1061129950 9:128703072-128703094 GCGAGGGCGTCGCGGGGCCGGGG - Intronic
1061976101 9:134068537-134068559 GGGAGCGCGCGCGCGGGGCGGGG + Intergenic
1062134499 9:134917830-134917852 GACAGCGAGCCCCCGGGCCATGG + Exonic
1062230509 9:135479562-135479584 GCGGGGGCGTCCCCGGGGCGCGG + Intronic
1062230874 9:135480554-135480576 GTGAGCGCGCCCTCGGGGAGGGG + Intronic
1062459888 9:136658619-136658641 TGGAGCGCGCACCCGGGCAGGGG + Intergenic
1062570903 9:137184881-137184903 GAGAGCGGACCCCAGGGCCGGGG + Intronic
1190062274 X:47219106-47219128 GTGAGCGCGTCCCCGAGGCGTGG + Intronic
1195625178 X:106999816-106999838 GCGCGCGGGCCCCTGGGCTGCGG - Intronic
1196016325 X:110944328-110944350 GCGCGCGCATCCCCGGGCCATGG + Intronic
1197774683 X:130111201-130111223 GGGAGCGCCCGCCCGGGCCGCGG - Intergenic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1200787736 Y:7274405-7274427 GCGACCGCGCCTCGGGGCTGGGG - Intergenic