ID: 1127342863

View in Genome Browser
Species Human (GRCh38)
Location 15:58065710-58065732
Sequence GCGAGCGCGCCCCCGGGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 215}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127342863_1127342872 18 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342872 15:58065751-58065773 CAAGCTGGGGCTCTTCTTATTGG 0: 1
1: 0
2: 0
3: 6
4: 116
1127342863_1127342874 27 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342874 15:58065760-58065782 GCTCTTCTTATTGGACGTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1127342863_1127342869 3 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342869 15:58065736-58065758 TATATAGGCAGGTGTCAAGCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
1127342863_1127342867 -8 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342867 15:58065725-58065747 GCGCTCGCCTGTATATAGGCAGG 0: 1
1: 0
2: 0
3: 0
4: 7
1127342863_1127342873 26 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342873 15:58065759-58065781 GGCTCTTCTTATTGGACGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 56
1127342863_1127342871 5 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342871 15:58065738-58065760 TATAGGCAGGTGTCAAGCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 158
1127342863_1127342870 4 Left 1127342863 15:58065710-58065732 CCGCGGCCCGGGGGCGCGCTCGC 0: 1
1: 0
2: 1
3: 22
4: 215
Right 1127342870 15:58065737-58065759 ATATAGGCAGGTGTCAAGCTGGG 0: 1
1: 0
2: 2
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127342863 Original CRISPR GCGAGCGCGCCCCCGGGCCG CGG (reversed) Exonic