ID: 1127346801

View in Genome Browser
Species Human (GRCh38)
Location 15:58109202-58109224
Sequence CTGTGCAGAACAAGTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127346800_1127346801 20 Left 1127346800 15:58109159-58109181 CCTGGAAGCAATACATTCTTGGC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG 0: 1
1: 0
2: 2
3: 24
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127346801 Original CRISPR CTGTGCAGAACAAGTTCCCA TGG Intronic
900809105 1:4787656-4787678 CTGGGCAGAGCCAGTGCCCAGGG - Exonic
903049587 1:20590663-20590685 CTCTGCAGCACAAAGTCCCAAGG - Intronic
903495056 1:23760345-23760367 CTGTGCAAATCAATCTCCCAAGG - Exonic
904053558 1:27655753-27655775 CTTTGCAGAGCCATTTCCCAGGG - Intergenic
904320548 1:29695272-29695294 TTTTGCAGAATAAGTTTCCAGGG + Intergenic
904624264 1:31793345-31793367 ATGTCCAGAACACCTTCCCAGGG + Exonic
910351373 1:86302233-86302255 GTGTGCAGAAGGAGTTTCCATGG - Intergenic
911353711 1:96790000-96790022 TTGTTCAGAACAAGGTCCTATGG + Intronic
915733398 1:158069616-158069638 CTGTGCAAAACCAGTCCCCAGGG - Intronic
916590285 1:166183560-166183582 CTGTGCAGAAAAATTCCCCTGGG - Intergenic
916723571 1:167503481-167503503 ATGTGCATTACACGTTCCCAGGG - Intronic
920857760 1:209676733-209676755 CTGTGCACCAGAGGTTCCCATGG + Intergenic
921206656 1:212855296-212855318 CTGGGCAGAACCAGCTCTCAGGG - Intergenic
1062760416 10:12888-12910 CGGTGCAAATCAAGTTCCGAAGG - Intergenic
1069584469 10:69588825-69588847 CTGTGCAGAACAAATCTACAGGG - Intergenic
1069789450 10:71010409-71010431 TTGAGCAGACCAAGTCCCCATGG + Intergenic
1071533912 10:86411785-86411807 CTGTGGCCTACAAGTTCCCAAGG - Intergenic
1071604311 10:86974210-86974232 CTGGGCAGTATAAGCTCCCAAGG - Intronic
1074508873 10:114095252-114095274 CTGTGGTGATCAAGTTCCCCAGG - Intergenic
1076273346 10:129175527-129175549 CTTTGCTGATCAAGTTCCCCTGG + Intergenic
1077420418 11:2447410-2447432 CTGTTCATGACAACTTCCCAGGG - Intronic
1081614894 11:44584988-44585010 CTGGGCAGACCGAGCTCCCACGG + Intronic
1082770003 11:57200635-57200657 ATGTGCATAACAATTTCCCGGGG + Intergenic
1084835983 11:71802177-71802199 ATGTGCTGAACCAGTCCCCAGGG - Intergenic
1086562087 11:88179273-88179295 CTGTGGAGAACAGGTTTCCATGG - Intergenic
1088801962 11:113314648-113314670 CAGTGCAGGACCAGCTCCCAGGG - Intronic
1092407336 12:8230223-8230245 ATGTGCTGAACCAGTCCCCAGGG + Intergenic
1092446338 12:8560946-8560968 CTGAGCAGAAAAAGTTTCCAAGG + Intergenic
1094808016 12:34109431-34109453 CGGTGCAAATCAAGTCCCCAAGG - Intergenic
1096738170 12:53672496-53672518 CTGTGAAGAACAAGGTCTGATGG + Intronic
1100051791 12:90458726-90458748 CTGTCCAGTACAAGTTCTCCTGG + Intergenic
1104775623 12:131388570-131388592 CTGGCCAGAGCAAGTGCCCAGGG + Intergenic
1106540481 13:30685878-30685900 CAGTACAGAACAAGTTACAATGG + Intergenic
1107348527 13:39489242-39489264 CTGTGCAAAACAATTCCTCAAGG - Intronic
1109565680 13:64112861-64112883 CTGTTCTCAAAAAGTTCCCATGG + Intergenic
1109834664 13:67841248-67841270 CTGTGCAGAGCAAGTCACCAGGG + Intergenic
1112502551 13:99954407-99954429 CTGTGCTGAAGAAGTTACAATGG - Intergenic
1112711745 13:102137553-102137575 CAGTCCAGAACAAGTTCCTTGGG - Intronic
1112711821 13:102138225-102138247 CAGTCCAGAACAAGTTGCCTGGG + Intronic
1112711863 13:102138517-102138539 CAGTCCAGAACAAGTTGCCTGGG + Intronic
1114265661 14:21071249-21071271 CTCTGCAGTGAAAGTTCCCAGGG - Intronic
1120103381 14:80468970-80468992 CTGAGCCGAAAAAGTTTCCAAGG - Intergenic
1121526565 14:94623440-94623462 CTGTGCAAAACTAGTTGGCAGGG + Intronic
1122264286 14:100539487-100539509 CTGTACTGAACAAGCTCCCAGGG + Intronic
1122683037 14:103481244-103481266 CTGTTCAGAACAAATTTCCCAGG + Intronic
1122984994 14:105207955-105207977 CTGTGCAGCACAGGTCCCCACGG + Intergenic
1125259899 15:37811296-37811318 CTGTGCATTACAAGTTCCTGTGG - Intergenic
1125600761 15:40914796-40914818 CTGGGAAGAATCAGTTCCCAAGG + Intergenic
1127346801 15:58109202-58109224 CTGTGCAGAACAAGTTCCCATGG + Intronic
1127448832 15:59096322-59096344 ATGTGGAGGACATGTTCCCATGG + Exonic
1128226895 15:66008050-66008072 CTATGCAGACCAAGAGCCCAGGG + Intronic
1129146565 15:73653238-73653260 CTTTCCATAACAACTTCCCAAGG - Intergenic
1129491860 15:75935005-75935027 CTGTTCATAACAAGCTCCAAAGG - Exonic
1129642092 15:77390960-77390982 CTCTGCAGAATAAGTTCAAAGGG + Intronic
1129693205 15:77725229-77725251 CTGTGGAGAATAAGTACCGATGG - Intronic
1131442740 15:92471274-92471296 CTGTGGAAAACAAGTACCCCTGG - Intergenic
1131457651 15:92595923-92595945 CTGTGCATATCCAGTTCCCCCGG - Intergenic
1132074275 15:98806676-98806698 CTGTCCAGCACATGTTCACAAGG - Intronic
1132140251 15:99386511-99386533 CTGTGGAGAACATGGTCTCAGGG - Exonic
1135322739 16:21507892-21507914 CTGCACAGAACAAGGTCCCAGGG + Intergenic
1136334223 16:29601055-29601077 CTGCACAGAACAAGGTCCCAGGG + Intergenic
1137384936 16:48032741-48032763 CTGAGCAAAACAGGTTGCCAGGG - Intergenic
1140828721 16:78731403-78731425 CAGTGCAGAAAGATTTCCCAAGG - Intronic
1140974181 16:80043553-80043575 CTGTGTAGAACAGGGTCCCTTGG + Intergenic
1141868994 16:86771815-86771837 ATGTGCAGAACAAGCCCCCAGGG - Intergenic
1142034937 16:87856913-87856935 CTGCACAGAACAAGGTCCCAGGG + Intronic
1142385787 16:89763635-89763657 ATGTTTAAAACAAGTTCCCAGGG + Intronic
1143188381 17:5023958-5023980 CTGTGCAGAACCCGCTCCCCGGG - Exonic
1144136373 17:12299074-12299096 CCTTGCAGAACAAGCTCCCTTGG - Intergenic
1144165903 17:12610100-12610122 CTGGGCAAAAAAAGTTCCCAAGG - Intergenic
1145749351 17:27344139-27344161 ATGTCCACAACAATTTCCCAGGG - Intergenic
1145887159 17:28390292-28390314 TTGTGCAGAGGAAGTTCTCAGGG + Intronic
1147457884 17:40549885-40549907 GTGTGCAGAAAAAGCTCCCCAGG - Intergenic
1151316148 17:73323939-73323961 CTGTGCAGAATAAGATCCCTGGG + Intergenic
1152616164 17:81338850-81338872 CTGGGCAGGACCATTTCCCAGGG - Intergenic
1152953324 18:13242-13264 CGGTGCAAATCAAGTTCCGAAGG - Intergenic
1153054182 18:929302-929324 CTGTGAAGAAGAGGTTTCCACGG - Intergenic
1154171614 18:12056839-12056861 CTGTGCAGAACCCGCTCCCCAGG + Intergenic
1155402139 18:25450633-25450655 CTGTCCAGCACTGGTTCCCATGG - Intergenic
1156227672 18:35124987-35125009 CTGTGCAGAAGAGCTTCCCCAGG - Intronic
1157617268 18:48994695-48994717 TTGTGTAGAAATAGTTCCCAGGG + Intergenic
1159229871 18:65592703-65592725 ATCAGCAGAACAAATTCCCATGG - Intergenic
1160377248 18:78422428-78422450 CTGTGCAGAAGAATTTCCAAAGG + Intergenic
1160557977 18:79738356-79738378 CTCTGGAGACCAAGTTCTCAGGG - Intronic
1161048460 19:2149818-2149840 CTGTGCAGAAAAAGTCCTCTCGG + Intronic
1161844308 19:6703193-6703215 TTATGGAGAAGAAGTTCCCAAGG - Intronic
1164679076 19:30121975-30121997 TTGTCCAGGGCAAGTTCCCACGG + Intergenic
1166535954 19:43574975-43574997 CTGTGCAGAAAATCTTCTCAAGG - Exonic
1168557954 19:57359177-57359199 CTGTGCAGGTCAACTGCCCAGGG - Exonic
928451252 2:31380360-31380382 TTCTGAAGTACAAGTTCCCAAGG - Intronic
928883475 2:36122875-36122897 CTGAGATGGACAAGTTCCCAGGG - Intergenic
929819878 2:45264419-45264441 TTGGGCAGAACAAGGTCCAAGGG + Intergenic
930998700 2:57755249-57755271 CTGAGCAGAACAAGATCGTAAGG - Intergenic
933737060 2:85503720-85503742 CTGTGCAGAACGGCTTGCCAGGG - Intergenic
938612694 2:132965096-132965118 CTGTACATAACAGGTTCACATGG - Intronic
941844079 2:170116291-170116313 CTGAGCGGAAAAAGTTTCCAAGG - Intergenic
942722014 2:178964044-178964066 CTGTTCAGAACAAGTTCTTATGG + Intronic
944898349 2:204188829-204188851 CTTTGCAGAACAAGCCCCCTGGG - Intergenic
945595760 2:211789554-211789576 CTGGCCAGAACAATATCCCATGG + Intronic
946146249 2:217733334-217733356 CTGCTCAGGACAATTTCCCAAGG - Intronic
946664708 2:222036493-222036515 ACGTGCAGAGCAAGTTCCCAGGG + Intergenic
948669019 2:239554758-239554780 CAGTGCAGAAAAACTTCCTAAGG + Intergenic
1170479094 20:16747222-16747244 TTGTGCAATACAATTTCCCAAGG - Intergenic
1172397973 20:34623084-34623106 CTGTCCTGAACCAGTCCCCATGG - Intronic
1173446051 20:43119577-43119599 GTGTTCAGACCCAGTTCCCAAGG + Intronic
1174588812 20:51628928-51628950 CTCTGCAGAACATGCTTCCAAGG + Intronic
1175858672 20:62137285-62137307 CTGAGCAGTACCAGTTCCGAAGG - Intronic
1176002979 20:62842014-62842036 CTGTGCAGGACAGGTCACCAAGG + Exonic
1179468462 21:41594392-41594414 CTTTGCAGAACAAATTGCAAGGG + Intergenic
1181583936 22:23842672-23842694 CTGGGCATCCCAAGTTCCCAGGG + Intergenic
1182577851 22:31285202-31285224 CTGCTCAGGAAAAGTTCCCAAGG + Intronic
1184019845 22:41813606-41813628 CTGTGCTGACCCAGTTCCCATGG + Intronic
952873749 3:37924764-37924786 CTGTGCAGACCCAGTGCCGATGG + Intronic
953136075 3:40182947-40182969 CAGTGCAGTACAAGTACCCCTGG + Intronic
953994268 3:47507491-47507513 CTGTGCAGAAATAGGTCACATGG + Intronic
957052375 3:75420596-75420618 ATGTGCTGAACCAGTCCCCAGGG + Intergenic
959281092 3:104341667-104341689 CTGCACAGAACAAGTTAGCAAGG - Intergenic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
961886000 3:130096827-130096849 ATGTGCTGAACCAGTCCCCAGGG + Intronic
963414142 3:144973040-144973062 ATGTACAGAACAGCTTCCCATGG + Intergenic
965093840 3:164196655-164196677 CTTTGCAGAATAAGTTCGGAAGG - Intergenic
965697303 3:171422857-171422879 TTGTGCAGATGAAGATCCCAGGG - Intronic
967289180 3:187902465-187902487 ATGTGCAGGACTAGTTCCCAAGG - Intergenic
967313070 3:188124841-188124863 CTGTGCAGACTACGTGCCCATGG - Intergenic
969758802 4:9167821-9167843 ATGTGCTGAACCAGTCCCCAGGG - Intergenic
971670789 4:29554205-29554227 CTCTGCAGAAAAAGTCACCATGG - Intergenic
974752916 4:66164859-66164881 CTGTGCAAGACAAGTTCCCATGG + Intergenic
975715287 4:77199644-77199666 CTGTGCTGAAGCAGTTCCCTTGG + Intronic
975728939 4:77319244-77319266 CTGTGGGGAACAAGTCTCCAGGG + Intronic
976621783 4:87135725-87135747 ATGTGCAAAAATAGTTCCCAAGG - Exonic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
986500842 5:8398015-8398037 CTGTGAGGAGCAAGATCCCACGG + Intergenic
991581833 5:68163868-68163890 CTGTGCAGTACTAGTTCTCAAGG + Intergenic
996147727 5:119996182-119996204 GTGTGCAGGACAAGATCCCTAGG - Intergenic
997707068 5:135965751-135965773 CTGTGCTGAGCAAGATCCTAGGG - Intergenic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1005186173 6:23165198-23165220 CTGAGCAGAAAAAGTTCTCAAGG - Intergenic
1005831794 6:29676953-29676975 CTGTACAGAAGACGCTCCCATGG - Exonic
1006281041 6:33053530-33053552 CTGAGTAGAAAAAGTTTCCAAGG - Intergenic
1006977972 6:38121493-38121515 TTTGGTAGAACAAGTTCCCATGG + Intronic
1011547159 6:88493937-88493959 CTGGGGAGAACAATTTCCCTTGG - Intergenic
1015820812 6:137258651-137258673 CTGTACAGAACAAATGACCATGG - Intergenic
1017589172 6:155959971-155959993 CTGTCCAGAAACAGTTTCCATGG - Intergenic
1019655516 7:2192611-2192633 CTGTGGAGAATCAGTTCCCTAGG - Intronic
1020941566 7:14545570-14545592 CTATGAAGAACAAGTGACCATGG + Intronic
1021487898 7:21187296-21187318 CTGTGCAGAAGAAGTGGGCATGG - Intergenic
1021754979 7:23843085-23843107 CTGTGCAGAAGAACTCACCAGGG + Intergenic
1022317658 7:29260555-29260577 AGGTGCAGAAAAAGTGCCCAGGG + Intronic
1022329349 7:29362745-29362767 GTGGTCAGAACAACTTCCCAAGG - Intronic
1023200665 7:37693907-37693929 CTGTAAAGACAAAGTTCCCAAGG + Intronic
1024301662 7:47891675-47891697 CTGTGCAGAGCAACTGCCCCTGG + Intronic
1025150610 7:56543585-56543607 CTGTGCAGAACTGGACCCCAGGG + Intergenic
1026566217 7:71491690-71491712 CTGTGCTGAACAAGTTCCCCAGG - Intronic
1026603545 7:71796745-71796767 CTGTGCTGAAAAAGAGCCCAAGG - Intronic
1026895540 7:74008068-74008090 CTCTGCAGAACAGGTGCCCTGGG - Intergenic
1027056411 7:75052832-75052854 GTGTGAAGAACAAGTCTCCAAGG + Intronic
1033297233 7:140151141-140151163 CTGTTCTTAACAAGTTCCCCAGG + Intronic
1034226358 7:149486948-149486970 CTGTGCAGTCCAGGTTCCCCGGG - Intronic
1036847707 8:12181143-12181165 ATGTGCTGAACCAGTCCCCAGGG + Intergenic
1036869075 8:12423458-12423480 ATGTGCTGAACCAGTCCCCAGGG + Intergenic
1038244821 8:25845616-25845638 CTGGGCAGAATCACTTCCCAGGG + Intronic
1038357184 8:26840256-26840278 CTGTGCTGACCAAATGCCCAGGG - Intronic
1038557373 8:28533650-28533672 CTGTGAAGAACAAAAACCCAGGG - Intronic
1045320409 8:101077900-101077922 ATGGGCAGATCAAGGTCCCAAGG + Intergenic
1045720077 8:105098845-105098867 GTGTGCAGAACAAGAACCCTGGG + Intronic
1047356159 8:124124173-124124195 CTGTGCAAAACAAATTGTCAGGG + Intergenic
1047785687 8:128151977-128151999 CTGTGCACAGCAAGGTCCCCTGG - Intergenic
1050197268 9:3099344-3099366 CTGTCCAGTACAATTTCTCAGGG + Intergenic
1051166126 9:14263988-14264010 CAGGGCAGAACAATTGCCCATGG + Intronic
1051478319 9:17532718-17532740 CTGTGCAGAGCCAGCTCCCGTGG + Intergenic
1052504057 9:29329864-29329886 CTGGAAAGAACAAGTTCACATGG + Intergenic
1054838461 9:69706750-69706772 GTGTGCAGAACATGTACCCAAGG + Intergenic
1054838557 9:69708417-69708439 CTGAGCAAATCAATTTCCCAGGG + Intergenic
1054949375 9:70833493-70833515 CTGTGATGGACAATTTCCCAAGG + Intronic
1055617656 9:78089888-78089910 CTGTGCAGAGCAGGATCTCATGG + Intergenic
1056793977 9:89644279-89644301 CTGTGCAGAACTCCATCCCAGGG - Intergenic
1057858950 9:98624700-98624722 CTGTGCAGGCCAAGTTCCTTAGG - Intronic
1058046823 9:100366069-100366091 CTGCGCAGAAAAAGTTTCCAAGG + Intergenic
1061591722 9:131602235-131602257 CTGTGGAGTGCAAGTTCCTATGG + Intronic
1187583969 X:20639498-20639520 CTGTGCAGCACAGGTGGCCAGGG - Intergenic
1192717747 X:73661746-73661768 CTGAGCAGAAAAAGTTTCCAGGG + Intronic
1193381082 X:80816436-80816458 GTGGGAAGAACAAGTACCCAGGG + Intergenic
1195159607 X:102157923-102157945 CTGGGCTGAGCAAGTTCCCAAGG + Intergenic
1195162144 X:102181326-102181348 CTGTGCTGAATAAGTGCCCACGG - Intergenic
1195611879 X:106876781-106876803 CTTTGAAGAACAACTTCCAAAGG + Intronic
1198485706 X:137085497-137085519 CTTTGCAGACCAATTCCCCAAGG - Intergenic
1202081716 Y:21090574-21090596 CTGAGCAGAAAAAGTCTCCAAGG + Intergenic