ID: 1127346926

View in Genome Browser
Species Human (GRCh38)
Location 15:58110324-58110346
Sequence ATGGAGAAGGTGAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 824
Summary {0: 1, 1: 1, 2: 8, 3: 70, 4: 744}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127346922_1127346926 -7 Left 1127346922 15:58110308-58110330 CCAAAGGGAGAAGCAAATGGAGA 0: 1
1: 0
2: 7
3: 36
4: 427
Right 1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG 0: 1
1: 1
2: 8
3: 70
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127346926 Original CRISPR ATGGAGAAGGTGAGGGTAGA AGG Intronic
900157928 1:1211017-1211039 AGGGTGGAGGTGAGGGTAGCGGG - Intergenic
900158909 1:1214187-1214209 GTGGAGGAGGGGAGGGGAGAGGG + Intergenic
900943116 1:5814109-5814131 AGGGTGAAGGGGAGGGGAGAGGG - Intergenic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
902216144 1:14935683-14935705 AGGGAGAAGGGGAAGGGAGAGGG - Intronic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902873151 1:19326209-19326231 AGGGGGAAGCTGAGGTTAGATGG - Intronic
903678245 1:25080034-25080056 ATTGAGAAAGTGAGGGGAGAAGG - Intergenic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
904213045 1:28898301-28898323 GTGGTGAAGATGAGGGGAGAAGG - Intronic
904413780 1:30342662-30342684 ATGGCGCAGGTGAAGGCAGAGGG - Intergenic
904455873 1:30647755-30647777 ATGATGAGGGTGAGGGTAGCTGG - Intergenic
905106061 1:35564331-35564353 AGGGAGAAGGTGTGCATAGAGGG - Intronic
905323643 1:37134782-37134804 ATTGAGAAGGTGTGGGAGGAGGG + Intergenic
905409402 1:37757924-37757946 AGGGAGGAGGAGAGGGGAGATGG - Intronic
905486506 1:38301090-38301112 ATGGAGAAGGGGCAGGTTGAAGG + Intergenic
906285693 1:44586410-44586432 AGGGACAAGGTAAGGATAGAGGG + Intronic
906851101 1:49251225-49251247 ATGGGGAAGGTGTGGGCAGCTGG - Intronic
906944333 1:50283002-50283024 ATGTTGAAGATGAGGGCAGAGGG - Intergenic
907456668 1:54580776-54580798 ATGGAGATGGTGAGGCTGCAGGG + Intronic
907696041 1:56730320-56730342 AGGGAGGAGGGGAGGGGAGAGGG + Intronic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
907919722 1:58901254-58901276 CTGGAGAAGGTGGGGGTTGGGGG + Intergenic
908195731 1:61743877-61743899 ATGGAAGAGGGGAGGGTAAAAGG + Intronic
908525109 1:64980439-64980461 ATGGAGAACGCGAGGGCAAAAGG - Intergenic
909993145 1:82247950-82247972 ATAGAGAAGGTGGGGGGATAGGG + Intergenic
910592455 1:88940947-88940969 ACTGTGAAGGTGATGGTAGAGGG - Intronic
910819996 1:91336137-91336159 AAGGAGGAGGGGAGGGTAGGAGG - Intronic
911217099 1:95206901-95206923 AAGGAGAAACTGAGGGTATACGG - Intronic
911786529 1:101956471-101956493 GAAGAGAAGGTGAGGGTAGATGG - Intronic
911887160 1:103317763-103317785 ATGGGGATGGTGAGGGTGGAAGG + Intergenic
912411957 1:109485811-109485833 ATGCAGCAGGTGAAGGAAGATGG + Intronic
913063913 1:115232255-115232277 ATGGGGATGGGGAGGGCAGAGGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914879075 1:151533918-151533940 AGTGAGAAGGTGAGGGTTGAGGG - Intronic
915339631 1:155169546-155169568 ATGGAGAAGATGAAGCTATATGG + Exonic
915498051 1:156295024-156295046 ATGGAGTAGTGGAGGGTTGAGGG + Intronic
915502174 1:156327274-156327296 GTGGAGAGGGAGAGGGGAGAGGG - Intronic
916005430 1:160655084-160655106 ATGGAGAAGAGGTGGGTGGATGG - Intergenic
916260353 1:162835729-162835751 TTGGAGAAGGAGAGGCTACAAGG - Intronic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
916634040 1:166648940-166648962 ATGGAGACAGTGAGCATAGAAGG - Intergenic
917529980 1:175826112-175826134 AATCAAAAGGTGAGGGTAGAGGG + Intergenic
917628233 1:176867308-176867330 AGGGAGAAGAAGAGGGGAGAGGG + Intronic
917729644 1:177862010-177862032 ATGGTCCAGGTGAGGGAAGATGG - Intergenic
917748974 1:178037652-178037674 GGGGAGAAGGGGAGGGTAGAAGG + Intergenic
918066005 1:181102163-181102185 GTGGAGAAGGTGTGGGGAGGAGG - Intergenic
918138745 1:181702148-181702170 ATGGAGCAGGTTTGGGAAGAGGG - Intronic
918442586 1:184582795-184582817 ATTAAGAAGGTGAGGTTTGAGGG + Intronic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918590760 1:186238296-186238318 ATGGAGAAGTGGAGGGGGGAAGG + Intergenic
918645114 1:186895026-186895048 ATGGAGAAGCTGAGAGTTAAGGG - Intronic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919981418 1:202644568-202644590 AAGGAGAGGCTGAGGGGAGAGGG - Intronic
920118502 1:203638115-203638137 ATGGAGGAGGGGAGGGGAGATGG + Intronic
920330234 1:205202083-205202105 AGGGAGAAGGGGAAGGGAGAGGG + Intronic
920592924 1:207239526-207239548 ATGGAGATAGAGAGTGTAGAAGG + Intergenic
921590115 1:216993295-216993317 AGGGAGATGGTGAGGGAGGAGGG - Intronic
922000349 1:221471263-221471285 ATGGGGAGGGTGATGGTGGAAGG - Intergenic
922056573 1:222048065-222048087 ATGGGGAAGGGGAGGTGAGATGG - Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922574277 1:226651885-226651907 ATGGAGGAGGTGTGGGCAGAGGG - Intronic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922662628 1:227443535-227443557 AGGGAGAGGGAGAGGGAAGATGG - Intergenic
922720270 1:227896707-227896729 AGGGACAGGGTGAGGGCAGATGG + Intergenic
923045061 1:230349764-230349786 CTGGAGAATGTGAGGGGACAAGG + Intronic
923472268 1:234302468-234302490 ATGGAGAACTTGAGCGTAGATGG + Intronic
923482551 1:234397674-234397696 GGGGAGGAGGTGAGGGAAGAGGG + Intronic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
923986122 1:239384631-239384653 ATGGACAAGGTAAATGTAGATGG - Intergenic
924166887 1:241292775-241292797 AGGGAGAAAGGGAGGGAAGAAGG + Intronic
924925469 1:248676275-248676297 AGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1063427235 10:5959998-5960020 ATGGAGGAGCTGAGGGTAATGGG - Intronic
1063921186 10:10934710-10934732 TTCGAGAGGGTGAGGGTTGAGGG + Intergenic
1063953947 10:11248417-11248439 ATGGAGAGGAGGAGGGTGGAAGG - Intronic
1064418846 10:15173024-15173046 ATGAAGAAAGTGAGGGCAGTAGG + Intergenic
1065122757 10:22544565-22544587 AGGGAGCAGGTGTGGGCAGAAGG - Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065804741 10:29384115-29384137 ATCCAGAAGTTGAGGGGAGAAGG + Intergenic
1066211511 10:33243899-33243921 AAGGAGAAGGAGAGTGGAGAAGG + Intronic
1067184302 10:44014085-44014107 AAGGAGAAGGGGAGGGGAAAAGG - Intergenic
1067216912 10:44310944-44310966 ATGGAGAAGGGGAGGGTGCGCGG + Intergenic
1067339593 10:45391045-45391067 AGGGAGAGGGAGAGGGGAGAGGG - Intronic
1067474576 10:46557093-46557115 ATGGAGAAGGCGAGAGGAAAGGG - Intergenic
1068667812 10:59696079-59696101 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1069282359 10:66670539-66670561 AGGTAGAAGGGGAGGTTAGAAGG - Intronic
1069366435 10:67699086-67699108 CTTGAAAAGGTGAGGGAAGAAGG - Intergenic
1069708274 10:70472810-70472832 AGGGAGGAGGTGTGGGCAGAAGG + Intergenic
1069853426 10:71425162-71425184 CTGGAGTGGGTGAGGGTGGAAGG + Intronic
1070291938 10:75123056-75123078 ATGGAGATGGTGTCTGTAGAAGG - Intronic
1070655129 10:78266257-78266279 AGGGAGGAGGTGAGAGGAGAAGG + Intergenic
1071270643 10:84003817-84003839 ATGGGGAAGGTGAGGAAGGAGGG - Intergenic
1071519260 10:86318998-86319020 ACGGAGACAGTGAAGGTAGAAGG + Intronic
1071827292 10:89337763-89337785 ATGCAGGAGGTGAGGTAAGATGG - Intronic
1072491087 10:95906726-95906748 ATGGAGAAGGTGTGGGAATGAGG + Intronic
1072539653 10:96388700-96388722 TTGGAAAAGGGCAGGGTAGAGGG - Intronic
1072801050 10:98392710-98392732 ATGGAGAAGCTGAGGCTTCATGG - Intronic
1072837951 10:98736974-98736996 ATTGAGAAGATGAAGGTTGAAGG + Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073088228 10:100909789-100909811 GAGGTGAAGGTGAGGGTAGAGGG - Intergenic
1073125053 10:101144020-101144042 GTGTAGAAGGTGAGGGAAGGAGG - Intergenic
1073497143 10:103902855-103902877 AACGAGAAGGTAAGAGTAGAAGG - Intronic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074517838 10:114187392-114187414 ATAAAGTAGGAGAGGGTAGAGGG + Intronic
1075080086 10:119377778-119377800 TTGGAAAAGGTGGGGGTAGAGGG + Intronic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1076257787 10:129042270-129042292 ATGGAGTAGGGAAGGGTGGATGG - Intergenic
1076713240 10:132350584-132350606 ACGGGGAAGATGAGGGTGGAAGG + Intronic
1077308912 11:1879927-1879949 ATGGACAAGGTGAGGCCTGAGGG + Intronic
1077479907 11:2808886-2808908 ATGGACAATGGGTGGGTAGATGG + Intronic
1077629327 11:3800122-3800144 ATGGAGGAGTTGGGGGAAGATGG - Intronic
1078444787 11:11395974-11395996 GTGGAGATGGGGAGGGGAGAGGG + Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1079151185 11:17901012-17901034 AGGGATGAGGTGGGGGTAGACGG - Intronic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1080451703 11:32383436-32383458 ATGGAGTAGGGGAGGATTGAAGG - Intergenic
1080606442 11:33868961-33868983 ACCGAGAAGGAGAGGGAAGAAGG + Intronic
1080899101 11:36470635-36470657 CTGGAGTGGGTGAGGGTACAAGG + Intergenic
1080960805 11:37157640-37157662 AAGGACAAGATGAGGGAAGAAGG - Intergenic
1081489493 11:43556561-43556583 AGAGGGGAGGTGAGGGTAGAGGG - Intronic
1081578091 11:44332246-44332268 AAGGAGGAGGTGGGAGTAGAAGG - Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082764325 11:57155217-57155239 AGGGTAAAGGAGAGGGTAGAAGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083367205 11:62148546-62148568 AAGAAGAAGGTGAGGGGAGCTGG + Exonic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083952471 11:65964626-65964648 TTGAAGAAGGTGGGGTTAGAGGG + Intronic
1084150155 11:67284365-67284387 ATGAGGAAGGTGAGGGTCGCCGG + Exonic
1084182552 11:67454154-67454176 ATGGTGAGGGTGAGGGGAGTTGG + Intronic
1084196502 11:67525755-67525777 ATGGAGGAGGTGAGGGGATAAGG + Intergenic
1084726414 11:70945338-70945360 AGGGAGGAGGTGAAGGCAGAAGG + Intronic
1084751693 11:71208313-71208335 ATGGGGAAGTTGGGGGGAGAAGG + Intronic
1084938397 11:72599482-72599504 ATGGGGGAGGTGAGGAAAGAAGG - Intronic
1085051088 11:73380614-73380636 AGGCAGGAGGTGAGGGTCGAGGG + Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085139882 11:74130134-74130156 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1085758795 11:79224087-79224109 ATAGAGATGGTGAGAGGAGAGGG - Intronic
1085960146 11:81452153-81452175 AGGGAGATGGGGTGGGTAGAGGG - Intergenic
1086100448 11:83093912-83093934 ATGCAGAACGTGAGGCTAGATGG - Intergenic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1086254935 11:84864511-84864533 ATGGAGGCTGAGAGGGTAGAGGG - Intronic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087530032 11:99368912-99368934 CTGGAGAATGTCAGGGAAGAGGG + Intronic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1089170243 11:116506602-116506624 AGGGAGAGGGTGGGGGTGGATGG + Intergenic
1089337348 11:117734323-117734345 ATGGAAAAGGTGGGGAGAGATGG + Intronic
1089396666 11:118140641-118140663 AAGGGGAAGGGGAGGGAAGATGG - Intronic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089605264 11:119638014-119638036 GTGGAGGAGGTGAGGGCAGGGGG - Intronic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1090003831 11:122983424-122983446 AAGGAGAAGGGAAGGGAAGAAGG + Intergenic
1090243220 11:125198337-125198359 AAGGCGAAGGTGGGGGTAGAGGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090858371 11:130631473-130631495 ACGGAGAAGGTAAGGTAAGAAGG + Intergenic
1091115012 11:133004801-133004823 ATGGAGAGGGGCAGGTTAGACGG - Intronic
1091936690 12:4440451-4440473 ATGGAGAAGGATGGGGTGGAAGG + Intronic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092654324 12:10668730-10668752 CTGGAGAAAGTGAAAGTAGAAGG - Intronic
1092655472 12:10679766-10679788 ATAGATAAGGTGAGGGTTAAGGG - Intergenic
1092739463 12:11614146-11614168 AAGGAGAAATTGAGGGTGGAAGG + Intergenic
1093396523 12:18690059-18690081 ATTGAGAAAGTGAAGGTGGAAGG - Intronic
1093884204 12:24440730-24440752 AGGGAGTAGGTGAGGGGAGGAGG - Intergenic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095171030 12:39036623-39036645 ATGGAAAAGGTGTGGCTATACGG + Intergenic
1095262998 12:40119538-40119560 AAGGAGAAGGTGAGGGCAGGAGG - Intergenic
1095596149 12:43960313-43960335 AGGGAGAAGGAGAGGGAAGGGGG + Intronic
1096539150 12:52294502-52294524 AGGGAGGAGGGGAGGGAAGATGG + Intronic
1096786268 12:54018835-54018857 TGGGAGAGGGTGGGGGTAGAGGG - Intronic
1096789277 12:54034887-54034909 AAGGAGAGGGCGAGGTTAGAGGG - Exonic
1097021747 12:56025682-56025704 ATGGAGGTGGAGGGGGTAGAGGG + Intronic
1097160735 12:57044864-57044886 ACGGTGAAGGTAAGGGGAGAAGG + Intronic
1097167872 12:57095158-57095180 ACGGGGAAGGAGAGGGGAGAAGG - Exonic
1097198251 12:57256441-57256463 ATGGAGCAAGGGAGGGCAGATGG + Exonic
1098047713 12:66419258-66419280 ATGGAGAGAGAGAGAGTAGAAGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099148506 12:79078249-79078271 AGAGTGAAGGTGAGGGGAGAAGG - Intronic
1099886182 12:88534134-88534156 ATGAAGAAACTGAGGCTAGAAGG + Intronic
1099887039 12:88544308-88544330 ATGAAGAAACTGAGGCTAGAAGG + Intronic
1100401029 12:94230092-94230114 ATGGAGAATGGGAGGGAGGAGGG - Intronic
1101059835 12:100959274-100959296 CTTGAGAAGGTGAGGTGAGAGGG - Intronic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1101306269 12:103530671-103530693 ATGGGGGAGGTGAGGGGTGAAGG + Intergenic
1101372562 12:104142681-104142703 TAGGAGGAGATGAGGGTAGAGGG - Intergenic
1101410998 12:104468231-104468253 TTGAAGGAGATGAGGGTAGATGG + Intronic
1101861351 12:108484928-108484950 AGGGAGGAAGAGAGGGTAGAGGG + Intergenic
1102014867 12:109641424-109641446 ATTCAGAAGGGGAGGTTAGAAGG - Intergenic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102552503 12:113702082-113702104 AAGGAGAAAGGGAGGGAAGAAGG - Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102720721 12:115013748-115013770 AGGGAGGAGGTGGGGGGAGAGGG - Intergenic
1102899318 12:116624064-116624086 AAGAAGAAGGTGAAGGAAGAAGG + Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103222482 12:119257381-119257403 AGGGAGAAGGGGAGGGAAGAAGG + Intergenic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1104145121 12:126025925-126025947 ATGCACAAGATGAGGGTAGGGGG - Intergenic
1105251548 13:18703163-18703185 AGTGAGAAGGTTAGGGAAGAAGG - Intergenic
1105284704 13:18994574-18994596 ATGCAGAAGGCCAGGGAAGAAGG + Intergenic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1105527264 13:21187423-21187445 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1105899625 13:24743888-24743910 GTGGAGCAGGAGATGGTAGAGGG - Intergenic
1105949178 13:25214074-25214096 CTGGAGCAGGTGACAGTAGATGG - Intergenic
1106356622 13:28989652-28989674 ATGGGGAGGATGAGGGTGGACGG + Intronic
1106839347 13:33669969-33669991 ATGGAGAAGGTGGTAGTAGTTGG - Intergenic
1106871810 13:34029796-34029818 AGGGAGAGGGAGAGGGTAGCAGG + Intergenic
1106892378 13:34259721-34259743 ATTGAGAAGGGCAGAGTAGATGG + Intergenic
1107098253 13:36559985-36560007 TTGGAGAAGGGGAGGTAAGAGGG + Intergenic
1107662219 13:42650437-42650459 ATGGGGAAGGGGAGGGGAGGAGG + Intergenic
1109343003 13:61085775-61085797 AAGGAGTAGGTTAGGGGAGAGGG + Intergenic
1110277900 13:73660551-73660573 AGGGAGAAAGGGAGGGAAGATGG + Intergenic
1110772032 13:79360466-79360488 GTGGTGAGGGTGATGGTAGATGG - Intronic
1110872991 13:80474468-80474490 ATGGAGAAGGTCATTTTAGAAGG + Intergenic
1111777170 13:92678995-92679017 ATGGAAAAGGTGGGGGGAAATGG + Intronic
1112767089 13:102756830-102756852 ATGGAGAAGAAGAGGTTAGGGGG - Intronic
1113609792 13:111636180-111636202 ATGAAGCAGGTTAGGGAAGATGG - Intronic
1113966555 13:114156164-114156186 ATGCCGGATGTGAGGGTAGAGGG + Intergenic
1114389574 14:22292415-22292437 ATGGGGAGGATGAGGGTTGAGGG + Intergenic
1114401985 14:22418515-22418537 ATGGAAGAGCTGAGGGTGGAAGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115298130 14:31853447-31853469 ATGGAGAAGGTGGAGTAAGAAGG - Intronic
1115539962 14:34411279-34411301 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1116065834 14:39981867-39981889 ATGGAGGAGGCAAGAGTAGAAGG - Intergenic
1116192223 14:41675605-41675627 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1116504934 14:45666155-45666177 ATGTAGAAGGTGGGGCAAGATGG - Intergenic
1117287171 14:54297438-54297460 ATGTAGAAATTGAGGGTGGAGGG - Intergenic
1117350632 14:54878099-54878121 GTGGAGAAAGTGAGGGAAAAAGG + Intronic
1118513822 14:66505857-66505879 ATGGAGATGGGGAGGGTTGATGG - Intergenic
1119042264 14:71285654-71285676 AAGGAGAAGGTGATTGAAGATGG - Intergenic
1119919431 14:78432672-78432694 AAGAGGAAGGTGAGGGAAGAAGG - Intronic
1119980165 14:79071628-79071650 ATGGAGAGAGAGAGAGTAGAAGG + Intronic
1121593385 14:95137555-95137577 ATGGAGAAGGGGAAGGGAAAGGG + Intronic
1122109189 14:99483711-99483733 TTGGATAAGGTGTGGTTAGATGG + Intronic
1122254222 14:100464852-100464874 ATGGGGTAGGGGAGAGTAGATGG - Intronic
1122625187 14:103081769-103081791 AAAGAGATGGTGATGGTAGATGG + Intergenic
1124497109 15:30193303-30193325 AAGGAGAGGCTGAGGGGAGAGGG - Intergenic
1124685668 15:31779777-31779799 ATGGAGGAGGTGGGTGCAGAGGG + Intronic
1124746467 15:32345344-32345366 AAGGAGAGGCTGAGGGGAGAGGG + Intergenic
1124972365 15:34500647-34500669 ATGGAAAAGGTGGGGGGAAATGG + Intergenic
1125530703 15:40411683-40411705 GTGGAGAAGGTGAGTATAGGTGG + Exonic
1125609422 15:40960599-40960621 AAGCAGAAGGTGTGGGAAGAAGG + Intergenic
1126874649 15:53027942-53027964 ATGTAGACAGTGAGGTTAGAAGG + Intergenic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1127034622 15:54901727-54901749 ATGGAAATTGTGTGGGTAGATGG - Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1127438805 15:58985862-58985884 AAGGAAAAGGGGAGGGGAGAGGG + Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1128107143 15:65053537-65053559 ATGGAGGAGCTGAGGTCAGAGGG - Exonic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128499521 15:68218146-68218168 ATGGGGAAGGACAGGGGAGACGG + Intronic
1128748805 15:70133872-70133894 ATGGAGAAGCAAAGGGCAGATGG - Intergenic
1129790151 15:78335711-78335733 ATGGAGCAGGTGAGTGCTGAAGG - Intergenic
1130175914 15:81570627-81570649 TTGGAGAAGGTGGGGAAAGAAGG - Intergenic
1130233406 15:82113629-82113651 AGGGAGGAGGAGAGAGTAGAGGG - Intergenic
1130856023 15:87840841-87840863 ATAGAGAAAGTGAGGGAGGAAGG + Intergenic
1131087721 15:89590999-89591021 TTGGGGAGTGTGAGGGTAGAAGG - Intronic
1131137135 15:89945887-89945909 GGGGAGAAGGAGATGGTAGAGGG + Intergenic
1131559275 15:93425099-93425121 ATGGAGAAATTGAGGGCAGGAGG - Intergenic
1132940432 16:2504317-2504339 TGGGGGAAGGTGAGGGTACATGG - Intronic
1133080474 16:3315095-3315117 ATGGAGAAGGTTTGGGGAAAGGG - Intronic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133485462 16:6214862-6214884 AGGGAGAAGGCGAGGGGAGAAGG + Intronic
1133485511 16:6215031-6215053 ATGGAGAGGGAGAGGGGAGAAGG + Intronic
1133839458 16:9394616-9394638 AAGGAGGAAGTGAGGGTGGAAGG - Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1134449414 16:14354256-14354278 AAGGGGAAGGGGAGGGTAGGAGG + Intergenic
1134860146 16:17553612-17553634 AAGGAGAAGGGATGGGTAGATGG + Intergenic
1135050010 16:19185133-19185155 AGGGAGAAAGGGAGGGAAGAGGG - Intronic
1135165512 16:20135524-20135546 TTGCAGAAGGACAGGGTAGAAGG - Intergenic
1135678390 16:24436682-24436704 AAGGAGATGGTGTGGGAAGAAGG - Intergenic
1135933224 16:26757202-26757224 ATGATGAATGTGTGGGTAGATGG + Intergenic
1136019415 16:27430471-27430493 AAGGAGAAACTGAGGTTAGATGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136054498 16:27678412-27678434 AGGGAAAAGGAGAGGGAAGAGGG - Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1137554196 16:49460475-49460497 ATGGAGAAGGGGAGGTTTGAGGG + Intergenic
1137721600 16:50630640-50630662 GGGGAGGAGGTGAGGCTAGATGG + Intronic
1137909968 16:52367618-52367640 ATGGTAAAGGTGAGGATTGAGGG + Intergenic
1138293852 16:55870277-55870299 ATGGAGGAGGTGAGAGGAGGAGG + Intronic
1138761063 16:59544925-59544947 TTGGAGAAGGTGAAATTAGAAGG + Intergenic
1138795758 16:59966745-59966767 AAGGAGAAGGTGAGTGTATCGGG + Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139459640 16:67111276-67111298 ATGGAGAGGGTGAAGGGAGAAGG - Intronic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139963271 16:70730083-70730105 GTGGAGAGAGTGAGGGGAGAGGG - Intronic
1140702462 16:77593889-77593911 TTGTAGAAGGTGAGGACAGAAGG + Intergenic
1140775137 16:78242594-78242616 ATTAAAAAGGTGAGGGTAGCAGG + Intronic
1141155473 16:81593934-81593956 AGGGGGAAGGTAAGGGTAGAGGG - Intronic
1141230990 16:82167427-82167449 GTGGAGAGGGGAAGGGTAGATGG + Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1142043426 16:87909950-87909972 ATGGGGAAACTGAGGCTAGAAGG - Intronic
1203113784 16_KI270728v1_random:1469528-1469550 AAGGAGAAGGGAAGGGAAGAGGG - Intergenic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143051916 17:4132976-4132998 GTGGAGCAGGTGGGGGAAGAAGG + Intronic
1143115005 17:4577165-4577187 GTGGAGGGGGTGAGGGAAGAAGG + Intergenic
1143186787 17:5014829-5014851 ATGGAGAAGGTAATGGCTGAGGG + Exonic
1143250237 17:5518136-5518158 ATGGGGGAGGTGAAGGAAGAAGG - Intronic
1143277380 17:5721922-5721944 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1143775227 17:9195045-9195067 ATGAGGAAGGTGGGGGTAGGGGG - Intronic
1143887559 17:10076254-10076276 ACGGGGAAGGGGAGGGGAGACGG + Intronic
1144025000 17:11269740-11269762 ATGGAGATGGTGAGATTAGCTGG + Intronic
1144098624 17:11924137-11924159 ACAGAGCAGGTGAGGGGAGAAGG - Intronic
1144778876 17:17798106-17798128 AAGGAGAAGGTGCGGCCAGAAGG + Exonic
1146059777 17:29598478-29598500 AGGGAGAAGGGGAGGGGAGAGGG - Intronic
1146100382 17:29974946-29974968 TTTGAGAAGGTGAGGGCAGGAGG + Intronic
1146689253 17:34861749-34861771 ATGAAGAAGGTGTAAGTAGAGGG - Intergenic
1147111080 17:38262091-38262113 CTGGAAAAGGTGAGTGTTGAAGG - Intergenic
1147757703 17:42779863-42779885 AGGGAGATGGTGAGGGAAGGGGG - Intergenic
1147977839 17:44258218-44258240 CTGGAGGAGGTGAGGGGAAAGGG + Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1148418430 17:47526350-47526372 CTGGAAAAGGTGAGTGTTGAAGG + Intronic
1148604077 17:48915681-48915703 ATGGAGTTAGTGAGGGGAGAGGG - Intronic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149200704 17:54182876-54182898 AGTGAGAAAGTGAGGGTGGAGGG - Intergenic
1149537238 17:57442532-57442554 CGGGAGAAGGGGAGGGGAGATGG - Intronic
1149937170 17:60819736-60819758 AAGGAGAGGGGGAGGGTAGGAGG - Intronic
1150125290 17:62631009-62631031 CTGGGCAAGGTGAGGGTACATGG + Intronic
1150838461 17:68585907-68585929 TTGGAGGAGGTGAGGCGAGAAGG + Intronic
1152094094 17:78263213-78263235 AGGGAGCAGGTGGGGGCAGAAGG - Intergenic
1152277584 17:79367223-79367245 AGGGAGAAGGGGAGGGGAGGAGG - Intronic
1152448764 17:80363244-80363266 GTGGAGAACCTGAGGGTAGATGG - Exonic
1152491818 17:80640106-80640128 ATGGAAAAGGAGATGGTAAATGG - Intronic
1152532545 17:80927826-80927848 ATGGAGGAGATGAGGGCAGGCGG - Intronic
1152677156 17:81647527-81647549 TTGGAGCAGGGGAGGGTGGATGG - Intronic
1203192766 17_KI270729v1_random:205172-205194 AGGGAGAAGGGGAGGTTACAGGG - Intergenic
1203202130 17_KI270730v1_random:4607-4629 AGGGAGAAGGGGAGGTTACAGGG - Intergenic
1152993377 18:383661-383683 GTGGAGAAGGAGTGGGTAGGGGG - Intronic
1153222481 18:2873945-2873967 TTGGAGAACTTGAGGGTATAAGG - Intronic
1153283808 18:3439148-3439170 AGGGAGAAGGTGACACTAGATGG + Intronic
1153527944 18:6015353-6015375 TTGCAGAAGGTGGGGGTGGATGG + Intronic
1153552044 18:6272313-6272335 ATGAAGGAGGTGAGGGTATTTGG - Intronic
1154303693 18:13216364-13216386 ATGACGAAGTTGAGGCTAGAAGG - Intergenic
1154375084 18:13802471-13802493 ATGGAGAAGCTGAGGTTTGGTGG - Intergenic
1155484869 18:26330739-26330761 ATGGAGAGATTAAGGGTAGAAGG - Intronic
1155523800 18:26696239-26696261 ATTGGGAAGCTGAGGGAAGATGG + Intergenic
1155721521 18:29018889-29018911 ATCGAAAAGGTGAGGAAAGAGGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156491404 18:37498512-37498534 AGGGAGAAGGTAAGGGAAGAGGG - Intronic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156842320 18:41623735-41623757 ATGGAACATGTGAGGGTACAGGG - Intergenic
1156907399 18:42370307-42370329 ATGGAGGAGGTGAGGCATGAAGG + Intergenic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157421934 18:47554989-47555011 GTGTGGAAGGTGAGGGAAGAGGG - Intergenic
1157554623 18:48605386-48605408 ATGGAGAAGGAGGGGATATAAGG - Intronic
1157617055 18:48993184-48993206 AGGGAAAAGATGAGGGCAGATGG - Intergenic
1157619223 18:49006447-49006469 ATGGAGATGGTAAGGGTGGAGGG - Intergenic
1157880642 18:51318105-51318127 ATGGAGGAGATGTGGGTAGGTGG - Intergenic
1158718821 18:59905145-59905167 ATGGGAAACGTGAGGGAAGAAGG + Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159775724 18:72601383-72601405 ATAGAAAGGTTGAGGGTAGAGGG + Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160971262 19:1768788-1768810 ATGGAGGAGGTGTGGGGAGGTGG + Intronic
1162127418 19:8506914-8506936 ATAGAGAAGGTGAGGCTAGGAGG - Intergenic
1162134322 19:8545797-8545819 ATGGAGAAGGGGAGAGGACATGG - Intronic
1162185596 19:8902180-8902202 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162185974 19:8905027-8905049 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162186700 19:8910460-8910482 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162187310 19:8915597-8915619 ATGGTGAAGTTGAGGGTGAACGG + Exonic
1162188151 19:8923016-8923038 ATGGTGAAGTTGAGGGTGAATGG + Exonic
1162745203 19:12793966-12793988 CTGGAGGGGGTGGGGGTAGAGGG - Intronic
1162843534 19:13373600-13373622 TTGGAGAAGGAGAGGGGAGGTGG - Intronic
1163295329 19:16408049-16408071 ATGGATAAGGGAAGGGAAGATGG + Intronic
1163649981 19:18511646-18511668 ATGGAGAAGGTGGAAGTACAGGG + Intronic
1164537991 19:29100658-29100680 AGGGAGAAGCTGAGAGAAGATGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1165044462 19:33093811-33093833 ACACAGAAAGTGAGGGTAGAAGG - Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1165969698 19:39616723-39616745 AAGGAGAAAGTGTGGGAAGAAGG - Intergenic
1166041463 19:40205288-40205310 AAGGAGAAGGTGAAGGCAGGGGG + Exonic
1166267230 19:41691807-41691829 CTGGAGCATGTGTGGGTAGAAGG + Intronic
1166301546 19:41914315-41914337 AGGGAGATGGTGGGGGGAGACGG - Intronic
1166375057 19:42323402-42323424 AGGGAAAAGGTGAGGGTCCAGGG + Intronic
1166714532 19:44958267-44958289 CTGGAGCGGGTGAGGGGAGAGGG + Intronic
1167033083 19:46976590-46976612 ATGGAGAAGGCGAGTGCAGCCGG - Intronic
1167242309 19:48351588-48351610 AGAGAGGAGGTGAGGGCAGAGGG - Intronic
1167631565 19:50629263-50629285 AAGGGGAAGGTCAGGGGAGAGGG + Intronic
1167682294 19:50931215-50931237 ATAGAGAAAGTGATGGAAGAAGG - Intergenic
1167856883 19:52249058-52249080 ATGTAGAAGGTTTGGGTGGATGG + Intergenic
1168020673 19:53606643-53606665 GTGGAGGCGGTGAGGGTGGAGGG + Intergenic
1168480146 19:56713291-56713313 ATGGAGAAGGTGTGGGTTCCTGG + Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925337490 2:3108841-3108863 CTGGAGAAGGCGAGGGCAGTGGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
926931107 2:18041952-18041974 AGGCAGAAGGTGAGGGTTTATGG - Intronic
927002419 2:18811943-18811965 TTGGAGAAGTGGAGGGGAGAGGG + Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
928123685 2:28602004-28602026 ATGGTGAGGGTGAAGGTGGATGG + Intronic
929445444 2:41997398-41997420 CTGGAAAAGGTGAGAGCAGAGGG + Intergenic
929744638 2:44643272-44643294 ATGGAGAGGGTAAGAGTTGAGGG + Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
929902449 2:46017137-46017159 ATGGAGATGGAGAGGGGTGATGG - Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
931186938 2:59961973-59961995 GTGATGAAGGTGGGGGTAGAAGG - Intergenic
931719388 2:65056341-65056363 AGGGAGAAGGGGCGGGAAGAAGG + Intergenic
931831706 2:66059106-66059128 GTGAAGAAGGTGAGGGTCCAGGG - Intergenic
931869114 2:66440530-66440552 AGTGAGAAGGAGAGGGGAGAGGG - Intronic
931919924 2:67003937-67003959 ATGGGTAAGATGAGGGTAGCTGG + Intergenic
933014407 2:77105983-77106005 AGGAAGAAGGTGAGTGTAGTTGG - Intronic
933234480 2:79850156-79850178 ATGGAGGAAGGGAGGGTAGGAGG - Intronic
933339135 2:80999173-80999195 ATGGAGATAGAGAGAGTAGAAGG - Intergenic
934061545 2:88298711-88298733 GGGGAGAAGGTGAGGGGAGAGGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934937954 2:98478696-98478718 GTTGAGGGGGTGAGGGTAGAAGG + Intronic
936478971 2:112867794-112867816 ATGAAGAAGGAGATGGTATAGGG + Intergenic
936503100 2:113082024-113082046 GTGGAGCTGGTGAGGGTGGATGG + Intergenic
936959723 2:118060432-118060454 AAGGAGCAGGTGAGAGGAGAAGG + Intergenic
937376470 2:121339270-121339292 ATGCAGAGGGTCAGGGCAGAGGG + Exonic
937478545 2:122236555-122236577 ATGGGGAAGGTGGAGGCAGATGG + Intergenic
937892378 2:126948466-126948488 ATGTAGAATGTCAGGGTGGAAGG - Intergenic
938067981 2:128292198-128292220 CTGGTGAAGGTGTGGGGAGAGGG + Intronic
938245256 2:129771796-129771818 ATGGAGAAGGTAAGTATATAAGG - Intergenic
938248186 2:129794987-129795009 TTGGAGATGGTGGGTGTAGATGG + Intergenic
939105431 2:137943357-137943379 AGTGAGAAGGTTAGGGCAGAAGG - Intergenic
939126243 2:138180874-138180896 ATGCAGAAGTGGAGGGTAGGGGG + Intergenic
939186995 2:138872362-138872384 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
939480585 2:142742805-142742827 AAGGAGAGGGTGGGGGAAGAAGG - Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940697653 2:156999846-156999868 CTTGAGAAGGTGAGAATAGATGG + Intergenic
940883420 2:158968875-158968897 GTGGAGAGGGTGATGGGAGAAGG + Intronic
941064239 2:160882956-160882978 AAGGAGCAGCTGGGGGTAGAGGG + Intergenic
941069941 2:160944582-160944604 GTGGAGACAGTGAGGGTAGATGG - Intergenic
941887165 2:170539950-170539972 ATGGAAAAGGTGATGCCAGAGGG - Intronic
942411854 2:175717726-175717748 ATTGAGAAGTTGAGAGAAGAAGG + Intergenic
942572536 2:177328428-177328450 ATGGAGAAGGTAATTGGAGATGG + Intronic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
943330763 2:186556316-186556338 AGGGAGAAAGGGAGGGAAGAAGG - Intergenic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944687140 2:202127543-202127565 ATGGAGAAGGGGACACTAGAAGG + Intronic
944782985 2:203039341-203039363 AAGGAGAAGGGGAGGGGAGGGGG - Intronic
944884079 2:204044706-204044728 ATGGAGAGGATGAGGGAAAAAGG + Intergenic
944897258 2:204177812-204177834 CTGGTGAGGGTGAGGGTGGAGGG + Intergenic
946175703 2:217920962-217920984 AGGGAGAGGGGGAGAGTAGAGGG + Intronic
946531067 2:220570774-220570796 GAGGAGTAGGTGAGGGGAGAGGG - Intergenic
947119762 2:226801318-226801340 AGAGGGAAGGTGGGGGTAGAAGG + Intergenic
947192541 2:227522703-227522725 ATGAAGTAGGTGAGGAAAGAAGG - Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947415266 2:229888848-229888870 GTGGGGAAGGAGAGGGTATAAGG + Intronic
947712915 2:232326073-232326095 AGGGAGGAGGTCAGGGGAGAGGG + Intronic
947732596 2:232439514-232439536 AGGGAGGAGGTCAGAGTAGAGGG + Intergenic
947889909 2:233608245-233608267 TGGCAGAAGGTGAGGGTGGAGGG + Intergenic
947895338 2:233666100-233666122 TGGCAGAAGGTGAGGGTGGAGGG + Intronic
947958225 2:234213104-234213126 ATGGAGAGGGGGAGGGTGCATGG + Intergenic
948494119 2:238334893-238334915 CTGGAGAAGGTGTGGGGTGAAGG - Intronic
948677648 2:239608185-239608207 ATGGAGAAAGGGAGTGTAAAGGG - Intergenic
948815640 2:240509046-240509068 ATGGATGAGTGGAGGGTAGATGG + Intronic
949066165 2:241991547-241991569 CTGGCGAAGGTGAGGGAAGCAGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169106638 20:3001803-3001825 CTTGAGTAGGTGAGGGCAGATGG + Intronic
1169558269 20:6770745-6770767 ATGGGGAAGATGAGGGCAAAAGG + Intronic
1169719374 20:8657059-8657081 AGGGAGAAGGTGAGGGAAGGGGG + Intronic
1169867632 20:10218273-10218295 ATGGAGCTGGCGAGGGTGGACGG + Intergenic
1171083290 20:22210774-22210796 GTGGAGAAGGTTCGTGTAGAAGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1171279293 20:23882502-23882524 AAGTGGAAGGTTAGGGTAGATGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172292089 20:33783981-33784003 ATGGAGAAGTGGAGGGAAAAGGG - Intronic
1172772976 20:37392345-37392367 ATGGAGAAGTTGAGGCCAGGAGG - Intronic
1172952572 20:38731283-38731305 ATGGTGGAGGTGGGGGTAGATGG - Intergenic
1173181866 20:40812195-40812217 GTGGGGAAGGTGAGGGGAGCTGG + Intergenic
1173185034 20:40834024-40834046 ATGGAGGAGGTGAAGAGAGAGGG + Intergenic
1173664190 20:44753439-44753461 CTGGAGAAGGAGAGTGGAGATGG + Intronic
1173860062 20:46277565-46277587 ATGGTGAAGGTGAGTGAAAAGGG + Intronic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174097097 20:48098064-48098086 AGGAAGAAGGTGAGGGTAGATGG + Intergenic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1175077581 20:56389208-56389230 ATGGAGAAGTGGAGGGTCCAGGG - Intronic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175461716 20:59156646-59156668 ATGGGGAAGGTGAGGGTCAAAGG - Intergenic
1175615091 20:60391034-60391056 GTGGACAAAGTGAGGATAGAGGG + Intergenic
1175743333 20:61435956-61435978 CTGGAGAAGGCGAGGGGAGGTGG - Intronic
1175762614 20:61571725-61571747 AGTGAGAAGGGGAGGGGAGAGGG - Intronic
1175841632 20:62031660-62031682 AATGAGAAAGTGAGGGGAGAGGG - Intronic
1175935126 20:62510636-62510658 ATGGAGAGGTGGAGGGTGGAGGG - Intergenic
1176200026 20:63855903-63855925 GTGGAGACGGGGAGGGGAGAAGG + Intergenic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1176275597 20:64265707-64265729 AAGGAGAAGGGGAAGGAAGAGGG - Intronic
1176618812 21:9041781-9041803 GAGGAGAAGGTGAGGTTTGAGGG - Intergenic
1176707181 21:10125376-10125398 AAGGGGAAGGTGAGGTTTGAGGG + Intergenic
1176837074 21:13803050-13803072 AGTGAGAAGGTTAGGGAAGAAGG - Intergenic
1177039379 21:16088136-16088158 TTGCAGAAGCTGAGGGTAGGTGG - Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178239000 21:30877386-30877408 AAGGAGATGGTGAGGGAAGGTGG + Intergenic
1179714623 21:43280628-43280650 ACGGGGAAGGTGGAGGTAGAGGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180223648 21:46376082-46376104 CTGCAGACGGAGAGGGTAGAGGG - Intronic
1180708030 22:17821589-17821611 AGGGTGGAGGGGAGGGTAGAGGG + Intronic
1181822953 22:25489902-25489924 AGGGAGAAGTGGAGGGTAGCAGG - Intergenic
1181880972 22:25979792-25979814 ATGGAGAAGGGGAAGGGAAAGGG - Intronic
1182040845 22:27237863-27237885 ATGTAGAATTTGAGGGGAGAGGG + Intergenic
1182434145 22:30319582-30319604 ATGGAGTAGGGTAGGGTAGGGGG + Intronic
1182565598 22:31196194-31196216 GAGGAGCAGGTGGGGGTAGAGGG - Intronic
1182903099 22:33915262-33915284 ATTGAGAATGGGAGGGTAGGTGG - Intronic
1183093444 22:35539063-35539085 ATGGGGCAGGTGGGGGTGGAGGG - Intergenic
1183115633 22:35690547-35690569 GAGGAGAAGGGGAGGGAAGAGGG + Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1185373226 22:50470356-50470378 GTGGAGAGGGTCAAGGTAGATGG - Intronic
949494613 3:4619831-4619853 AGAGAGAAGGAGAGGGGAGAGGG - Intronic
950312446 3:11970307-11970329 ATGGAGAAGCTGAGCCCAGAGGG + Intergenic
950326435 3:12114658-12114680 ATGGTGAAGTTGAGAGTTGAAGG - Intronic
950499466 3:13354561-13354583 TTTGGGAAGGTGAGGGCAGAGGG - Intronic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950646960 3:14383033-14383055 AGAGAGGAGGTGAGGGAAGACGG + Intergenic
951063102 3:18233670-18233692 GTAGAGAAGCTAAGGGTAGAGGG + Intronic
951735105 3:25854888-25854910 ATGAAGAAGCTGAGAGTAGGAGG + Intergenic
951846276 3:27088010-27088032 AAGGAGGATGTGAGTGTAGATGG + Intergenic
952123536 3:30273397-30273419 ATGGAGACTGGGAGGGTTGAGGG - Intergenic
952653249 3:35751693-35751715 ATGAGGAAAGTGAGGCTAGAAGG + Intronic
953242215 3:41159742-41159764 TTGGAGAAAGTGAGAGTGGAAGG - Intergenic
953392907 3:42544168-42544190 AAGGAGAAAGTGAGGATAGAAGG - Intergenic
953980720 3:47411678-47411700 ATGGAGAAGGTGAGAAGAGGGGG + Exonic
954596776 3:51831528-51831550 AGGGAGGAGGTGAGGGCAGTAGG - Intergenic
954972429 3:54662567-54662589 ATGGAGAAGGTGAGGGCCTCTGG - Intronic
955148985 3:56348126-56348148 AAGGAGAAGCTAAGGGTAGAAGG - Intronic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
956465047 3:69511731-69511753 AAGGAGAAGGGGAAGGAAGAAGG - Intronic
957541128 3:81570462-81570484 AGGGAGAAGATGAAGGTTGATGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
958163665 3:89851424-89851446 ATGGAGTAGGGGAGAGGAGAAGG + Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
959512095 3:107225470-107225492 AGGGAGATGGAGAGGGGAGAGGG - Intergenic
959576582 3:107940750-107940772 ATGGTGGAGGTGGGGGTAGGGGG + Intergenic
959919029 3:111850294-111850316 AGGGAGAAGGTGAGGGGGGCAGG + Intronic
959923060 3:111891127-111891149 ATGGATAAGGTGTTGCTAGAGGG + Intronic
959971584 3:112416032-112416054 ATAGAGATAGAGAGGGTAGAAGG - Intergenic
960417304 3:117400117-117400139 ATGCAGGAGGTCAGGGCAGAGGG + Intergenic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
961384402 3:126515993-126516015 TTGGAGACAGTGAGGGTAGGTGG - Intronic
961522603 3:127475633-127475655 GTGGAGTGGGTGAGGGAAGAAGG - Intergenic
961542741 3:127611129-127611151 CTGCAGGTGGTGAGGGTAGAAGG - Intronic
962459525 3:135596533-135596555 GTGGAGAAGATGAGGGGTGAGGG + Intergenic
962745700 3:138396090-138396112 GTGGAGAAGGGGAGGGAAGGGGG + Intronic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962996371 3:140632951-140632973 AGAGAGAAAGTGAGGGAAGATGG - Intergenic
963320892 3:143807900-143807922 ATGGAGAAGGTGCCGGTAGAGGG + Intronic
963327343 3:143877123-143877145 AAGGAGAAGGTGTGGGGAGGGGG - Intergenic
963833235 3:150031207-150031229 ATTAAGAGGGTGAGGGAAGATGG - Intronic
963911868 3:150822062-150822084 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
964677833 3:159303497-159303519 ATAGAGAGGGAGAGGGAAGAAGG + Intronic
965317021 3:167204977-167204999 ATGGAGAAGATGAGAAGAGAAGG + Intergenic
966430527 3:179827452-179827474 AGGCTGAAGATGAGGGTAGAAGG - Intronic
966942184 3:184754264-184754286 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
966942239 3:184754480-184754502 TGGGAGAAGGTGATGGGAGAAGG + Intergenic
967217033 3:187219561-187219583 ATGGAGATGGTCAAGGTTGAGGG + Intronic
967645362 3:191916674-191916696 ATGGAGAAGTTGAGGAGATAAGG - Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969102583 4:4780473-4780495 ATGGAGAAACTGAGGCTTGAGGG - Intergenic
969599774 4:8169456-8169478 AGGGAGCAGGTGAGGGGTGAGGG - Intergenic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
971443388 4:26715284-26715306 ATGTGGAAGTTGAAGGTAGAAGG - Intronic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971603955 4:28632805-28632827 ATGGAGTTGGTGATGGTTGATGG + Intergenic
971626206 4:28923250-28923272 AGGGAGAAAGAGAGGGGAGATGG - Intergenic
972329165 4:38047756-38047778 AGGGAAAAGGTGAGGGGTGAGGG + Intronic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
973033173 4:45370883-45370905 ATGAAAAAGTTAAGGGTAGAAGG - Intergenic
973307168 4:48665797-48665819 ATGGAGAAGGTGACTGTAAGAGG - Intronic
975259551 4:72280712-72280734 ATGAAGAAGATGAGGAAAGATGG - Intergenic
975273486 4:72466265-72466287 ATGTAGAAGAAGAGGCTAGAGGG + Intronic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975316481 4:72959030-72959052 ATGGAGAAGGTGGATCTAGAGGG - Intergenic
975561782 4:75715423-75715445 ATGGACAAAGAGAGGGTAGAAGG - Intronic
975707788 4:77128134-77128156 ATGGGGATGGTGCGGGAAGAAGG + Intergenic
975962981 4:79935297-79935319 ATGGAGAGGGTGGGGGTGGGGGG - Intronic
976056831 4:81078982-81079004 AGGGAAAAGGTGAGGGAACAAGG + Intergenic
976364068 4:84213715-84213737 AAGGAGAGGGTGAGAGGAGATGG - Intergenic
976420563 4:84838805-84838827 ATTTTGAAAGTGAGGGTAGAAGG - Intronic
976587280 4:86812742-86812764 AAGGAGGAGGTGAGGTTAGAGGG + Intronic
977370420 4:96127195-96127217 ATAGAGAAGGAAAGGGAAGAAGG - Intergenic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978854667 4:113380828-113380850 ATGGAGATGGTGGGGGAGGAAGG - Intronic
979453077 4:120895556-120895578 ATGAAGAAGATGAGGGCAGAGGG - Intronic
980532758 4:134075239-134075261 ATTGTGAATGTGAGGGTTGATGG + Intergenic
980552340 4:134355513-134355535 ATGGAGGAGCTGAGAGTCGATGG + Intergenic
980657146 4:135804016-135804038 AAAGAGAAGGTGGAGGTAGAGGG - Intergenic
980896995 4:138869153-138869175 AGAGAGAGGGTGAGGGGAGAGGG + Intergenic
981080072 4:140631071-140631093 ATGGAAAAGGTGAAAGTATATGG - Intronic
981215352 4:142159273-142159295 GTGAAGAAGGTGAAGGTAAAAGG + Intronic
981546498 4:145899329-145899351 AGGGAGTTGGGGAGGGTAGAGGG + Intronic
981678504 4:147366844-147366866 ATGGAGAAGGTGAGAGATGTAGG + Intergenic
981746086 4:148053643-148053665 ATAGACAATGTGATGGTAGATGG - Intronic
981824517 4:148924890-148924912 GTGGAGACAGTGAGGGTAGAAGG - Intergenic
981884237 4:149653605-149653627 ATGGATCAGGTGAGAGCAGAAGG + Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983846520 4:172526835-172526857 ATGGATAAGGTCAGGGCAGGGGG - Intronic
983968852 4:173846394-173846416 ATGTGGAGGGTGGGGGTAGAAGG + Intergenic
984703739 4:182833877-182833899 AAGGAGGAGGGGAGGGGAGAAGG - Intergenic
984911483 4:184677040-184677062 AAGGGGAAGGGGAGGGGAGAAGG - Intronic
985166098 4:187095728-187095750 AGGGAGAAGGTGAGGCTGCAGGG + Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986067986 5:4254807-4254829 AAGGAGATGGTGAGGGGAGAAGG + Intergenic
986586910 5:9328261-9328283 GTGGATCAGGTGAGAGTAGAGGG - Intronic
986693273 5:10331364-10331386 TTGGAGATGGTGAGGGAAGGAGG - Intergenic
988611957 5:32735236-32735258 ATGGAGGAGGAGGGGTTAGAAGG - Intronic
989219469 5:38940201-38940223 ATGACCAAGGTGAGGGTACAGGG + Exonic
990191651 5:53266559-53266581 ATGGAGTGGGGGTGGGTAGAAGG - Intergenic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
991012525 5:61898959-61898981 ATGGAGGAAATGAAGGTAGAGGG + Intergenic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991377178 5:65977945-65977967 AGGGAGAGGGTTAGGGGAGAGGG + Intronic
992222538 5:74586996-74587018 ATTGAGGAGGGGAGGGAAGATGG + Intergenic
993242600 5:85410288-85410310 TTGGAGAAGGTGCTGGTAGGAGG - Intergenic
993432451 5:87848666-87848688 GGGGAGAAGGTGAGAGAAGAAGG - Intergenic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
994339520 5:98610034-98610056 AATGCGAAGGTAAGGGTAGAAGG - Intergenic
995130918 5:108629620-108629642 AGGGAGAAGGTCTGGGTGGAAGG + Intergenic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
996417822 5:123229178-123229200 ATGTTGAAGGTTAGGGAAGATGG - Intergenic
996696538 5:126402945-126402967 ATGTAGAATGTGAGGCTAAAAGG + Intronic
996988230 5:129594779-129594801 AGGGAGAAGAGGAGGGGAGAAGG - Intronic
997671046 5:135672226-135672248 ATGGAGAATGTAAAGGGAGAGGG + Intergenic
998303441 5:141049440-141049462 ATGTAGAAGGTGAGAGGAAAGGG - Intergenic
1000037371 5:157459784-157459806 AAGGAGAGGGGGAGGGTAGGAGG + Intronic
1000828045 5:166070538-166070560 TTGGAGGAGGTGAGGGTAGATGG - Intergenic
1000930339 5:167243756-167243778 AGGGAGAAGGTAAGAGGAGAGGG - Intergenic
1001025705 5:168222716-168222738 GTGGAGAAGGAGAGAGTATAGGG - Intronic
1001434953 5:171693021-171693043 ACGGAGAAGCTGAGGCCAGAGGG - Intergenic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001961216 5:175881146-175881168 GTGGGGATGGTGAGGGAAGAGGG + Exonic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003369579 6:5511064-5511086 AGGGAGAAGGAGAGGCCAGATGG + Intronic
1003578543 6:7318773-7318795 ATGGAGAATGTGGGGGCAGGAGG - Intronic
1003899744 6:10643341-10643363 ATGGAGAAGGGGAAGGTCAAGGG - Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1006670969 6:35729368-35729390 AGGAAGAAGGTGGGAGTAGATGG - Intergenic
1006763959 6:36488413-36488435 ATGGAGAACAGGAGGGAAGATGG - Exonic
1007707560 6:43799999-43800021 ATGGAGATGGTGAGAGAGGAAGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1008419718 6:51284033-51284055 ATGAAGGAGGTGGGGGAAGAGGG + Intergenic
1008422849 6:51322389-51322411 ATTTAGAAGGTGAGGATAGGAGG - Intergenic
1008428666 6:51389036-51389058 ATGGAGCGGGTGAAGGTAAAAGG - Intergenic
1008551041 6:52631018-52631040 ATGGAGAATATGAGGGAATACGG - Intergenic
1008876061 6:56329379-56329401 ATGGAGAAAGTCAGGGGTGAAGG + Intronic
1010118435 6:72342969-72342991 ATGGAGAGAGTGAGGATATAGGG + Intronic
1010132536 6:72511593-72511615 ATGGAGAAGATAAGGGTATAAGG - Intergenic
1010574819 6:77518004-77518026 GTGGGGAAGGTGAGAGTAGGGGG - Intergenic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011425913 6:87229893-87229915 ATGGAGGTGGTAAGAGTAGATGG + Intronic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1012671269 6:102050763-102050785 AAGGAGAAAAGGAGGGTAGAGGG + Intronic
1012832656 6:104225083-104225105 AGGGAGAAGGTTAGGGAAGGTGG + Intergenic
1013087352 6:106867669-106867691 AGGGAGTCGGTGAGGGTTGAGGG + Intergenic
1013268607 6:108524723-108524745 ATGCAGAAAGTGGGGCTAGAAGG + Exonic
1013290867 6:108717629-108717651 ACGGAGAAGGAGCGGGGAGAAGG - Intergenic
1013822354 6:114170054-114170076 ATGGAGAAGGTTAAAGTAGAAGG + Intronic
1014029247 6:116681759-116681781 ATGGAGAGGGCGAGGCTAGGAGG - Intronic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014822798 6:126011532-126011554 ATGAAGAAGCTGGGGGTAGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015437019 6:133201345-133201367 ATTGGTAAGCTGAGGGTAGAAGG - Intergenic
1015732231 6:136360890-136360912 ATGGAGAAGGTGTGGAAAGCGGG + Intronic
1016995399 6:149959135-149959157 ATGGAGAGAGTGAGGGGTGAGGG - Intergenic
1017247692 6:152244885-152244907 CAGGAGAAAGTCAGGGTAGAGGG + Intronic
1017336516 6:153267349-153267371 AAGGAAAAGGTGAGAGAAGACGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018054028 6:160036241-160036263 ATGGAGAAGCTGAGGGGTGCAGG - Intronic
1018077408 6:160229570-160229592 GTGGAGAAGGGGTGGGTACATGG - Intronic
1018375026 6:163202147-163202169 TGGGAGAAGGTGGGGGCAGAGGG + Intronic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018914064 6:168121922-168121944 AGGGAGAAGGAGTGGGGAGACGG + Intergenic
1020011330 7:4807462-4807484 GGGGAGAAGGAGAGGGAAGAAGG - Intronic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020081375 7:5287768-5287790 AGAGAGCAGGTGAGGGAAGAAGG - Intronic
1021658283 7:22893518-22893540 ATGGACAAGGTGTGGAAAGATGG - Intergenic
1021670083 7:23026824-23026846 ATGGGGAAGGAGAGGATACATGG + Intergenic
1022310157 7:29189689-29189711 AGGGAGAAGGGGAGTGTAGGGGG - Intronic
1022536107 7:31099594-31099616 GAGGAGAGGGAGAGGGTAGAGGG + Intronic
1022574812 7:31487349-31487371 ATGGTGAAGGAGAGAGCAGAAGG - Intergenic
1023931133 7:44707380-44707402 ATTGAGCAGGTGAGGGCAGGTGG + Exonic
1023937655 7:44750751-44750773 ATGGACAAGGTCAGTCTAGAGGG - Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024457880 7:49629799-49629821 ATGGAGAAAGTGTGTGTGGAGGG - Intergenic
1025197536 7:56944380-56944402 AGAGAGCAGGTGAGGGAAGAAGG + Intergenic
1025674411 7:63632559-63632581 AGAGAGCAGGTGAGGGAAGAAGG - Intergenic
1026647345 7:72183316-72183338 AAGGAGGGGGAGAGGGTAGATGG + Intronic
1026837546 7:73648435-73648457 AGAGAGAAAGTGAGGGGAGAGGG - Intergenic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1027161175 7:75803511-75803533 ATGCAGAAGAAGAGGGTAGCAGG - Intergenic
1028119139 7:87037509-87037531 ATGGAGAGGGAGAGAATAGATGG - Intronic
1028409970 7:90519835-90519857 ATGAAGGAGGTGAAGGAAGAAGG - Intronic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1029493615 7:100885405-100885427 ATGGAGAAGTGGAGGGTAGAGGG + Intronic
1029697159 7:102221060-102221082 AGGGAGGAGGTTAGGGGAGAGGG - Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030773370 7:113502471-113502493 TTGCAGAAGGTAAGGGAAGAAGG + Intergenic
1031141667 7:117949536-117949558 ATGGACAATGTGAAGGGAGATGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032361423 7:131258984-131259006 AGGGAGAATGTGAGGGTAACAGG + Intronic
1032613616 7:133442694-133442716 ATGGAGGAGGTGGGAGTAGATGG + Intronic
1033193358 7:139304322-139304344 GTGGGGAAGGTCAGGGTAGAAGG + Exonic
1033407012 7:141079664-141079686 ATGGAGATGGAGAGGGCAGGAGG - Intronic
1034704409 7:153127703-153127725 GGGAAGAAGGTGAGGGCAGATGG - Intergenic
1037517998 8:19652938-19652960 CTGGAAAATTTGAGGGTAGAGGG - Intronic
1037570371 8:20152815-20152837 ATGAAGTAGGTGAGGGGAGATGG + Intronic
1037580886 8:20245519-20245541 GTGGGGAAGGTTAGTGTAGACGG - Intergenic
1037587973 8:20290992-20291014 GTGGAGGAGCTGAGGGGAGAAGG - Intronic
1037610108 8:20468935-20468957 ATGGAGAGGCTGAGTGTAAAAGG - Intergenic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038680091 8:29658778-29658800 ATGGAGGGGGTGAGGATGGAAGG - Intergenic
1038995473 8:32918258-32918280 TTGGAGAAGGTGAGAGACGATGG + Intergenic
1039383839 8:37112980-37113002 ATGGAGATGGGAAGAGTAGAAGG - Intergenic
1039415536 8:37390711-37390733 AAGGAGATGGTGAGGCGAGAGGG + Intergenic
1040360771 8:46662146-46662168 ATGGAGATGGTTAGGGTTGTGGG + Intergenic
1040822560 8:51580146-51580168 TTGAAGAAGGTGTGGGCAGAGGG + Intronic
1041041739 8:53853480-53853502 CAGCAGCAGGTGAGGGTAGAAGG + Intronic
1042120202 8:65479093-65479115 ATTGACAAGGTGAAGGCAGAGGG + Intergenic
1042741150 8:72048346-72048368 CTGTAGAACTTGAGGGTAGAGGG + Intronic
1042756802 8:72223159-72223181 CTGCAGAACTTGAGGGTAGATGG + Intergenic
1044893573 8:96863507-96863529 GTGGTGAAGGTGAGGGTAAAGGG + Intronic
1044995883 8:97837746-97837768 CAGGGGACGGTGAGGGTAGAAGG + Intronic
1045944259 8:107777621-107777643 ATGGGGAAGTTGAGGGAAAATGG - Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046877652 8:119274197-119274219 GTGGGGAATGTGAGGATAGAGGG + Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047263530 8:123283524-123283546 TTGGGGAAGCTGAGGCTAGAAGG + Intergenic
1047391526 8:124455854-124455876 AAGGGGAAAGTGAGGGTAGGAGG + Intronic
1047927832 8:129698318-129698340 ATGGAGGAGGCAAGGGGAGAAGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048165607 8:132059061-132059083 AGGGAGAAAGAGAGGGTAGAAGG - Intronic
1048186104 8:132242287-132242309 ATGGAGGTGGGGTGGGTAGAAGG + Intronic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048618489 8:136105789-136105811 ATGGAGAAATTGAGAGTTGAAGG + Intergenic
1048842285 8:138576679-138576701 ATGCAGAAAGAGAGGGGAGAGGG + Intergenic
1049011815 8:139892295-139892317 TAGGAGAAGGTCAGGGTAGAGGG + Intronic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049383817 8:142330985-142331007 AGGGACAGGGTGAGGGCAGAAGG + Intronic
1049743329 8:144251455-144251477 GTGGAGAAAGTGAGGTAAGAGGG - Intronic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1051944326 9:22548747-22548769 ATGGAGATGGTGAAGGCAGTAGG - Intergenic
1052112746 9:24608963-24608985 AAAGAGAAAGGGAGGGTAGAAGG - Intergenic
1052152850 9:25140452-25140474 ACTGAGAAGGGGAGGGAAGAGGG + Intergenic
1052642437 9:31186177-31186199 ATGAAGAAGTGAAGGGTAGAGGG - Intergenic
1053329324 9:37188841-37188863 AAAGAGAAGGGGAGGGGAGAGGG - Intronic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1055291720 9:74788581-74788603 ATGCAGAAGATAAAGGTAGATGG + Intronic
1055527609 9:77151118-77151140 AAAGAGAAGAAGAGGGTAGATGG + Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055856420 9:80693116-80693138 AGGGAGAAAGGGAGGGAAGAAGG - Intergenic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057517428 9:95734034-95734056 GTGGAGAGGGGAAGGGTAGAAGG - Intergenic
1058140399 9:101351898-101351920 ATGGATAAGGAGAGGGGAAATGG + Intergenic
1058634501 9:107023364-107023386 AGGGAGCTGGTGAGGGTGGATGG + Intergenic
1058798402 9:108520420-108520442 ATGTAGTAGGTGGGGGTAGTGGG + Intergenic
1058962910 9:110008582-110008604 ATGGGGAAGGCGAGTCTAGAAGG + Intronic
1058967057 9:110048535-110048557 GAGGAGAAGGTGTGGGTAGATGG + Intronic
1059449596 9:114362158-114362180 ATGGGGAAACTGAGGCTAGATGG - Intronic
1059653109 9:116333856-116333878 ATGGTGATGGTGGGGGTGGAGGG - Intronic
1059740200 9:117142645-117142667 ATGGAGAAAGTAAGGTCAGAAGG + Intronic
1059752921 9:117265523-117265545 ATGGAGAGGGTCAGTGTTGAGGG + Intronic
1059761247 9:117339754-117339776 AGGAAGAAGGTGAAGGAAGAAGG + Intronic
1059869817 9:118560576-118560598 AAAGAAAAGGTGAGGGTAGCAGG + Intergenic
1060206405 9:121685143-121685165 ATGGAGGGAGTGAGGGTGGAGGG - Intronic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060625391 9:125107807-125107829 AGGGAGATGGAGAGGGGAGAGGG - Intronic
1061036797 9:128118726-128118748 ATGGAGAATGTAAGGGTACAGGG + Intergenic
1061245111 9:129397571-129397593 ATGGATAAGGGGATGGTTGAAGG + Intergenic
1061455270 9:130692903-130692925 AAGGAGAGGGAGAGGGTAGTGGG + Intergenic
1061657488 9:132104238-132104260 CTGGGGAGGGTGAGGGTAGAGGG - Intergenic
1061900096 9:133668482-133668504 AGGGTGAGGGTGAGGGGAGAGGG - Intronic
1061926619 9:133809026-133809048 ATTGAGAAGGTGAGGGCAGATGG - Exonic
1062362608 9:136194757-136194779 AAGGGGAAGGGGAGGGAAGAGGG - Intergenic
1062638429 9:137503655-137503677 AAGGAGAAGGGGAAGGAAGAAGG + Intronic
1202791927 9_KI270719v1_random:94250-94272 AAGGGGAAGGTGAGGTTTGAGGG + Intergenic
1185581270 X:1213039-1213061 AGGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185581280 X:1213058-1213080 AGGGGGAAGGGGAGGGGAGAGGG - Intergenic
1186057764 X:5668148-5668170 TTGCAGAAGGTGAGGTCAGAAGG + Intergenic
1186133655 X:6496211-6496233 ATGGAGAAGGTGGGGAGAAAGGG - Intergenic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186574093 X:10746997-10747019 ATGGAGAAGGTGAGAGGTGATGG + Intronic
1186731502 X:12415356-12415378 ATGGAGGAGGTAAGGGTTGCAGG - Intronic
1186942800 X:14529295-14529317 ACGGAGAGGGTGAGGGAAGTGGG - Intronic
1187176144 X:16897915-16897937 ATGGAGAGAGTGAGGCTGGAGGG + Intergenic
1187505386 X:19874755-19874777 AAAGAGAAGGTGTGGGGAGAAGG + Intronic
1188368150 X:29335266-29335288 ACGGAGACGGAGAGGGGAGAGGG + Intronic
1188596413 X:31906803-31906825 AAGTAGAAGGTGAGGTTGGAGGG - Intronic
1189121346 X:38398589-38398611 AAGGAGAGGGTGGGGGCAGAGGG - Intronic
1189230769 X:39450895-39450917 ATGGAGGAGGGGAGAGTGGAGGG - Intergenic
1189377371 X:40476084-40476106 GTGGAGAAGGGGTGGGAAGAGGG - Intergenic
1189961144 X:46325896-46325918 ATGGAGGCGGGGAGGGGAGATGG + Intergenic
1190011607 X:46789973-46789995 CTCGAGATGCTGAGGGTAGAAGG + Intergenic
1190185323 X:48228626-48228648 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190190722 X:48274694-48274716 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190664860 X:52687299-52687321 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190674562 X:52771120-52771142 ATGGTGATGGTGAGGCTGGAAGG - Intronic
1190731248 X:53227461-53227483 GTGGAGGAGGTGAGGGAAAAGGG + Intergenic
1190856261 X:54297784-54297806 AAGGAGAAGGTCAGGCTCGATGG + Intronic
1191843862 X:65532038-65532060 AGGGAGAAGGACAGGCTAGAGGG - Intronic
1191864896 X:65696054-65696076 ATGGGGAAGGTGAGGAGACAAGG - Intronic
1192219015 X:69184430-69184452 GTGGAGAAGGAGGGGGCAGAGGG - Intergenic
1192433463 X:71127784-71127806 AAGGAGAAAGTGAGGGATGAAGG - Intronic
1195625651 X:107003712-107003734 ATGAAGTAGGTGTGGGCAGAGGG - Intergenic
1195788790 X:108558699-108558721 ATGGAGCAGGGAAGGGTAAAAGG - Intronic
1195943051 X:110180842-110180864 ATGGAGAAGGGAAGTGTGGAAGG - Intronic
1196003075 X:110807158-110807180 ATGGAGAAAGGAGGGGTAGAAGG + Intergenic
1196392388 X:115221836-115221858 ATGTAGAAGATGAGGGGAAAGGG + Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198317059 X:135478382-135478404 AAGGAGAGGTTGAGGATAGAGGG - Intergenic
1199708674 X:150452425-150452447 ATGGTGATGGAAAGGGTAGAAGG + Intronic
1199871802 X:151904841-151904863 ATGGAGAAGGGGCGGGAACAGGG + Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201708377 Y:16961858-16961880 ATGTAGATGATGAGGGTTGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic