ID: 1127347853

View in Genome Browser
Species Human (GRCh38)
Location 15:58118914-58118936
Sequence ACTTCCATTCCCCCACTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127347853_1127347857 6 Left 1127347853 15:58118914-58118936 CCTGCTAGTGGGGGAATGGAAGT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1127347857 15:58118943-58118965 GTGCAGGGACTTACAGAGAATGG 0: 1
1: 0
2: 1
3: 24
4: 196
1127347853_1127347856 -9 Left 1127347853 15:58118914-58118936 CCTGCTAGTGGGGGAATGGAAGT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1127347856 15:58118928-58118950 AATGGAAGTGGAAAAGTGCAGGG 0: 1
1: 0
2: 10
3: 26
4: 390
1127347853_1127347855 -10 Left 1127347853 15:58118914-58118936 CCTGCTAGTGGGGGAATGGAAGT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1127347855 15:58118927-58118949 GAATGGAAGTGGAAAAGTGCAGG 0: 1
1: 0
2: 2
3: 32
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127347853 Original CRISPR ACTTCCATTCCCCCACTAGC AGG (reversed) Intronic
900739850 1:4324140-4324162 TGTTCATTTCCCCCACTAGCTGG - Intergenic
902504092 1:16928296-16928318 ACCTCCCTTCCCCCAACAGCTGG + Intronic
902581305 1:17409481-17409503 ACTTCCATCCCCCCCCTCTCTGG + Intronic
903871223 1:26436282-26436304 ACTTCAATTCCCCAAGTAGCTGG - Intronic
911596793 1:99807020-99807042 ACTTACATTAGCCCACTATCAGG + Intergenic
921392554 1:214631232-214631254 ACTTCCATTCCCCGCATTGCTGG + Intronic
922435457 1:225600741-225600763 ACCTCATTTCCCCCAGTAGCTGG - Intronic
923015977 1:230126993-230127015 ACCTCCATTCACCCACTACCAGG - Intronic
1067008040 10:42683123-42683145 AGTTCCATTCTCACACTAACTGG - Intergenic
1067343776 10:45423735-45423757 ACTTGCAGTCCCCCACTCGGTGG - Intronic
1072976365 10:100062376-100062398 ACTGCCAGGCCCCCACAAGCAGG - Intronic
1074021711 10:109591361-109591383 ACTTGTAATCCCCCACTACCTGG - Intergenic
1083630167 11:64091181-64091203 ACTTCCCTTGCCCCAGGAGCTGG - Intronic
1083907047 11:65679661-65679683 ACCTCCACCCCCCAACTAGCTGG - Intergenic
1084215903 11:67646726-67646748 ACTTCCCTCCCGCCACCAGCAGG - Intronic
1084986496 11:72877889-72877911 ACCTCCATTTCCCGAATAGCTGG - Intronic
1088137994 11:106580400-106580422 TCTTCCATGCTTCCACTAGCAGG - Intergenic
1088507626 11:110541862-110541884 ACTTTCCTTCCTCCCCTAGCTGG + Intergenic
1089311682 11:117562161-117562183 ACTTCCATGCCCCTAGCAGCTGG - Intronic
1094443586 12:30506136-30506158 ACTTCCATTTACCCAACAGCAGG + Intergenic
1095669007 12:44836262-44836284 AATTCTATTCCCACACTAGGCGG + Intronic
1104260382 12:127176779-127176801 ACCACCCTTCCCCCACTAGCTGG + Intergenic
1122182995 14:99969468-99969490 ACCTCCATTCCTCCTCTGGCAGG - Intergenic
1127347853 15:58118914-58118936 ACTTCCATTCCCCCACTAGCAGG - Intronic
1138300240 16:55920026-55920048 ACCACCCTTCCCCCACCAGCAGG + Intronic
1142671047 17:1487519-1487541 GCTCCCACTCCCCCACCAGCTGG - Intronic
1148105386 17:45116077-45116099 ACTTCCAATCCCCAACATGCAGG - Intronic
1149589818 17:57820440-57820462 ACTCCCATTCCCCCAAAAGTGGG - Intergenic
1151673312 17:75584965-75584987 ACTCCCATGCCCCCACTGACCGG - Intergenic
1152299399 17:79486272-79486294 CCTACCATTCCCCCACTTCCTGG + Intronic
1152385361 17:79970951-79970973 ACTTCCATTCCCACACTGGGAGG - Intronic
1155397911 18:25405952-25405974 ACTTCCATGCCCCCTCCAGGTGG + Intergenic
1155785108 18:29886584-29886606 AATTCCCTTCCCCCACTTGGAGG - Intergenic
1162993411 19:14318383-14318405 ACTTCCATTCTCCCTGTGGCTGG - Intergenic
1165139411 19:33689893-33689915 ACTTCCATTCCACCCCTGCCTGG + Intronic
926207864 2:10846910-10846932 TCTACCATCCCCCCAATAGCTGG + Intergenic
928707771 2:33969341-33969363 AGTGCCATTTCCCCAATAGCAGG - Intergenic
930541084 2:52707625-52707647 ACTTCTCTTCTCCCAGTAGCAGG - Intergenic
932617969 2:73247940-73247962 ATTTCCATGCCCCCACCAACTGG - Intronic
932831784 2:74997061-74997083 ACTCCCATTCCCAAACTAGATGG - Intergenic
934761472 2:96859256-96859278 TCTTCCGTGCCCCAACTAGCGGG - Intergenic
935352833 2:102168633-102168655 ACTTCCATTGTCTCATTAGCTGG - Exonic
936827451 2:116599667-116599689 ACTTGCATTCCCCCAGCAGCTGG - Intergenic
939006242 2:136790978-136791000 CCTTCCAGTGCCCCAGTAGCTGG - Intronic
946107828 2:217387642-217387664 CCTTCCATGCCCCCAACAGCTGG - Intronic
946288522 2:218725012-218725034 ACTTCAGCTCCCCGACTAGCTGG + Intronic
947686816 2:232094602-232094624 ACTTCCACCTCCCCAGTAGCTGG - Intronic
1174536716 20:51257004-51257026 AGTTCAATTCCCACACTACCTGG + Intergenic
1176416874 21:6481071-6481093 CCTTCCATGCCCCCACAACCTGG + Intergenic
1179260576 21:39755081-39755103 ACTTCTAGTCCCCGACAAGCAGG - Intronic
1179663169 21:42891484-42891506 ACTTCCACACCACCACCAGCGGG - Intronic
1179692372 21:43089404-43089426 CCTTCCATGCCCCCACAACCTGG + Intergenic
1180390574 22:12278350-12278372 ATTACCATTCTCCCACTATCTGG - Intergenic
1180409169 22:12586407-12586429 ATTACCATTCTCCCACTATCTGG + Intergenic
1183901126 22:41006867-41006889 ACTTCAAATTCCCCAATAGCTGG + Intergenic
1185385200 22:50528734-50528756 CTTTCCATTCCCTCACCAGCTGG - Intronic
950152911 3:10702192-10702214 ACTTCCTTTCCCCTACAAGGTGG - Intronic
954946890 3:54433953-54433975 GCTTCCATTCCCCCACCTGGTGG + Intronic
956113406 3:65894229-65894251 ACTTCCATTTTCTCACTAGTAGG - Intronic
958996576 3:100912799-100912821 AGTTCCACTCACCCACTAGTTGG + Intronic
960048622 3:113220399-113220421 ATTTCCATTACCCAAGTAGCTGG - Intronic
961142208 3:124565110-124565132 ACTTCCTTTCCTCCACTAGATGG + Intronic
961644531 3:128385666-128385688 AGTTCCATTCCACCACTCACTGG + Intronic
962925770 3:139992072-139992094 ATTTCCATTCCTCTAGTAGCAGG - Intronic
967840564 3:194001942-194001964 ACTTCCGTTCCCCCACTCCTCGG + Intergenic
970192772 4:13531078-13531100 ACTTCCATTACCCCACTTTGGGG - Intergenic
970233329 4:13933366-13933388 AGTTCCCTTATCCCACTAGCAGG + Intergenic
970406532 4:15769397-15769419 TCTTCAGTTCCCCCACTAGAAGG - Intergenic
971655065 4:29333629-29333651 AGTTTCTTTCCCCCACTTGCAGG + Intergenic
975383936 4:73733189-73733211 ACTTCCTTTCCCCCAAGAGTGGG - Intergenic
975885249 4:78957248-78957270 ACTGTCATTCCCCCACTGACAGG - Intergenic
980695111 4:136344378-136344400 ACTTCAGTTCCCCAAGTAGCTGG - Intergenic
981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG + Intergenic
982167862 4:152631552-152631574 TCTCCCCTTCCCCCAGTAGCTGG + Intronic
983072893 4:163291135-163291157 ACTTCCTTCCCTCCACAAGCGGG + Intergenic
985623413 5:968687-968709 ACTGCCATTCCCCCACTGTGTGG - Intergenic
986794426 5:11194895-11194917 ACTTCCATGCTCCCACTACCAGG - Intronic
989309667 5:39999886-39999908 GCTTCCATGCCCCCTCTAGATGG - Intergenic
992593187 5:78317550-78317572 ACTTTCCTTCCCCCACTTGGAGG - Intergenic
997387609 5:133486016-133486038 AGTGCCATTCCCCCAGGAGCTGG - Intronic
1007741189 6:44010555-44010577 AGTTCCAAGCCCCCACTGGCAGG + Intergenic
1010058949 6:71599658-71599680 ATTTCCATTTCCCCAGTAGTAGG + Intergenic
1012978887 6:105809440-105809462 ACTTCTATTGGGCCACTAGCCGG + Intergenic
1014311520 6:119808512-119808534 ACTTGCATTCTCCCACTCACTGG + Intergenic
1015012745 6:128371758-128371780 CCTCCCCTTCCCCCAGTAGCTGG - Intronic
1015509449 6:134023398-134023420 ACTTCCATTCCCTTTCTAGAGGG - Intronic
1017410718 6:154165216-154165238 ACTTCCATACCACTACTACCAGG + Intronic
1018143583 6:160863294-160863316 CCTTCCTTTCCCCCACTGGGGGG + Intergenic
1018676542 6:166226965-166226987 ACTTCCACTACCCCACAACCCGG - Intergenic
1019848226 7:3527915-3527937 CCTACCATTCACCCCCTAGCTGG - Intronic
1019848311 7:3528289-3528311 CCTACCATTCACCCCCTAGCTGG - Intronic
1020529789 7:9318735-9318757 ACTGCCTTTTCCCCAATAGCAGG + Intergenic
1022898075 7:34773077-34773099 ACTCCCATTGACCCACTAACGGG - Intronic
1024144081 7:46493392-46493414 TCTGCCATTCACCCACTAGATGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1030695687 7:112582413-112582435 ACATTCATTCCACCACTTGCAGG + Intergenic
1033777007 7:144622472-144622494 CCTTTTTTTCCCCCACTAGCAGG - Intronic
1037401678 8:18500463-18500485 GCTTCCACTCCCCCACTTCCAGG - Intergenic
1042129039 8:65568354-65568376 ACTTCCATTCCCACAGCAACTGG + Intergenic
1043504741 8:80891189-80891211 GCTTCCATTCCTCCACTCCCAGG + Intergenic
1047186627 8:122639049-122639071 ACTTTCATTACTCCACTAGGGGG - Intergenic
1047528206 8:125651941-125651963 CCTCCCATTCCACCACTAGAAGG - Intergenic
1050155021 9:2657598-2657620 ACTACCATCTCCCCACTAACAGG - Exonic
1050459238 9:5863051-5863073 ATTTCCATTGCCCCAGGAGCTGG - Intergenic
1059318155 9:113444941-113444963 ACTGCCATTTCCCCACCATCTGG + Intronic
1060914925 9:127382495-127382517 ACTTTAAATCCCCCAGTAGCTGG - Intronic
1062041002 9:134404288-134404310 ACTCCTATTCCCCCACCAGGAGG - Intronic
1187646827 X:21356563-21356585 ACTTCCATTCCCCGCCTGGCAGG - Intergenic
1189273628 X:39769251-39769273 ACTTCCAGTCCTCCTCTTGCAGG + Intergenic
1189608910 X:42710618-42710640 ACCTCCACTGCCACACTAGCAGG - Intergenic
1190578027 X:51860949-51860971 AATTCCATTCCCACCCTACCTGG + Intronic
1193052465 X:77115762-77115784 ACTTCCTTACCCACACCAGCTGG + Intergenic
1195404439 X:104497364-104497386 TCTTCCATTAGCCCACTGGCTGG + Intergenic
1196033561 X:111117941-111117963 ACTACCATTCCCAAACTAGGTGG - Intronic
1199308749 X:146297977-146297999 ACTTCCATAGCCACACCAGCTGG + Intergenic
1201539916 Y:15094834-15094856 ACTTCAACTTCCCCAGTAGCTGG + Intergenic
1202161394 Y:21939847-21939869 ACTTCCAGAGCCCCGCTAGCAGG - Intergenic
1202229962 Y:22646526-22646548 ACTTCCAGAGCCCCGCTAGCAGG + Intergenic
1202313194 Y:23549639-23549661 ACTTCCAGAGCCCCGCTAGCAGG - Intergenic
1202557608 Y:26120955-26120977 ACTTCCAGAGCCCCGCTAGCAGG + Intergenic