ID: 1127349684

View in Genome Browser
Species Human (GRCh38)
Location 15:58138185-58138207
Sequence CAGGGCCCGTCACTGTGATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127349679_1127349684 12 Left 1127349679 15:58138150-58138172 CCTGCAATTGTGTAACATGAAAA 0: 1
1: 0
2: 0
3: 12
4: 218
Right 1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127349684 Original CRISPR CAGGGCCCGTCACTGTGATT TGG Exonic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902340193 1:15778102-15778124 CAGGGCCAGTCACTGTGGCTGGG + Intronic
904405875 1:30287613-30287635 CAGGGCCCCTCTCTGGGGTTTGG - Intergenic
906646003 1:47475558-47475580 CAGGGCCTGTCCCTCTGCTTGGG + Intergenic
908790782 1:67779294-67779316 CAGCCTCCGTCTCTGTGATTTGG - Intronic
909696449 1:78473496-78473518 AAGGGCCCTGCTCTGTGATTTGG + Intronic
912456170 1:109798986-109799008 CAGATCCCATCACTGGGATTTGG - Intergenic
919788532 1:201275509-201275531 CTGGGCCCGTGACTGTGAGACGG + Intergenic
923063924 1:230500918-230500940 CAAGCCCCGCCCCTGTGATTTGG - Intergenic
924129764 1:240894960-240894982 CAGGCCCCATCACTGGCATTGGG - Intronic
1064287574 10:14005353-14005375 AAGAGCCCGTCACTGTGCTAGGG - Intronic
1067086032 10:43238664-43238686 CAGGGCCCCTGACTGCCATTCGG + Intronic
1069915748 10:71785632-71785654 CAGGGATCGTCACTGTGAACCGG + Intronic
1072422931 10:95304622-95304644 CAGGGCCCTTCATTGTTCTTAGG + Intergenic
1075947781 10:126453258-126453280 CAGGGCCTCTCGCAGTGATTTGG + Intronic
1076797174 10:132803999-132804021 CAGGGCCCAGCCCTGTGCTTGGG + Intergenic
1078063549 11:8063056-8063078 CAGGCCCAGACACTGTGATGGGG - Intronic
1079478043 11:20851825-20851847 CAGAGCCCCTCACAGTGATTGGG + Intronic
1079492949 11:21009945-21009967 CAGGGCCCGTAACAGTGGGTGGG - Intronic
1083713110 11:64560662-64560684 CAGAGCCAGGCACTGTGATGAGG - Intronic
1084478249 11:69400955-69400977 CAGGGCCCGACAGTGTGCTCAGG + Intergenic
1089595478 11:119576390-119576412 GTGGGCCCGTCACTGGGTTTAGG + Intergenic
1091176396 11:133562120-133562142 CAGGGCCCGTCCCAGTGCCTGGG - Intergenic
1094728879 12:33151870-33151892 CAGGGCCCATCCCTTTGTTTTGG - Intergenic
1095991198 12:48035765-48035787 CTGAGCCCATCACTGTGGTTTGG - Intergenic
1102340400 12:112116940-112116962 CAGGGCCTGGCACCTTGATTAGG + Intergenic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1103341787 12:120224765-120224787 CAGGGCCCCTCCCTGTGACGTGG - Intronic
1103597272 12:122031362-122031384 CAGGGCTTGGCACTGTGTTTTGG + Intronic
1103720122 12:122969242-122969264 CAGAGCCAGTCTCTGTGACTAGG - Intronic
1104760466 12:131295061-131295083 CTGGGCCCGTCCCTGTGACCAGG - Intergenic
1104819312 12:131665724-131665746 CTGGGCCCGTCCCTGTGACCAGG + Intergenic
1105428192 13:20313717-20313739 CAGCGTCCCTCCCTGTGATTTGG - Intergenic
1107964957 13:45589714-45589736 CAGGCCCCTTCACTGTGTCTGGG + Intronic
1108374611 13:49802347-49802369 CAGGGCCCATGTCTGTAATTTGG + Intergenic
1112570193 13:100587144-100587166 CAGGGCCCTTACCAGTGATTAGG - Intronic
1114476510 14:22998870-22998892 CATGTCCAGTCACTGTGATGGGG + Exonic
1118500264 14:66355812-66355834 CAGAGCCCATTTCTGTGATTTGG + Intergenic
1127349684 15:58138185-58138207 CAGGGCCCGTCACTGTGATTTGG + Exonic
1129657000 15:77530993-77531015 CAGGGACCTACACTGTGTTTGGG - Intergenic
1132846967 16:2005138-2005160 CAGGGCCTTTCCCTGTGTTTGGG - Intronic
1135861739 16:26062352-26062374 CAGTGCTTGGCACTGTGATTGGG + Intronic
1137711743 16:50571541-50571563 GAGAGCCCGTCACTGGGACTGGG - Intronic
1141502515 16:84453633-84453655 CTGGGCCCGTGACTGTGTTCTGG - Intronic
1143444089 17:6996927-6996949 CAGGGCCCTGCACCGTGATGCGG - Exonic
1146939633 17:36835587-36835609 CAGGGCCTATCACTGTGGTCAGG - Intergenic
1151539559 17:74758144-74758166 CAGAGACGGTCACTGGGATTAGG + Intronic
1161801564 19:6419169-6419191 CAGGGCCTCTCATTGTGATGTGG - Intronic
931417917 2:62098967-62098989 CAGGGCCTTTAACTCTGATTTGG + Intronic
931595305 2:63935764-63935786 CATGTCCAGTCACTGTGATCAGG - Intronic
932223945 2:70024400-70024422 CTGGGCCTGTCACTCTGGTTTGG + Intergenic
935208833 2:100921114-100921136 CAGATCCCGCCACAGTGATTTGG + Intronic
938647535 2:133346969-133346991 CAGGGCCCACCACAGTGATGAGG - Intronic
1172646096 20:36470627-36470649 CAAGACTCGTCACAGTGATTAGG - Intronic
1176002690 20:62840097-62840119 CAGAGCCCTTCACTGAGATGAGG - Intronic
1178376021 21:32068007-32068029 CAGGGCCCTGCACTGTGAATAGG + Intergenic
1178817384 21:35944219-35944241 CAGTGCCGGGCACTGTGATAAGG - Intronic
1182780493 22:32863561-32863583 CAGGGCCTCTCACTGTCAATGGG + Intronic
1183542982 22:38440649-38440671 CAGTGCCAGTCGCTGTGATGAGG + Intronic
1184788938 22:46687407-46687429 CAGGGCCCGTCATTGTGGGCTGG - Intronic
950329987 3:12148578-12148600 CAGGGCAAGCCACTGGGATTTGG + Intronic
952153026 3:30613073-30613095 CAGGGCCCGTACCTATGACTGGG + Intronic
957205701 3:77195997-77196019 CAGGGCCACTCACATTGATTCGG + Intronic
962712180 3:138097454-138097476 CAGTGGCCTTCACTGTGAATGGG - Intronic
963927642 3:150967798-150967820 CAGTGCCTGTCACTGAGAGTTGG - Intronic
968986111 4:3875322-3875344 CAGGCCCCATCAGTGTGATTTGG + Intergenic
974594753 4:64000738-64000760 CAGGGCCTTTAACTCTGATTTGG + Intergenic
985796225 5:1964117-1964139 CAGGGTCAGTCAGTGGGATTTGG - Intergenic
988590249 5:32542553-32542575 CAGGTCACTTCACTTTGATTGGG + Intronic
988608838 5:32706014-32706036 CAGGCCCCGCCACTGACATTGGG - Intronic
992878977 5:81086530-81086552 CAGTTCCCGTCATTGAGATTAGG - Intronic
994097080 5:95857176-95857198 CAAGGCCCCTCACTGTAATGTGG - Intronic
998645798 5:144060522-144060544 CAGGGCCTGTCAGTGTGTTGGGG + Intergenic
1000056776 5:157614043-157614065 CTGGGCCAGTCACTGTGACCGGG + Intergenic
1002290874 5:178199902-178199924 CTGGGCCTGGCACTGAGATTTGG - Intergenic
1003846315 6:10177637-10177659 CTGTACCCGTAACTGTGATTCGG + Intronic
1005121431 6:22393479-22393501 CAAGGCCTCTCAATGTGATTTGG + Intergenic
1007726260 6:43917645-43917667 CAGCCCCCCACACTGTGATTGGG + Intergenic
1013196117 6:107846719-107846741 CAGGGCCAGGCAGTGTTATTAGG + Intergenic
1030647927 7:112084761-112084783 CAAGTCATGTCACTGTGATTTGG - Intronic
1031784250 7:126008909-126008931 CAGGGCCTGTCAGTGTGTTGGGG - Intergenic
1034983610 7:155494229-155494251 CAGGGCTCCTCACTCGGATTTGG - Intronic
1037646999 8:20801228-20801250 CAGGGCCAGACTCAGTGATTTGG + Intergenic
1039934897 8:42033754-42033776 CAGGGGCCGGCACAGTGATTAGG - Intronic
1040017007 8:42708033-42708055 CAGGGCCCATCTCTGTGAAGAGG + Intronic
1047430746 8:124789610-124789632 CAGGGCACCTCACCGTCATTGGG - Intergenic
1056763070 9:89428324-89428346 CAGGGCCAGGGACTGTGTTTGGG - Intronic
1057865290 9:98675342-98675364 CAGGACTTGTCACTGTGGTTAGG - Intronic
1061845319 9:133384977-133384999 CTGGGCCCACCACTGTGCTTCGG - Intronic
1061965405 9:134011092-134011114 CAGAGCCCGCCACTGTGGGTGGG - Intergenic
1186484542 X:9923814-9923836 CAGTGCCTGTAACTATGATTTGG + Intronic
1189198706 X:39173484-39173506 CAGAGGCCCTCACTTTGATTAGG + Intergenic
1194179770 X:90697339-90697361 CAGGGTCAGTCACTGTGTATGGG - Intergenic