ID: 1127350549

View in Genome Browser
Species Human (GRCh38)
Location 15:58147710-58147732
Sequence AACCCTATGCTTCTATCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127350545_1127350549 28 Left 1127350545 15:58147659-58147681 CCTTAGAGTCTTTCTGGAAATTC 0: 1
1: 0
2: 0
3: 16
4: 229
Right 1127350549 15:58147710-58147732 AACCCTATGCTTCTATCAACAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127350549 Original CRISPR AACCCTATGCTTCTATCAAC AGG Intronic
903403597 1:23077526-23077548 AACCCTATCATTTTATAAACTGG + Intronic
906409345 1:45566543-45566565 AAACCTCTGCTTCTCTCACCTGG + Intronic
907109741 1:51916120-51916142 AACACTATGCTGCAATCAGCTGG + Exonic
912059889 1:105654401-105654423 AACACTATACTTGTATCAAATGG + Intergenic
912590404 1:110813183-110813205 AACCAAATGCTTGAATCAACAGG + Intergenic
922111020 1:222555510-222555532 TACCCTCTGCTTCTATGAATTGG - Intergenic
1068333294 10:55600464-55600486 GACCCAATAATTCTATCAACAGG + Intronic
1075524697 10:123173969-123173991 AACTAGATGCTTATATCAACAGG - Intergenic
1081489275 11:43554843-43554865 AACCAAATTCTTCTATCATCCGG + Intergenic
1081629343 11:44678082-44678104 AAGCCAATGCTGCTACCAACAGG + Intergenic
1086681971 11:89682924-89682946 AACTCTATTCTTCTCTAAACTGG - Intergenic
1092823539 12:12375746-12375768 AATCATTTGCTTCTACCAACTGG + Intronic
1092978150 12:13766022-13766044 AATCCCATGCATCTATCCACTGG + Intronic
1098408107 12:70148715-70148737 CACCATCTGCTTCTATCAACTGG - Intergenic
1099029759 12:77511727-77511749 AATCCTATTCTTCTATCTAAAGG - Intergenic
1106374337 13:29170413-29170435 AACATTATGCTTCTAGTAACAGG + Intronic
1110317503 13:74127979-74128001 CACCTGAAGCTTCTATCAACTGG - Intronic
1111829050 13:93303538-93303560 AACCCAAGTCTTCTATCACCTGG - Intronic
1117994542 14:61466583-61466605 AAACCTTTGCTTCCATAAACTGG - Intronic
1126916540 15:53472692-53472714 AACACTGTATTTCTATCAACTGG - Intergenic
1127350549 15:58147710-58147732 AACCCTATGCTTCTATCAACAGG + Intronic
1129791261 15:78341863-78341885 AACCCCTTGCTTCAATCCACCGG - Intronic
1131857323 15:96611235-96611257 AATTCTATCCTTCTATCAATAGG - Intergenic
1148733651 17:49852333-49852355 AGCCCTCTGTTTCTTTCAACTGG - Intergenic
1149816240 17:59726876-59726898 AACTTTAAGCTTCTATGAACTGG + Intronic
1157689968 18:49673533-49673555 AAGCCGATGTTTCTACCAACTGG + Intergenic
925545424 2:5010683-5010705 AACCATATGCTTTTACCTACAGG + Intergenic
928031993 2:27787983-27788005 AACCTTATGATTATATCAACAGG + Intronic
928937890 2:36699293-36699315 AATCCTATGGTTCTATGCACTGG + Intronic
931514226 2:63033855-63033877 CATCATATGCTTCTATCAAGTGG + Intronic
931936207 2:67199800-67199822 AACCCTACTCTTCTATTAGCTGG + Intergenic
932503022 2:72201322-72201344 CACCCCATTCTTCTATCATCTGG - Intronic
937279401 2:120707073-120707095 AACCCTAAGTGTCTATCAGCAGG + Intergenic
939507203 2:143060239-143060261 CACCCTATTTTTCTATCAAATGG - Intergenic
939858289 2:147387465-147387487 AACACTGTTCTTTTATCAACAGG + Intergenic
941056269 2:160792481-160792503 CAACCTAAGTTTCTATCAACAGG + Intergenic
942679107 2:178457965-178457987 AACCCTATCTTTCTAACAATTGG - Intronic
943019467 2:182554811-182554833 AACCATATTTTTCTATGAACTGG - Intergenic
943617588 2:190111179-190111201 GATCCTATGCCTCTGTCAACTGG - Intronic
1170608065 20:17888571-17888593 GACCATCTGCTTCTATGAACTGG + Intergenic
1171149421 20:22814123-22814145 AACCCCATGATTTTATCAACTGG + Intergenic
1176898488 21:14412212-14412234 AAGCCTATGCATCTATTCACAGG - Intergenic
1182410888 22:30185071-30185093 AACCCACTGCTTCTATCTCCTGG - Intergenic
1183337291 22:37257160-37257182 AATCCTATCCTTCCTTCAACAGG - Intergenic
949358429 3:3206087-3206109 AAACGTATGCTTCTACCAAGTGG + Intergenic
950705306 3:14775862-14775884 TACACTATGCTTCCATCAGCAGG + Intergenic
951067649 3:18286040-18286062 TACCATATGCTTCTATGAATTGG - Intronic
954495527 3:50956293-50956315 ATACCTGTGCTTCTAACAACTGG - Intronic
954789675 3:53122867-53122889 AAGCCTAAACTTCTATCCACTGG + Intronic
955138106 3:56240140-56240162 AATCCTGTGCTTCTAACAAAGGG + Intronic
958958745 3:100489074-100489096 AACTCTCTGCTTCTTTCATCTGG + Intergenic
962515605 3:136147621-136147643 AACCCTCAGCTTTTATCAAGGGG - Exonic
964249481 3:154695121-154695143 AAGCCTATGGTTCTGTTAACAGG + Intergenic
965035941 3:163438177-163438199 AAACCTATGAGTCCATCAACAGG + Intergenic
965718589 3:171634951-171634973 CACCCTATTATTCTACCAACTGG + Intronic
968856567 4:3128625-3128647 AAACCTATGCCGCTATCAAATGG - Intronic
971021262 4:22538451-22538473 AACCCTATCCATCCATCACCTGG - Intergenic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
979952547 4:126911761-126911783 ACCCCTCTGCTTCTATCTTCTGG - Intergenic
979979572 4:127238025-127238047 GACCTTGTGTTTCTATCAACAGG - Intergenic
980480427 4:133380102-133380124 AACCCTGTGCCTCTATCACAAGG - Intergenic
984400008 4:179251226-179251248 ACCCCTATGCTTATATCCACTGG - Intergenic
984958344 4:185068832-185068854 AACCCTCTGCTTTTATCACCTGG + Intergenic
993175708 5:84482519-84482541 GTCCCTATGTTTCTTTCAACAGG - Intergenic
995174481 5:109159250-109159272 AACCCTACTCTTCTTTCAAGCGG + Intronic
1000278395 5:159760762-159760784 AGGTCAATGCTTCTATCAACTGG - Intergenic
1006619953 6:35356841-35356863 AACAATATGCTTCTATTACCAGG - Intronic
1007799148 6:44377013-44377035 AACTCCATGCCTCTATCCACAGG + Exonic
1013113406 6:107082068-107082090 GATTTTATGCTTCTATCAACAGG + Intronic
1014486542 6:122006008-122006030 AAGTTTATGCTTCTATAAACTGG + Intergenic
1015227692 6:130876507-130876529 AATCCTATGCTTCTATACACAGG + Intronic
1017329297 6:153177009-153177031 AACCCAATGCTTGTACCAATTGG + Intergenic
1019858724 7:3636401-3636423 CACACTCTGCTTCTATGAACTGG + Intronic
1019862693 7:3674943-3674965 GTCACTATGCTTCTATCCACAGG - Intronic
1023504070 7:40881770-40881792 AACACAGTTCTTCTATCAACAGG - Intergenic
1024793671 7:52996315-52996337 AACTCTATGATTCTCTTAACTGG - Intergenic
1027555343 7:79657596-79657618 GACACTAGGCTTCTATTAACAGG + Intergenic
1028323312 7:89490196-89490218 ACTCCTATGCTGCTGTCAACGGG + Intergenic
1028610304 7:92702928-92702950 ATCCCTAGGCTTCCATCCACTGG + Intronic
1031708188 7:125009578-125009600 CACCCTACTCTTCTATCAAATGG + Intergenic
1032486215 7:132289409-132289431 ATCCCTATGCTTTTAGCAAAAGG - Intronic
1034015302 7:147577335-147577357 AATCCTCTTCTTCTATCTACTGG - Intronic
1039823076 8:41150982-41151004 GACCCTATGGCTCTATCAAGTGG - Intergenic
1042101716 8:65281444-65281466 AACCCAATGCTTCTCTGAAAGGG - Intergenic
1046026719 8:108733243-108733265 AACCCAAGGTATCTATCAACAGG + Intronic
1055116979 9:72615639-72615661 AACCATATCCTTCAATCAAATGG + Intronic
1187148277 X:16657400-16657422 ATCCCTGTGCTTACATCAACCGG - Intronic
1191738519 X:64412759-64412781 AACCCCATGATTATCTCAACAGG - Intergenic
1193308418 X:79976273-79976295 AGCCCAATGCTTCTTTCAAAGGG + Intergenic
1196396323 X:115265932-115265954 AAACCTATTCTTCTATGAAGAGG - Intergenic
1197052045 X:122071519-122071541 CATCCTAAGCATCTATCAACAGG - Intergenic
1197308173 X:124869567-124869589 CAACCTAAGCGTCTATCAACTGG + Intronic
1200395847 X:155987229-155987251 AACCCTCAGCTTCTCCCAACAGG + Intergenic