ID: 1127356081

View in Genome Browser
Species Human (GRCh38)
Location 15:58201335-58201357
Sequence AGGGAAATAGCAGCCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127356077_1127356081 17 Left 1127356077 15:58201295-58201317 CCAGCTGTGGGAAGGAAGTGTGA 0: 1
1: 0
2: 0
3: 21
4: 249
Right 1127356081 15:58201335-58201357 AGGGAAATAGCAGCCTGTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 244
1127356076_1127356081 23 Left 1127356076 15:58201289-58201311 CCTTTTCCAGCTGTGGGAAGGAA 0: 1
1: 0
2: 3
3: 25
4: 308
Right 1127356081 15:58201335-58201357 AGGGAAATAGCAGCCTGTGAAGG 0: 1
1: 0
2: 1
3: 10
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127356081 Original CRISPR AGGGAAATAGCAGCCTGTGA AGG Intronic
900034223 1:393518-393540 AGGGAAACAGCAGGGTGAGATGG - Intergenic
900055058 1:623408-623430 AGGGAAACAGCAGGGTGAGATGG - Intergenic
900858702 1:5207633-5207655 AGGGGAACAGAAGCCTGTGCAGG + Intergenic
901456796 1:9367745-9367767 GGGGAAAGAGGAGCCTGTGTTGG - Exonic
901745639 1:11371477-11371499 AGGGCACCAGCTGCCTGTGAGGG + Intergenic
901963175 1:12843673-12843695 AGGGACAGTGCAGCCTATGATGG - Intergenic
902438276 1:16412078-16412100 AGGGGCAGAGCAGCCAGTGAGGG - Intronic
902641473 1:17768986-17769008 AGGGAAATAGCAGCATCAGTAGG - Intronic
902862602 1:19257031-19257053 AGAGAAAGAGCATTCTGTGAAGG - Intronic
904839322 1:33361665-33361687 AAGGAAATAACAGTCTCTGAGGG + Intronic
905016629 1:34782441-34782463 AGGTGAGTAGCAGCCTGGGAGGG + Intronic
906253914 1:44332800-44332822 CAGGAAACAGCAGCCTGTGGAGG + Intronic
906948493 1:50315763-50315785 AAGGTAAGAGCAGCCTGTGCAGG - Intergenic
910282665 1:85518555-85518577 AGAGAGATAGCAGCCTGAGAAGG - Intronic
910320795 1:85941365-85941387 AGGAAAATAGCAGCATGGTATGG + Intronic
912951782 1:114125281-114125303 AGGGCAATGCCAGCCTGTGCTGG + Intronic
913297503 1:117336231-117336253 AGGGAATTAGGAGCCTGTCCTGG - Intergenic
914207350 1:145544428-145544450 AGAGAGACAGCAGCCTGAGAAGG + Intergenic
916189275 1:162163276-162163298 AGGGATTGAGCAGCGTGTGATGG + Intronic
918084157 1:181231057-181231079 AGAGAGATAGCAGCATGAGAAGG - Intergenic
918780041 1:188687923-188687945 AGTGAAGTAGCAGCATGAGAGGG + Intergenic
920253886 1:204640904-204640926 AGGAAAACAGCAGCATTTGAGGG + Intronic
920445331 1:206012141-206012163 AGGGACACAGCTGCCTGTGGTGG - Intronic
920700679 1:208216099-208216121 AGAGAAAGAGCAGCAGGTGATGG - Intronic
921737005 1:218640389-218640411 AGGGAAATAGGAGCAAATGATGG - Intergenic
922256579 1:223897687-223897709 AGGGAAACAGCAGGGTGAGATGG - Intergenic
923881573 1:238109474-238109496 AGTGAAAAACCAACCTGTGAAGG + Intergenic
924337787 1:243000546-243000568 AGGGAAACAGCAGGGTGAGATGG - Intergenic
1064375136 10:14788679-14788701 AGGGAAATAGGAGCCTCTGAAGG - Intergenic
1064689352 10:17898619-17898641 AGGGACATAGTTGCCAGTGATGG + Intronic
1065141060 10:22718483-22718505 AGGCCAATAGCACCATGTGAGGG + Intergenic
1066101135 10:32119767-32119789 AGGGAGATAGTACCCTGTGGTGG - Intergenic
1067517670 10:46966881-46966903 GGGGAACAAGGAGCCTGTGAAGG - Intronic
1067644579 10:48084948-48084970 GGGGAACAAGGAGCCTGTGAAGG + Intergenic
1067770337 10:49117976-49117998 ATGGACAAAGAAGCCTGTGAAGG - Intergenic
1068167087 10:53344312-53344334 AGGGAAGTAGCAGGCTTTGCAGG + Intergenic
1068659310 10:59607088-59607110 AGGGAAACAGCAGACGATGAAGG + Intergenic
1070641690 10:78175094-78175116 AGGGACATGGCAGCCAGTGTGGG + Intergenic
1071363982 10:84880007-84880029 AGTGAAAAAGCAGACAGTGAAGG - Intergenic
1074051378 10:109883965-109883987 AGTGAAATATCAGGCAGTGATGG + Intronic
1075038024 10:119085575-119085597 AGGAATACAGCTGCCTGTGAGGG - Intergenic
1076948462 10:133666648-133666670 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076949451 10:133669958-133669980 AGGGAGAAACCAGCCTGGGAGGG - Intronic
1076950435 10:133673257-133673279 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076951420 10:133676556-133676578 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076952410 10:133679866-133679888 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076953398 10:133683176-133683198 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076955366 10:133742827-133742849 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076956356 10:133746137-133746159 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076957344 10:133749446-133749468 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076958333 10:133752756-133752778 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076959317 10:133756055-133756077 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076960306 10:133759365-133759387 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1077267178 11:1656858-1656880 AGGGAAATTGCAGCCTGGCCGGG + Intergenic
1077759164 11:5072117-5072139 AGGGGAATAGCAGCCACAGAAGG - Intergenic
1078923905 11:15857363-15857385 AGGTATATAGCAGCCGGGGAGGG + Intergenic
1079247827 11:18766018-18766040 AGGAAAATACCAGCCTGTTGAGG + Intronic
1080820231 11:35798784-35798806 GTGGAAAAAGCAGACTGTGAAGG + Intronic
1081025916 11:38015145-38015167 AGAGAGATGGCAGCCTGAGAAGG - Intergenic
1082069123 11:47924498-47924520 AGGTAAACAGCAGCATGTGGTGG - Intergenic
1082842495 11:57700599-57700621 ACGGAAATAGCATCCTCTGCTGG + Exonic
1083634293 11:64111833-64111855 AGGGTCAGAGCAGCCTGGGATGG + Intronic
1084142520 11:67242248-67242270 AGGCAAATAGCAGACTCTGTGGG + Intronic
1090146586 11:124329981-124330003 AGGTAAATAGCACCCTCTGATGG + Intergenic
1090406632 11:126479690-126479712 AGGGAGCAGGCAGCCTGTGAAGG - Intronic
1092617846 12:10231861-10231883 CTGGAAATAGCCGCTTGTGATGG + Intergenic
1092878661 12:12870761-12870783 GGGGAGATAGCAGCCTGGCAAGG + Intergenic
1093348205 12:18066764-18066786 ATGGAAATAGGAGCCTAGGAGGG - Intergenic
1094337870 12:29381019-29381041 AGGGAACTGGGAGCCTGTCATGG - Intronic
1096485758 12:51979864-51979886 AGGGCAAGAGCAGGCTGAGATGG + Intronic
1099256614 12:80322281-80322303 GGGGAAATAGAGGCCTGTAAAGG - Intronic
1099989310 12:89707594-89707616 AGGTAAATATCAGCCTGTCGAGG + Intronic
1103975732 12:124701402-124701424 ATGGAATTAGCAGGCAGTGAGGG + Intergenic
1104724852 12:131069593-131069615 AGGCTTCTAGCAGCCTGTGAGGG + Intronic
1104802458 12:131563891-131563913 AGGCTTCTAGCAGCCTGTGAGGG - Intergenic
1104803905 12:131572703-131572725 TGTGACATAGCATCCTGTGAAGG - Intergenic
1106458142 13:29945381-29945403 ACGAAAACAGCAGCCTGTCAGGG + Intergenic
1108706558 13:52993855-52993877 AAGGAAATAGCAGCCCAAGAGGG + Intergenic
1110194463 13:72770975-72770997 ATGAAAATGCCAGCCTGTGAAGG + Exonic
1110627508 13:77668214-77668236 ATGGACAGAGCAGCATGTGAAGG + Intergenic
1111956851 13:94768615-94768637 ATGGAAAAAGGAGACTGTGAAGG + Intergenic
1115332436 14:32212797-32212819 ATGGATAGAGCAGCCAGTGAGGG - Intergenic
1118040199 14:61908111-61908133 AGGTAAACAGCAGCCTTTAAAGG - Intergenic
1121337073 14:93083960-93083982 AGGGAAATTGCCGGCTTTGATGG - Intronic
1121883057 14:97517582-97517604 TGTGAGATAGCAGCCTTTGATGG - Intergenic
1124095481 15:26644848-26644870 AGGGACACATCAGCATGTGATGG + Intronic
1126467616 15:48975335-48975357 AGGGGAAAAGCAGCCTGAGGTGG - Intergenic
1127356081 15:58201335-58201357 AGGGAAATAGCAGCCTGTGAAGG + Intronic
1128517751 15:68353797-68353819 AGAGAAATAGGAACCTGTGCAGG - Intronic
1128878368 15:71220916-71220938 AGGGCAATGGCAGCCTGGGGAGG + Intronic
1129794397 15:78364993-78365015 TGGGAAATAATAGCCTGTAAGGG - Intergenic
1130006450 15:80103715-80103737 AGGGAGAAAGCAGACTGAGAAGG - Intronic
1130549553 15:84881295-84881317 AGGGGAAGAGCAGTGTGTGAGGG - Intergenic
1130554910 15:84915801-84915823 GGGGAAGGAGGAGCCTGTGAAGG - Intronic
1130917986 15:88321024-88321046 TGGGCAAAGGCAGCCTGTGATGG - Intergenic
1135224948 16:20647613-20647635 AAGGCAATTGCAGGCTGTGAAGG - Intronic
1135259617 16:20969746-20969768 CAGGAAAGAGCAGCCTGTGCAGG + Intronic
1137449223 16:48555269-48555291 AGGGAAAGAGCAGCCTGCCTGGG + Intronic
1141410443 16:83829416-83829438 AGGCCAACAGCAGCCTGGGAAGG + Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143890188 17:10096914-10096936 AAGGAAATTGCAGCCTCGGATGG - Intronic
1145245827 17:21268732-21268754 AGGGAAATAGCAGCAAGGCAGGG - Intergenic
1148602963 17:48908267-48908289 TGGGAACTAGCAGGCCGTGATGG - Intergenic
1151403177 17:73869470-73869492 AGGGGAATTGCAGCATGAGATGG - Intergenic
1155162996 18:23210676-23210698 AGGCAAGTAGCAGCAAGTGATGG - Intronic
1156189644 18:34703458-34703480 AGTGGAAGAGAAGCCTGTGAGGG - Intronic
1158249852 18:55475655-55475677 AAGGAAATAGGAAGCTGTGATGG - Intronic
1159754746 18:72350651-72350673 AAGGAAATGGCAGCATGAGATGG - Intergenic
1160374426 18:78400588-78400610 GGAGAAACAGCATCCTGTGAGGG + Intergenic
1160451466 18:78969351-78969373 GGAGAAATAGCAGCCTTTGATGG - Intergenic
1161637245 19:5396635-5396657 AGGGAAAGAGCAGCAAGAGAAGG + Intergenic
1165457989 19:35925980-35926002 CTGGAAATAGCAGCCTAGGATGG - Intergenic
925178327 2:1800313-1800335 AGGGAAATTCCAACCTGTGTTGG + Intronic
930016385 2:46973660-46973682 AGGGACTCAGCTGCCTGTGAAGG - Intronic
930642187 2:53864842-53864864 AGGGAAAAAACAGCCAGTCAGGG + Exonic
930826422 2:55700650-55700672 AGGGAAGAAGCATCCAGTGAGGG + Intergenic
931067231 2:58600349-58600371 AGGGAATTTGCAGTCTGTGATGG + Intergenic
933726747 2:85431309-85431331 TGGGAAATGGCAGCCTGGGATGG - Intronic
934765136 2:96876317-96876339 AGGAGAAAAGCAGGCTGTGAGGG + Intronic
934900796 2:98158509-98158531 AAAGAACTAGAAGCCTGTGATGG - Intronic
935008249 2:99103519-99103541 AGAGAAATAGGAGCACGTGATGG - Intronic
937969475 2:127538108-127538130 AGGGATGCAGCAGGCTGTGAGGG + Intronic
938122521 2:128644059-128644081 AGGGAAATTACACCCTGTAATGG + Intergenic
938932741 2:136100915-136100937 AAGGAAACATCAGTCTGTGATGG + Intergenic
938954619 2:136286346-136286368 AGGGAAATAGCAGAAGATGAGGG - Intergenic
940221566 2:151357632-151357654 AGTGAAGTAACAGCCTGTTAGGG - Exonic
945811220 2:214552631-214552653 AGAGAAATAGAACCCTGGGAAGG - Intronic
945839311 2:214868962-214868984 AGGGAAACAGCATCATGTAAAGG - Intergenic
945973423 2:216252394-216252416 AGAGGGATAGCAGCCTGTGTTGG + Intergenic
946413980 2:219530166-219530188 AGGGAAGGTGCTGCCTGTGATGG + Intronic
948654474 2:239468355-239468377 AGGGGAGAAGCAGCCTGAGATGG + Intergenic
948800052 2:240429416-240429438 AGAGTGATTGCAGCCTGTGAGGG - Intergenic
1169464204 20:5823198-5823220 TGAGAAACAGCAGCCAGTGAGGG - Intronic
1170795679 20:19544937-19544959 AGGGAAATAGAAGCGTGGAAAGG + Intronic
1172996961 20:39078040-39078062 ATGCAAATAGAAGCCTTTGAAGG - Intergenic
1173615467 20:44400566-44400588 AGGGAAACAGGAGAATGTGATGG + Intronic
1173647299 20:44641440-44641462 AAGGAACTAGCAGCCTTGGAGGG + Intronic
1173858058 20:46263711-46263733 AGGGGAAGAGCAGAGTGTGAGGG + Intronic
1173914696 20:46698305-46698327 GGGGAGATGGCAGCCTGAGAAGG - Intergenic
1174647592 20:52099198-52099220 ACAGAAATATCAGCCTGGGATGG - Intronic
1175709214 20:61206035-61206057 AGGAAAACAGCACCCTCTGAAGG + Intergenic
1175892593 20:62322155-62322177 AGGGCACTGGCAGCCTGTGGTGG + Exonic
1179084349 21:38203946-38203968 ATGGACAGAGCAGCCTGTGGAGG - Intronic
1181859651 22:25808431-25808453 AGTCAAACAGCAGCATGTGATGG + Intronic
1182031206 22:27160819-27160841 AGAGACATAGCAACATGTGAAGG + Intergenic
1182795709 22:32990180-32990202 AGGGAAAGTGGAGCCTGTCAAGG + Intronic
1183018840 22:35011113-35011135 GGAGAAATAGCAGCTTGTGGAGG - Intergenic
1183027593 22:35077364-35077386 AGGAAAAGAGGAGGCTGTGAGGG - Intronic
1184165035 22:42721883-42721905 GGAGAAGTAACAGCCTGTGATGG - Intergenic
1184408328 22:44312730-44312752 AGGTAAGGAGCAGCCTGTGGAGG - Exonic
950168376 3:10818278-10818300 AGGTAAATAACAGCATGTTAGGG + Intronic
953820949 3:46206933-46206955 AGAGATAGAGCAGTCTGTGATGG + Intronic
957586982 3:82145686-82145708 AAGGAAATGGCAGACTGCGATGG + Intergenic
959681928 3:109105986-109106008 GAGGAAATATCAGCCTTTGAGGG - Intronic
961742148 3:129039685-129039707 AGGGAAACAGCAGGCAGGGAGGG - Intronic
964087741 3:152836885-152836907 ATGGAGATACAAGCCTGTGAAGG + Exonic
967250263 3:187530104-187530126 AAGGCAAAAGAAGCCTGTGATGG + Intergenic
967795225 3:193592425-193592447 AGGGAAAAAGGAGAATGTGATGG + Intronic
967920305 3:194609409-194609431 GGGGAAAGAAGAGCCTGTGAGGG + Intronic
968938260 4:3624715-3624737 AGGGGAGGAGCAGCCTGGGATGG + Intergenic
970481918 4:16484803-16484825 AAGGAAAAAGCTGCCAGTGATGG - Intergenic
970861121 4:20703694-20703716 AGGGAAATAAAAGCCTGTCAAGG - Intronic
970995935 4:22268155-22268177 ACGGACAGAGCAGCATGTGAAGG + Intergenic
971210273 4:24609676-24609698 GGGGAAATAGCACCATGTAAAGG - Intergenic
975115731 4:70678605-70678627 AGGGAAATAGCTCTGTGTGATGG - Intronic
975549089 4:75591847-75591869 AGGTCAATAGCAGCCAGAGAAGG + Intronic
975558565 4:75688377-75688399 AGGGAAGTAGTATCCAGTGAAGG + Intronic
977275032 4:94966962-94966984 GGGGAAATATTAGCCTGTAATGG + Intronic
977849630 4:101810068-101810090 AGAGAAATGGCAGCATGAGAAGG + Intronic
979239354 4:118434770-118434792 AGGGAAACAGCAGGGTGAGATGG + Intergenic
981879138 4:149588349-149588371 AGGGAAATAAAATCCAGTGAAGG + Intergenic
984547276 4:181121489-181121511 AGGCAAATAGCAGGCTGTCATGG - Intergenic
985451916 4:190067453-190067475 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985452905 4:190070744-190070766 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985453892 4:190074037-190074059 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985454880 4:190077330-190077352 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985455868 4:190080627-190080649 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985456851 4:190083921-190083943 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985457839 4:190087217-190087239 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985458827 4:190090514-190090536 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985463079 4:190173277-190173299 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
986095803 5:4553171-4553193 AGTGAAAAAGCAGCCTCTCATGG - Intergenic
986410770 5:7476389-7476411 AGGAAAACAGCGTCCTGTGAGGG + Intronic
986501647 5:8407261-8407283 AGAGAAACAGCAACATGTGAGGG + Intergenic
990115746 5:52388316-52388338 AGGGAAATACCTGGCTGAGATGG - Intergenic
991923735 5:71683603-71683625 AGGGACAGAGCAGCATGTGGAGG + Intergenic
992169654 5:74089154-74089176 AGGGAAATAGAAACCTGAGTGGG - Intergenic
992369336 5:76126778-76126800 GTGGAAATGGGAGCCTGTGATGG - Intronic
993501040 5:88667260-88667282 ATGCAAATAGAGGCCTGTGAAGG - Intergenic
993742883 5:91562306-91562328 ATGGACAGAGCAGCCTGTGGAGG + Intergenic
995135561 5:108676045-108676067 AGGGGAATGGCAGGCTCTGAGGG + Intergenic
996226217 5:121000301-121000323 AAGGAAATAGCAGCTTTAGAAGG + Intergenic
996559182 5:124810275-124810297 AGGGAAATAGCTGGCTATAAAGG - Intergenic
997604177 5:135162240-135162262 AGAGAAATGGCAGCCTGTAGAGG - Intronic
999222146 5:149989184-149989206 AGGGAAATAGCCACATGTGCAGG + Intronic
999990073 5:157041689-157041711 AGGGAAACAGCATGCTTTGATGG - Intronic
1000550480 5:162656535-162656557 ATGGAACTTGCAGCCTGGGAGGG - Intergenic
1002445574 5:179288103-179288125 GGGGAGATGACAGCCTGTGATGG - Intronic
1002739597 5:181425350-181425372 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1005118380 6:22363652-22363674 CTGGCAATAGCAGCCTGAGAAGG + Intergenic
1006470498 6:34226119-34226141 AGTGAAACAGAAGCCTGAGAAGG - Intergenic
1006987039 6:38182725-38182747 ATGGAGACAGCAGCTTGTGAGGG - Intronic
1007427879 6:41759074-41759096 AGAGAAATGGAAGCCAGTGACGG + Intergenic
1007739077 6:44000276-44000298 AGGGCACTAGCAGCCTGGGTGGG - Intergenic
1014758355 6:125326980-125327002 AAGGCAAGAGCAGCCTGAGAAGG - Intergenic
1014795688 6:125721636-125721658 CGGGAAACAGCAGGCTGGGATGG + Intergenic
1015120191 6:129692562-129692584 AGGGAAAAGGCAGCATGGGATGG + Intronic
1015272663 6:131353369-131353391 AGGGGAATAGGAGGCTCTGAAGG + Intergenic
1016533771 6:145088782-145088804 AGGGCAGCAGCAGCATGTGATGG + Intergenic
1017207353 6:151817806-151817828 AGGGAAAAAGAACCCTATGAAGG - Intronic
1017621654 6:156305480-156305502 AAGCAAAAAGCAGCCTCTGATGG - Intergenic
1017679197 6:156846602-156846624 GGGGAGATAGCAGCATGTTAGGG - Intronic
1019244713 6:170700937-170700959 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1019826850 7:3291701-3291723 AGGGAATTGGGAGCCTTTGAGGG - Intergenic
1022103080 7:27180669-27180691 AGGGAAAAAGCAGCCTCAGCTGG + Intergenic
1022355896 7:29614278-29614300 AGGGAGATAGGAGCCAGTGAAGG - Intergenic
1022448078 7:30486176-30486198 AGAGAGATGGCAGCCTGAGAAGG + Intergenic
1022544553 7:31173958-31173980 AGGGAATGAGCAGCTTGTGGAGG + Intergenic
1032015137 7:128374923-128374945 AGGGAAATAGCAGCCAGGTGCGG + Intergenic
1032680581 7:134178706-134178728 AGGGAAAAAGCAGCCTTTATAGG - Intronic
1033210907 7:139459626-139459648 AGGGCACCAGTAGCCTGTGAGGG - Intronic
1033330731 7:140414912-140414934 AGGGAAATGGGGGCCTCTGAGGG - Intronic
1034027310 7:147720315-147720337 AAGCAAATAGCAGACTCTGAAGG + Intronic
1034087735 7:148335339-148335361 AGGGATTGAGCAGACTGTGATGG + Intronic
1034416910 7:150970168-150970190 AGGGAAATACCAACATGTGAAGG + Intronic
1035209388 7:157316639-157316661 ATGGAGAGAGCAGACTGTGAGGG - Intergenic
1035503413 8:107251-107273 AGGGAAACAGCAGGGTGAGATGG - Intergenic
1037784341 8:21893546-21893568 AGGGCACTTGCAGCCTCTGAGGG + Intergenic
1040496431 8:47969567-47969589 AGGGAAATAGCAGCAGGAAACGG - Intronic
1040622693 8:49107350-49107372 TGGGAAATGGGAGCCTGAGAAGG - Intergenic
1041451688 8:58012964-58012986 AGGGAGACACCAGCCTGGGATGG - Intronic
1046389922 8:113557235-113557257 AGAGAAATTGAAGCCTTTGATGG + Intergenic
1049176820 8:141197821-141197843 AGGGCAAAAGCAGCTTCTGAGGG - Intergenic
1050059220 9:1687756-1687778 AGGGAAATACCAGGCAGAGAAGG - Intergenic
1051107588 9:13597570-13597592 AAGGAAATAGCTGCCTTGGAGGG + Intergenic
1051583033 9:18697414-18697436 ATGGAATTAGGAGCCTTTGATGG - Intronic
1052198077 9:25742608-25742630 AAGGTTATAGCACCCTGTGAAGG + Intergenic
1054452939 9:65413044-65413066 AGGGGAGGAGCAGCCTGGGATGG - Intergenic
1057166083 9:92926764-92926786 AGAGAAATAGTAGGCTATGAAGG - Intergenic
1058087063 9:100759379-100759401 ATGAGAAAAGCAGCCTGTGATGG + Intergenic
1059974486 9:119701045-119701067 AGGGAAACAGCAAGCTGTGGTGG + Intergenic
1060550338 9:124482000-124482022 AGATAAATACCAGCCTGGGAGGG + Exonic
1061139302 9:128754628-128754650 AGGAAACTAGAAGCCTGTGTGGG - Intronic
1203604903 Un_KI270748v1:50157-50179 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1188325914 X:28800549-28800571 AGAGAAAGAGCAGCCAGTCAGGG + Intronic
1191901220 X:66042464-66042486 AAGGAAATAGTAGCGTGGGAAGG + Intergenic
1194555249 X:95350375-95350397 ATGGATAAAGCAGCATGTGAGGG + Intergenic
1195630404 X:107050071-107050093 AATGAAAGAGCAGCCAGTGAGGG + Intergenic
1197100049 X:122642121-122642143 AGTGAAATAGCAGAGTGTGGTGG - Intergenic
1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG + Intronic
1198023385 X:132681043-132681065 AGGGAAAAAGCAACATGTAATGG - Intronic
1198118651 X:133569313-133569335 AGGGACATAGCAGCTTCTAAAGG - Intronic
1198509334 X:137333727-137333749 AGGAAAATAACAGGCTCTGAGGG + Intergenic
1199250375 X:145654972-145654994 AGAGAAATAGAGGACTGTGAAGG + Intergenic
1199963829 X:152801466-152801488 AGGGAAAAAGAACCCTGTGAGGG - Intergenic
1200215046 X:154364505-154364527 GGGTAAAGAGCAGGCTGTGATGG - Exonic