ID: 1127358392

View in Genome Browser
Species Human (GRCh38)
Location 15:58223743-58223765
Sequence TAGGCAGACCTGAGTATGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127358392_1127358398 -1 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358398 15:58223765-58223787 ATGCAGTTTATACAGAGGAAGGG 0: 1
1: 0
2: 0
3: 23
4: 227
1127358392_1127358399 7 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358399 15:58223773-58223795 TATACAGAGGAAGGGTCTTTTGG 0: 1
1: 0
2: 1
3: 30
4: 350
1127358392_1127358400 8 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358400 15:58223774-58223796 ATACAGAGGAAGGGTCTTTTGGG 0: 1
1: 0
2: 1
3: 11
4: 232
1127358392_1127358402 30 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358402 15:58223796-58223818 GAACCCTGCCCAGGTTCTTCTGG 0: 1
1: 0
2: 0
3: 21
4: 155
1127358392_1127358397 -2 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358397 15:58223764-58223786 TATGCAGTTTATACAGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 184
1127358392_1127358401 21 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358401 15:58223787-58223809 GTCTTTTGGGAACCCTGCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1127358392_1127358395 -6 Left 1127358392 15:58223743-58223765 CCCCTCATACTCAGGTCTGCCTA 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1127358395 15:58223760-58223782 TGCCTATGCAGTTTATACAGAGG 0: 1
1: 0
2: 0
3: 9
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127358392 Original CRISPR TAGGCAGACCTGAGTATGAG GGG (reversed) Intronic
900377447 1:2362376-2362398 GAGGAAAACCTGTGTATGAGTGG + Intronic
907408035 1:54265703-54265725 TATGCAGAGATGAGTATGAAGGG - Intronic
909436824 1:75651803-75651825 TAGGCAGACCTGAGCAGGGCAGG + Intergenic
909873324 1:80772578-80772600 CAGACAGACCTGAGTTTGGGCGG + Intergenic
910365477 1:86460471-86460493 TAGGCAGACATGAGTAGGACTGG - Intergenic
910743263 1:90545219-90545241 AAGGCAGTTCTGAATATGAGAGG - Intergenic
911581957 1:99644501-99644523 TAGGGAGACCAGAGAATGGGAGG - Intergenic
915554460 1:156653676-156653698 TAGACAGGCCTGAGAAGGAGAGG - Intronic
916738335 1:167627987-167628009 TAGGCAGCCATGAGTAGGTGTGG - Intergenic
916968957 1:169987940-169987962 TAGGCATACTTGAGGATAAGCGG - Intronic
917510866 1:175668297-175668319 TTGGTAGACCTCAGTTTGAGTGG + Intronic
919813733 1:201424940-201424962 AAGGCAGCCCTGAGGAAGAGTGG + Intronic
920491566 1:206419614-206419636 TAAGCAGAACTGAGTAAAAGGGG + Intronic
920736363 1:208536504-208536526 TGGGCAGAACTGAATGTGAGAGG + Intergenic
1063926230 10:10980405-10980427 GAGGCACACCTGAGTCTAAGAGG - Intergenic
1065174821 10:23065868-23065890 TAGAGAGAGCTGGGTATGAGGGG - Intergenic
1065216569 10:23454975-23454997 TAGGCAGACATGAGCAGGACAGG + Intergenic
1065414366 10:25468288-25468310 TAGCCAGACATGAGCAGGAGTGG - Intronic
1067815107 10:49468296-49468318 AAGGCAGAGCTGAGCATCAGGGG - Intronic
1069070333 10:63985490-63985512 TAGGCAGACATGAGCATGGCAGG + Intergenic
1073193073 10:101666054-101666076 TAGCCAGACCTGGGTATCCGTGG - Intronic
1074523307 10:114244052-114244074 GAGGCATACCTGAGAATGGGTGG + Intronic
1080778160 11:35405549-35405571 TAGACAGACATGATTCTGAGAGG + Intronic
1082070829 11:47938266-47938288 AAGGAAGACCTGAGTAGGAAGGG - Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1089149894 11:116356513-116356535 TGGGCAGACCTGATTGAGAGAGG - Intergenic
1090499529 11:127247871-127247893 TAGCCTGTCCTGAGTATGTGGGG - Intergenic
1090499565 11:127248181-127248203 TAGCCTGTCCTGAGTATGTGGGG - Intergenic
1091641652 12:2241668-2241690 TAGGCAGAGCTGACTGTGACAGG - Intronic
1092160873 12:6314851-6314873 CAAGCAGCACTGAGTATGAGTGG - Intronic
1097008923 12:55938790-55938812 CAGACATACCTGAGAATGAGAGG + Intronic
1097915652 12:65018116-65018138 TGGGCAGCCCTCAGGATGAGAGG + Intergenic
1098088747 12:66878398-66878420 TAAGCAGAAATGAGTGTGAGAGG + Intergenic
1100364039 12:93902891-93902913 TAGGCAGACATGAGCATGGCAGG - Intergenic
1101615205 12:106329482-106329504 TAGTCAGACTTGAGAATGACCGG - Intronic
1103277250 12:119722834-119722856 AAGGCAGACGGGAGGATGAGAGG - Intronic
1105218608 13:18305304-18305326 TAGGCAGACCTGAGAACCAATGG - Intergenic
1106298577 13:28440895-28440917 TAGGCAGACATGAGTGGGACAGG + Intronic
1106966061 13:35070020-35070042 CAGGCAGAGCTGAGCATCAGTGG - Exonic
1108934848 13:55871191-55871213 TAGGTAGCCCTCAGTGTGAGAGG + Intergenic
1108960306 13:56218615-56218637 TGGGCAGACCTTAGTAAGTGTGG - Intergenic
1110080431 13:71303449-71303471 TAGGCACATTTGAGGATGAGAGG + Intergenic
1110232724 13:73183432-73183454 AAGGGAGACCTGGATATGAGTGG - Intergenic
1112923360 13:104642774-104642796 AAGGCAGGCCTGATTAGGAGTGG - Intergenic
1114074796 14:19154247-19154269 CAGGCAGAGTTGAGTATCAGTGG - Intergenic
1114087471 14:19245728-19245750 CAGGCAGAGTTGAGTATCAGTGG + Intergenic
1116106288 14:40512234-40512256 TAGGCACAACTGAGTATTACAGG + Intergenic
1116950774 14:50876655-50876677 CAGACAGACCTGGGTATGTGTGG + Intronic
1118865821 14:69702801-69702823 TAGGCAGTCCTGTATATCAGTGG + Intronic
1121368353 14:93334772-93334794 CAGGCAGACTTGAGTATGCTTGG + Intronic
1124365747 15:29070370-29070392 TAGGCAGGCCTGTGAATGGGAGG - Intronic
1125115448 15:36086199-36086221 TAGGCAGACCTGAGCAGGGCAGG + Intergenic
1127358392 15:58223743-58223765 TAGGCAGACCTGAGTATGAGGGG - Intronic
1128807767 15:70545531-70545553 TAGGTAGACCTGAGGGTGATAGG + Intergenic
1128854012 15:70991644-70991666 TAGTCAGCCCTCAGTATCAGTGG - Intronic
1129165490 15:73774945-73774967 AAGGCAGACCTGCCTATCAGAGG - Intergenic
1131661699 15:94524164-94524186 TAGGCAGACGTGAGTAGGGCAGG - Intergenic
1132857218 16:2051671-2051693 TTAGCAGATCTGAGCATGAGAGG - Intronic
1133055887 16:3145314-3145336 TGGGCAGCCCTGGGGATGAGGGG + Intronic
1138126839 16:54446274-54446296 CAGACAGACCTGAGAGTGAGTGG - Intergenic
1138932005 16:61670372-61670394 TAGGCATAAATGAATATGAGAGG + Intronic
1140665349 16:77222399-77222421 TTGGAAGACCTGAGAAAGAGAGG + Intergenic
1144356442 17:14451304-14451326 TAGGAAGACATTAGCATGAGGGG + Intergenic
1148623122 17:49049509-49049531 CCGGCAGGCCTGAGAATGAGTGG + Exonic
1155643768 18:28052705-28052727 TAGGCACACCTGAGAATGTCTGG - Intronic
1156684066 18:39623087-39623109 TAGGCAGACATGAGCATGGCAGG + Intergenic
1158515765 18:58128973-58128995 CAGGCAGACCTCATTAGGAGGGG + Intronic
1159652860 18:70998414-70998436 TAAGCACACATGAATATGAGTGG - Intergenic
1160057130 18:75493538-75493560 CAGGCAGCCCTGAGTAACAGAGG + Intergenic
1164430760 19:28186745-28186767 TAGGCAGACCTGTGGCAGAGAGG - Intergenic
926084507 2:10012196-10012218 TGGGCAGGCGTGCGTATGAGCGG + Intergenic
926084729 2:10013271-10013293 TGGGCAGACATGCGTATGGGCGG + Intergenic
926085278 2:10016026-10016048 TGGGCAGACGTGCGTATGGGTGG + Intergenic
926781119 2:16472739-16472761 TCTGCAGACCTGAGAATCAGGGG - Intergenic
928994567 2:37273429-37273451 TAGGCAGATCTCAGTGGGAGGGG - Intronic
933823251 2:86134407-86134429 TAAGAAGACCTCAGTATGGGAGG - Intronic
933993435 2:87650179-87650201 TTGACAGAACTGAGTTTGAGAGG + Intergenic
934295702 2:91741323-91741345 TAGGCAGACCTGAGAACCAATGG + Intergenic
935394082 2:102587007-102587029 AAGGCTGTCCTTAGTATGAGAGG - Intergenic
937839614 2:126512186-126512208 AAGGCAGAGCAGAGTCTGAGAGG + Intergenic
940566287 2:155364857-155364879 TAGGCAGACATGAGCAGGACCGG - Intergenic
942058310 2:172205604-172205626 TGGTCAGACCTGAGGCTGAGAGG + Intergenic
943161460 2:184258188-184258210 TAGGCAAACCTCAATATGTGAGG - Intergenic
944476591 2:200112745-200112767 TAGGCAGACATGAGTAGGGCAGG + Intergenic
944930711 2:204516406-204516428 GAAGCACACTTGAGTATGAGAGG + Intergenic
946989156 2:225308509-225308531 TAGGCAAAGATGTGTATGAGTGG - Intergenic
947145325 2:227059058-227059080 TAGGCAGGCCTGATTGTGAGAGG - Intronic
1168962566 20:1879284-1879306 TAGGCAGATGTGAGGATGAAAGG - Intergenic
1169627584 20:7589646-7589668 TCAGCAGACTTGAGTATTAGGGG + Intergenic
1169662772 20:7998604-7998626 TAGGATGAGCTGAGTAAGAGGGG - Intronic
1174493480 20:50921329-50921351 TATGCAAACCTGAGTATGAATGG - Intronic
1175459220 20:59138592-59138614 TAGGGAGACCTAACTTTGAGGGG - Intergenic
1180290446 22:10847181-10847203 CAGGCAGAGTTGAGTATCAGTGG - Intergenic
1180493245 22:15876602-15876624 CAGGCAGAGTTGAGTATCAGTGG - Intergenic
1181496325 22:23289225-23289247 AAGGCAGGTCTGAGAATGAGTGG - Intronic
1181767177 22:25100272-25100294 TCGTCAGAACTGAGTATGGGAGG + Intronic
1184433958 22:44458789-44458811 TAGGAAGACGTGAGCATGTGGGG - Intergenic
949282414 3:2361966-2361988 TAGAAAGACCTGAGTTGGAGGGG + Intronic
951710438 3:25581087-25581109 TAAACAGACCTGAGGAAGAGTGG - Intronic
953414351 3:42707146-42707168 GAGGGTGATCTGAGTATGAGGGG - Intronic
953914281 3:46908707-46908729 GAGGCAAACCTGAGTGTGTGCGG + Intergenic
957198696 3:77103826-77103848 TAGACTGACTTTAGTATGAGAGG + Intronic
961551908 3:127674238-127674260 CAGGCAGACCAGAGCAGGAGAGG - Intronic
962425256 3:135263750-135263772 TCTGCAGACCTGATTAAGAGTGG + Intergenic
962929302 3:140022476-140022498 TAGGGAGAGCTGCGTGTGAGAGG + Intronic
964111422 3:153091617-153091639 TAGGCAGTGCTGATTATGTGAGG - Intergenic
965561801 3:170069097-170069119 TAGGCAGAGTTGAGGATTAGAGG - Intronic
966965399 3:184986844-184986866 TAGGCAAAACTGAGTGTGGGAGG - Intronic
972411706 4:38801819-38801841 TAGGCAGACATGAGCAGGACAGG + Intronic
976687595 4:87832174-87832196 AAGGCAGACCCCAGTATGAATGG - Intronic
977984219 4:103362370-103362392 TAGCCAGACATGAGCAGGAGGGG - Intergenic
982939487 4:161531773-161531795 TAGGCAGATATGAGTATGTAGGG - Intronic
984902759 4:184599710-184599732 TAGGCCGAACTGACTTTGAGAGG + Intergenic
992861557 5:80916153-80916175 TAGGCAGTCCTGTGGGTGAGTGG - Intergenic
993137253 5:83984807-83984829 TAGGCAGAGCTGAGTGTGAATGG - Intronic
995294499 5:110503643-110503665 TAGGCAAACCTGAGTAGAGGAGG - Intronic
996857550 5:128026736-128026758 GAGTCAGACCAAAGTATGAGAGG - Intergenic
1001342434 5:170860169-170860191 TAGGCAGACAAGAGTACTAGTGG - Intergenic
1001914367 5:175547252-175547274 CAGGCAGACATGAGCAGGAGAGG - Intergenic
1002702781 5:181137837-181137859 TAGGGAGACCTGAGTGTGAGAGG + Intergenic
1003568370 6:7239559-7239581 TAGGCAGACCAAAGCAGGAGGGG + Intronic
1005158245 6:22833319-22833341 TAGGCAGACATGAGCAGGGGAGG + Intergenic
1006173028 6:32106305-32106327 ATGGCAAACCTGAGTGTGAGGGG + Intronic
1006300845 6:33192853-33192875 TATGGAGACCTGATTATGGGTGG - Intergenic
1012908271 6:105092045-105092067 CAGGCAGGCCTCAGTCTGAGGGG + Intergenic
1014137439 6:117906693-117906715 TAGGCAGATTTGAGTTTCAGTGG - Intergenic
1017480727 6:154851804-154851826 CAGGCAGACCTGAGTATCAATGG - Intronic
1017609708 6:156172263-156172285 TAGCTAGACATGAGTAGGAGTGG - Intergenic
1020975586 7:15002221-15002243 TAGGCAAACCTGAAAATGAAAGG + Intergenic
1026493718 7:70884994-70885016 AAGGCAGAGCTGAGGAAGAGAGG + Intergenic
1032087913 7:128893355-128893377 GAGGCAGATCTGGGTGTGAGCGG + Intronic
1034916380 7:155043329-155043351 TAGGCTGAGCTAACTATGAGAGG + Intergenic
1037396665 8:18450867-18450889 TAGGAAGACTTGAGTTTGAAGGG + Intergenic
1040859970 8:51989041-51989063 TAAGCAGGAATGAGTATGAGAGG + Intergenic
1041693081 8:60708714-60708736 CAGGCAAAGCTGAGTTTGAGTGG - Intronic
1042686473 8:71446736-71446758 TAGGCAGATCTGAGTTGCAGAGG - Intronic
1046217218 8:111164183-111164205 TAGGCAGACATGAGTGGGACAGG - Intergenic
1048321391 8:133403352-133403374 AAGGCAGAACAGAGTGTGAGAGG + Intergenic
1049822584 8:144645165-144645187 TCTGCAGCTCTGAGTATGAGAGG - Intergenic
1051889965 9:21931337-21931359 TAGGCAGACATGAGTAAGGGAGG + Intronic
1052400504 9:27994438-27994460 TAGGTAGACATGAGCAGGAGAGG + Intronic
1053465240 9:38302205-38302227 TAGGCAGACTAGGGTAGGAGAGG + Intergenic
1053536312 9:38929959-38929981 TTGACAGACCTGAGGATGAGTGG + Intergenic
1054629822 9:67433989-67434011 TTGACAGACCTGAGGATGAGTGG - Intergenic
1058479509 9:105376927-105376949 CAGACAGACCTGAGTTTGAACGG - Intronic
1059290515 9:113220096-113220118 AAGGCAGAACTGAGTATTTGTGG + Intronic
1059799781 9:117738533-117738555 TATGCAGAACTGAGTGGGAGAGG - Intergenic
1060430691 9:123549112-123549134 TAGACAGACCTGGGTGTGATGGG + Intronic
1061274119 9:129559608-129559630 TAGGCAGGCCTCTGCATGAGCGG + Intergenic
1186166650 X:6833548-6833570 TAGGTAGACGTGAGGCTGAGTGG + Intergenic
1188522717 X:31056798-31056820 TAGGCAGAACTGAGAAAGAGAGG + Intergenic
1191853364 X:65602600-65602622 CAGGCAGACCTGGGTTTGAGTGG + Intronic
1194010703 X:88557792-88557814 TAGGTAGACATGAGCATGAAAGG + Intergenic
1196535992 X:116845145-116845167 TAGTCAGACCAGAGTAAGATGGG + Intergenic
1198574228 X:137992507-137992529 TAGGCAGCTGTGAGTATGTGGGG + Intergenic
1202046825 Y:20743983-20744005 TAGTCAGACATGAGTATGGCAGG + Intergenic