ID: 1127358638

View in Genome Browser
Species Human (GRCh38)
Location 15:58225836-58225858
Sequence CTCAAACTCCAGTGCAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127358638 Original CRISPR CTCAAACTCCAGTGCAGTCA TGG Intronic
901826160 1:11862971-11862993 CTCAATCTCCAGTCTAGTCCTGG + Intergenic
903879204 1:26497263-26497285 GTCAAACTACAGTGCAGGCCTGG - Intergenic
904853055 1:33473533-33473555 CTCACACTCCAGGGCTGTCAAGG + Intronic
905657197 1:39692389-39692411 CTCAGACGCCAGTGCAGCCCAGG - Intronic
906517266 1:46447118-46447140 CTCAAACTCCATTGCGCTGATGG + Intergenic
908738524 1:67302788-67302810 CCCAAAGTCCTGTCCAGTCATGG - Intergenic
909355604 1:74705877-74705899 TTCAAAGTCCAATACAGTCATGG + Exonic
914488989 1:148137974-148137996 CTCAGAGGCCAGTGCAGGCATGG - Intronic
916517172 1:165530196-165530218 CTCAAACTACAGTGCAGAGGTGG + Intergenic
916942575 1:169691265-169691287 TTCTAACTCCAGTGAAGTAATGG - Exonic
917386374 1:174480461-174480483 AGCAAACTGCAGTGCAATCAAGG + Intronic
919334779 1:196218738-196218760 CTTAATTTCCAGTGCAGTCCTGG - Intergenic
919982742 1:202652486-202652508 CACTAACTCCATTGCTGTCAAGG - Intronic
924858127 1:247895272-247895294 CTCCAAATCCAGTGAAGTGAAGG - Intergenic
1063114187 10:3062277-3062299 CTCAAAGGCCAGTGCCGGCATGG + Intergenic
1065152102 10:22832418-22832440 ACTAAACTCCAGTGCTGTCAAGG + Intergenic
1065278834 10:24114157-24114179 CTCAGACTCCCTTGCAGCCAGGG - Intronic
1065778738 10:29146605-29146627 ATCATACTCCAGGGCAGTCTTGG + Intergenic
1066041341 10:31551080-31551102 CTCAAACCCCAGGGCAGAGATGG - Intergenic
1067030158 10:42874522-42874544 CTCAACCACCACAGCAGTCAAGG - Intergenic
1068750620 10:60587550-60587572 GTCAAAATCCACTGCAGTCATGG + Intronic
1068927986 10:62559619-62559641 CTCTAGCTCCAGTGGAGTCTTGG + Intronic
1068969350 10:62946587-62946609 ATGAAACTGCAGTTCAGTCAGGG - Intergenic
1069243173 10:66167793-66167815 CTCAAACTGCACAGCAGTCTAGG - Intronic
1072156339 10:92727322-92727344 CTCAAACTCCTGGTCAGTGATGG + Intergenic
1072518754 10:96211864-96211886 ATCAAATTCTATTGCAGTCAAGG - Intronic
1072551756 10:96483650-96483672 CCCAAAGTCCTGTCCAGTCATGG - Intronic
1072627083 10:97119503-97119525 CTCAAATCCGAGCGCAGTCAGGG + Intronic
1073120926 10:101122209-101122231 CTGAAAACCCAGTGCAGCCAGGG + Intronic
1074409962 10:113219840-113219862 CTCACACTCCAGTGCACTGAGGG + Intergenic
1074857488 10:117483972-117483994 CTCATCCTCCACTGGAGTCATGG - Intergenic
1075197054 10:120368915-120368937 CTCAAACTTGAGTGCATACAAGG - Intergenic
1077464856 11:2728874-2728896 CAGAAACTTCTGTGCAGTCAGGG + Intronic
1078720559 11:13880035-13880057 CTCAAACTCCAGCCCAGGTACGG + Intergenic
1083695491 11:64439569-64439591 CTCAAACTGCAGTGCTGGAAAGG + Intergenic
1083939242 11:65886417-65886439 GTCAAACTGCAGGGCAGTTAGGG + Exonic
1084095868 11:66910880-66910902 CTCAAACTGCAGTGCTGGGAGGG - Intronic
1084194674 11:67517766-67517788 CTCAATCCCCAGTGCAGCAACGG + Intergenic
1084204727 11:67584786-67584808 CTCCAAGTCCAGGGCAGGCATGG + Intronic
1086173192 11:83859790-83859812 CTAAACCTCCAGTGCTGTGAAGG - Intronic
1087251025 11:95900398-95900420 CTAATACTACAGAGCAGTCAAGG + Intronic
1090840533 11:130483826-130483848 CTTTAACTCCAGAGAAGTCAAGG - Intergenic
1090975677 11:131678157-131678179 CTCAAACCCCGGTCCAGTCTGGG - Intronic
1092250902 12:6895855-6895877 CTCAAACTGGAGTGCAGTTTGGG - Intronic
1093521293 12:20053135-20053157 TTCAAACTGCAGTTTAGTCATGG + Intergenic
1094683991 12:32692513-32692535 CTTGAACTCCACTGGAGTCAGGG + Intronic
1096454931 12:51776997-51777019 CACAATCTCCAATGCAGCCAAGG - Intronic
1096726496 12:53567501-53567523 ATCAAACTCCAGGGCACTCTTGG + Intronic
1098326778 12:69311823-69311845 CTCACTCTCCAGTGGGGTCAAGG + Intergenic
1101272613 12:103163456-103163478 CTCAAACACAAGGGCAGTCCTGG - Intronic
1103890435 12:124234745-124234767 CTCAAACTGCAATGCTGTCATGG - Intronic
1104208370 12:126662341-126662363 CTCCAACTCCCGTGCAGCTAGGG - Intergenic
1104260562 12:127178244-127178266 GTCACAATGCAGTGCAGTCAGGG - Intergenic
1104665220 12:130642984-130643006 CTCAAACTCCAGAGCAGGTGGGG - Intronic
1106176742 13:27338203-27338225 CTCAGGCTCAAGAGCAGTCAAGG + Intergenic
1106261120 13:28067553-28067575 CTTAAATTCCAGTGCCTTCATGG - Intronic
1107195745 13:37649386-37649408 CTCAAATTCTAGTTCAGTTACGG + Intronic
1107348701 13:39490957-39490979 CTCAAACTCCACTGGAATGAGGG + Intronic
1107438775 13:40405078-40405100 CTCCCACTCCACTGCAGTCCAGG + Intergenic
1108649276 13:52459905-52459927 CTCAGCCTCTAGTGCAGTGACGG + Intronic
1109778714 13:67078692-67078714 CTTAAAGTCCAGTGGGGTCATGG - Intronic
1115447066 14:33502840-33502862 CTCAATCTGCAGTGCAGAGACGG - Intronic
1117445294 14:55798442-55798464 CTCCAACACCAGTGCACACATGG - Intergenic
1119769686 14:77212764-77212786 CTCAACCTGCAGGGCAGTGAGGG - Intronic
1121357391 14:93227267-93227289 CTCCTACTCCAGTGCACCCAGGG + Exonic
1123579541 15:21703949-21703971 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1123616168 15:22146460-22146482 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1125771610 15:42171220-42171242 ATCAAACTCCCTAGCAGTCAGGG + Intronic
1125965641 15:43873745-43873767 CTCAAAGTCCACTGCAGCCTAGG - Exonic
1127068882 15:55268691-55268713 CTCAAAATCCAGCCCAGTCCAGG + Intronic
1127358638 15:58225836-58225858 CTCAAACTCCAGTGCAGTCATGG + Intronic
1127598278 15:60509408-60509430 CTCACTTTCCAGTGCAGTCTGGG - Intronic
1132316937 15:100897311-100897333 CTCAGAGACCAGTGCAGACACGG - Intronic
1202988411 15_KI270727v1_random:438194-438216 CTCAAACTCCAGTTCAGACCAGG + Intergenic
1132544970 16:528686-528708 AACAAACTCCAGAGCAGTAAGGG - Intronic
1136691727 16:32037678-32037700 CTCAAACTTCAGCTCAGTCCAGG + Intergenic
1136792314 16:32981241-32981263 CTCAAACTTCAGCTCAGTCCAGG + Intergenic
1136877502 16:33872667-33872689 CTCAAACTTCAGCTCAGTCCAGG - Intergenic
1137270491 16:46899694-46899716 CTCACGCTCCAGGGAAGTCAGGG - Intronic
1139580475 16:67870661-67870683 CTCAAATCCCAGTGTAGCCAAGG - Intronic
1140864810 16:79050608-79050630 CTCAAATACAAGTGCAGTCTTGG - Intronic
1141022437 16:80510038-80510060 CTCAAACTCCAAAGCAGCAATGG + Intergenic
1203094521 16_KI270728v1_random:1242705-1242727 CTCAAACTTCAGCTCAGTCCAGG + Intergenic
1143862407 17:9900432-9900454 CTCAGACTGCACTGCAGTCTCGG + Intronic
1143880441 17:10025737-10025759 CTCAATCTCCAGAGCAGCCTGGG + Intronic
1144631981 17:16878452-16878474 CTCCAACTACAGCACAGTCATGG - Intergenic
1145303871 17:21659766-21659788 CTCACACTCCACTCCAGTCTGGG - Intergenic
1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG + Intronic
1146574321 17:33978334-33978356 CTCACACTGCAGTCGAGTCAAGG + Intronic
1150526784 17:65931945-65931967 GTCAGACTCCAATGCTGTCAAGG - Intronic
1151377849 17:73703515-73703537 CTCAAATTGCAGTCCAGTCCAGG - Intergenic
1155226179 18:23731546-23731568 CACAAACTGGTGTGCAGTCATGG + Intronic
1157103130 18:44748042-44748064 CCTGTACTCCAGTGCAGTCAGGG - Intronic
1159730476 18:72020717-72020739 CTTGAACTCCATGGCAGTCAAGG + Intergenic
1160052263 18:75445047-75445069 TGCAAGCTACAGTGCAGTCATGG - Intergenic
1160404877 18:78638376-78638398 CTCATACTCCAATGGAGACACGG - Intergenic
1165152108 19:33766941-33766963 CTCAAACTCCACCACAGACAGGG + Intronic
1165332454 19:35148423-35148445 CTCAAACTACATGGCAGTCCTGG - Intronic
1166391242 19:42409977-42409999 CTCAAACTCAAGTGACTTCAGGG + Intronic
928132807 2:28665350-28665372 CTCAAACTCCGGTGGGGACAGGG + Intergenic
929808068 2:45164706-45164728 TTCAATCTCCAGTGAAGTCTCGG - Intergenic
930305811 2:49673292-49673314 CCCAAACTGGAGTGCAGTGATGG + Intergenic
933652236 2:84858805-84858827 TTCAAACTCCAGTGGAACCATGG + Intronic
936173482 2:110197474-110197496 CTCAGCCTCCACTGCAGGCAGGG + Intronic
939164242 2:138622901-138622923 CAGAGACTCCAGTGCAGTCGTGG - Intergenic
941038324 2:160591057-160591079 GAGAAACTCCAGTGCAGTCATGG - Intergenic
941255967 2:163231284-163231306 CTCAAACTACAGTGCAGTTCTGG + Intergenic
942135441 2:172920431-172920453 CTCAAACTGGACTTCAGTCAAGG + Intronic
942552073 2:177130108-177130130 CTAAAGCTCCACTGCAATCAAGG + Intergenic
943840018 2:192568130-192568152 CTATAACTCCAGTGTAATCATGG + Intergenic
944439623 2:199728701-199728723 CTCAAGTTCCATTGCATTCATGG - Intergenic
944692317 2:202169389-202169411 CTCTAACTAGGGTGCAGTCAAGG + Intronic
946143354 2:217710508-217710530 CTCACACTCCAGGACAGGCATGG + Intronic
946441295 2:219698871-219698893 CTCAATCTGCAGTGAATTCAGGG + Intergenic
1170243402 20:14194590-14194612 CTCTAACTCCACTGAAGACAGGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1172211539 20:33202153-33202175 CTCAAACTCCATTGCCTTGATGG - Intergenic
1173498107 20:43533608-43533630 CCTAAACCCCAGTGGAGTCAGGG - Intronic
1175460284 20:59147190-59147212 CTCCAAATTCTGTGCAGTCAGGG + Intergenic
1178591447 21:33914378-33914400 GTCAAACAGCAGTACAGTCAGGG - Intronic
1179482604 21:41687956-41687978 TACAAATGCCAGTGCAGTCAGGG + Intergenic
1179583374 21:42359297-42359319 CTTAGACTCCAGCACAGTCACGG - Intergenic
1180721912 22:17915644-17915666 CACAAAATACACTGCAGTCAAGG + Intronic
1181310291 22:21941013-21941035 CTCAGACTCCAGAGTAGTTAGGG + Intronic
1182361024 22:29746579-29746601 TTCAAAATCCAGAGCAGGCAGGG - Intronic
1182583609 22:31329870-31329892 ATCAAACCCCACTGTAGTCAAGG + Intronic
1184506931 22:44909504-44909526 CTAAAAAGCCAGTGAAGTCAAGG - Intronic
952524012 3:34190774-34190796 CTCTATCTCCAATTCAGTCAGGG - Intergenic
954711874 3:52509198-52509220 CTCACTCTCTAGTGCAGTGATGG + Exonic
956367101 3:68516122-68516144 CTCACAATCCAAAGCAGTCAAGG + Intronic
959757556 3:109917012-109917034 TTCAACCTCCAATGCAGTCCTGG + Intergenic
961456279 3:127026127-127026149 CTCAATCTCTCGTGCAGTGACGG - Intronic
970275794 4:14399181-14399203 CTCAGAGTCAAGGGCAGTCAAGG + Intergenic
971650873 4:29271737-29271759 CTGAGACTCCAGTGCAGCCATGG - Intergenic
974563509 4:63553328-63553350 CTAAACCTCCAGGGCTGTCATGG + Intergenic
975284526 4:72601772-72601794 CTTAAACTGCAGTCCATTCATGG - Intergenic
978628028 4:110709638-110709660 TTCACACTCCAAAGCAGTCATGG - Intergenic
980991802 4:139744687-139744709 CTCTCACTGCAGTGCAGCCACGG + Intronic
981662779 4:147186681-147186703 CTCAGACCACAGTGCAATCAAGG + Intergenic
983612798 4:169668563-169668585 CTCAAAGTGCAGTAAAGTCATGG + Intronic
989023608 5:37040906-37040928 CTCAACCTTCTTTGCAGTCAGGG - Intronic
989063766 5:37438011-37438033 CTCAAATTACAGGGCTGTCATGG + Intronic
989711365 5:44401350-44401372 CTAAAACACCAGTGCAATTAAGG - Intergenic
990172662 5:53071463-53071485 CTCATAGTCCAGAGCTGTCATGG + Intronic
990788158 5:59446736-59446758 CTCAAACTCCATTACATTAATGG + Intronic
992998867 5:82359735-82359757 CTCAAACTGCAATGCCTTCAAGG - Intronic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
994704288 5:103181527-103181549 CCCAGGCTGCAGTGCAGTCAGGG - Intronic
997509855 5:134446698-134446720 GTCAATTTCCAGTGCAGTAAGGG + Intergenic
999474779 5:151888576-151888598 CCCAAACTGAAGTGCAGACAGGG + Intronic
1001951075 5:175817025-175817047 CTCAGACGCCAGTGCACTCGGGG + Intronic
1002168115 5:177360522-177360544 CTCAGACTGCACTGCAGTCTGGG + Intronic
1002169011 5:177364974-177364996 CTCAAACTTCAGTGCAGAGTGGG - Intronic
1002430118 5:179198536-179198558 CTCAAACTCCAGTGTAGGCCGGG + Intronic
1004494953 6:16154722-16154744 CTCAAACTCCAGGGCACTAGTGG - Intergenic
1004504782 6:16238870-16238892 CTCAAACACCAAAGCAGGCAGGG - Intronic
1005994559 6:30923399-30923421 CTCACACTCCTGGGCAGCCAGGG - Exonic
1006414762 6:33896862-33896884 CTCACTCTCCAGTGCAGTCTGGG - Intergenic
1007081152 6:39105468-39105490 CTCCAACTGCTCTGCAGTCAGGG + Exonic
1007163270 6:39810160-39810182 CCCAAACTGCAGTGGAGTCCGGG + Intronic
1010901228 6:81430790-81430812 CTCAGACAACAGTGCAGTAAAGG - Intergenic
1011610402 6:89145853-89145875 CTCAAAGGCCAGAGCAGCCAAGG + Intergenic
1012007743 6:93735603-93735625 CTAAAAATCCAGGGCAGCCATGG - Intergenic
1012390227 6:98729743-98729765 CCCAACAGCCAGTGCAGTCATGG + Intergenic
1014811625 6:125893199-125893221 CTGAAACTCCAGTGGATGCATGG - Intronic
1015444998 6:133293588-133293610 CTCTGACTCCAGTGCAGGCCAGG - Intronic
1015707584 6:136104864-136104886 CTCAAAGTGCAGTGTAGTTATGG + Intronic
1016510844 6:144841265-144841287 ATCAGACTCCAGTGCAGAAAGGG + Intronic
1017064135 6:150513040-150513062 CTCAAGCTGGAGTGCAATCATGG - Intergenic
1017101534 6:150853561-150853583 CTCTAACCCCACTGCAGTTAAGG + Intergenic
1017847603 6:158273033-158273055 CTCAAGCTCCAGTGAAGTGTCGG - Intronic
1019492586 7:1322186-1322208 CTCGAACTCCTGCGCACTCAGGG - Intergenic
1025107170 7:56181055-56181077 CCCAGACTGAAGTGCAGTCAAGG - Intergenic
1028251580 7:88544708-88544730 CTCAGGCTCCAGTGCTGTAATGG + Intergenic
1028598788 7:92578035-92578057 CTTAAACTCCAGATGAGTCAAGG - Intronic
1033674283 7:143522435-143522457 CGCAAACAGCAGTGTAGTCATGG + Intergenic
1033687059 7:143650611-143650633 CGCAAACAGCAGTGTAGTCATGG + Intronic
1033697552 7:143807012-143807034 CGCAAACAGCAGTGTAGTCATGG - Intergenic
1034382938 7:150714800-150714822 CTGAGACTCAAGTGTAGTCAGGG + Intergenic
1039870295 8:41540224-41540246 TACAAGCACCAGTGCAGTCATGG - Intronic
1042336761 8:67638156-67638178 CTCAAACTCTAGGGCATCCAAGG - Intronic
1042879367 8:73470259-73470281 CCCAGACTCCCTTGCAGTCAGGG - Intronic
1043497159 8:80814405-80814427 CTAAAACTCAAGTATAGTCATGG - Intronic
1043696584 8:83226974-83226996 CTCAAACTGCAGTGAGATCAGGG + Intergenic
1044749007 8:95398665-95398687 CTCAGACTCCAGCCCACTCAGGG - Intergenic
1047034087 8:120915438-120915460 CTCCAACTCCAGTGCCCACAAGG + Intergenic
1047437628 8:124847879-124847901 GTCAAACTCAAGTGGCGTCAGGG - Intergenic
1049014579 8:139910630-139910652 CTTAAACTCCTGTGCAGTCATGG + Intronic
1049501126 8:142966782-142966804 CAGAGACTCCAGTGCAGCCATGG - Intergenic
1049994451 9:1021364-1021386 TACAAACTCCAGTGCAGGCAAGG + Intergenic
1051328287 9:15997202-15997224 CTCAAACCACAGTGCAGATAAGG + Intronic
1052342968 9:27381095-27381117 CTCAAACTCTACTGCAGGCATGG + Intronic
1052630930 9:31037839-31037861 CCTAAACTCCAGGGTAGTCAAGG - Intergenic
1053306641 9:36988990-36989012 CTCAAACCCCAGTCTACTCACGG + Intronic
1053479588 9:38406097-38406119 CTCAGACTCCAGTGGAGACATGG - Intergenic
1056490966 9:87106760-87106782 CTCAAATTCCAGTTCTGTTATGG + Intergenic
1058582158 9:106470275-106470297 ATGATACTCTAGTGCAGTCATGG - Intergenic
1059328808 9:113522192-113522214 CTCACACTCTAGTACAGACATGG - Intronic
1059656528 9:116362706-116362728 CTCAAACTGCAGTGCCCTGATGG + Exonic
1187454343 X:19428165-19428187 CACACTCTCCAGTGCAGACACGG - Intronic
1188746934 X:33856590-33856612 CACAAACTCAAATGCCGTCAGGG + Intergenic
1189250845 X:39599809-39599831 CCCAAGCTCCATTTCAGTCAGGG - Intergenic
1193396522 X:80990370-80990392 CTCAAGCTCCAGTGCTGAGATGG - Intergenic
1194901842 X:99521192-99521214 CTCACTCACCAGTGCAGACAAGG + Intergenic
1201407040 Y:13659932-13659954 CTCTACCCCCACTGCAGTCAAGG - Intergenic