ID: 1127361022

View in Genome Browser
Species Human (GRCh38)
Location 15:58245319-58245341
Sequence AAAGCATGGACTCCAGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127361009_1127361022 30 Left 1127361009 15:58245266-58245288 CCTTTGCAGTCCTGCTCCAGCAG 0: 1
1: 1
2: 0
3: 45
4: 270
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1127361011_1127361022 20 Left 1127361011 15:58245276-58245298 CCTGCTCCAGCAGCTAGAGGAGC 0: 1
1: 1
2: 2
3: 23
4: 328
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1127361015_1127361022 -9 Left 1127361015 15:58245305-58245327 CCCCATCTTCCCTGAAAGCATGG 0: 1
1: 0
2: 2
3: 27
4: 228
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1127361017_1127361022 -10 Left 1127361017 15:58245306-58245328 CCCATCTTCCCTGAAAGCATGGA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1127361012_1127361022 14 Left 1127361012 15:58245282-58245304 CCAGCAGCTAGAGGAGCCCAGCT 0: 1
1: 0
2: 1
3: 27
4: 295
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1127361013_1127361022 -2 Left 1127361013 15:58245298-58245320 CCCAGCTCCCCATCTTCCCTGAA 0: 1
1: 0
2: 1
3: 43
4: 397
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
1127361014_1127361022 -3 Left 1127361014 15:58245299-58245321 CCAGCTCCCCATCTTCCCTGAAA 0: 1
1: 0
2: 3
3: 43
4: 414
Right 1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127361022 Original CRISPR AAAGCATGGACTCCAGCTTC GGG Intronic
902700820 1:18170701-18170723 AAAGCATGGACTCCAGAGTCAGG - Intronic
904615485 1:31747241-31747263 AAAGCATGGACTCCTGATATGGG - Intronic
904838911 1:33357860-33357882 AAATCATGGATTCCTGCTCCTGG + Intronic
905091631 1:35435090-35435112 AAAACAAGGAATCCAGCATCAGG + Intronic
907014762 1:51001624-51001646 CAAGGATGGTCTCCAACTTCCGG + Intergenic
907952796 1:59200023-59200045 ATAGTCTGGATTCCAGCTTCTGG + Intergenic
910480114 1:87649555-87649577 AAAACTTGGACTCTAGCCTCTGG + Intergenic
910596770 1:88989654-88989676 TAAGCTTGGAGTGCAGCTTCTGG + Intronic
911888912 1:103341927-103341949 AAATCATGGAGTCCAGATTCAGG - Intergenic
912839581 1:113027206-113027228 AAAGGATGTACTTCAACTTCTGG + Intergenic
917920870 1:179748532-179748554 AAGGCATGGCCCCCAGGTTCAGG + Intronic
920249413 1:204613379-204613401 AATGCAAGGTCTCCAGCCTCTGG + Intergenic
922079796 1:222284561-222284583 AAAGCAATGGCTCCAGCTACTGG - Intergenic
922950404 1:229554282-229554304 AAGCCAGGGACTCCAGGTTCTGG + Intronic
924208907 1:241744530-241744552 AAAGCAGGGACGCCACATTCTGG - Intronic
1063151050 10:3336569-3336591 GAAGCATGGGCTCTAGCTTAGGG + Intergenic
1066065447 10:31758236-31758258 GAAGCATGGAGTGCAGCTTGAGG - Intergenic
1068188645 10:53620062-53620084 AAAGTAAGGACTCAGGCTTCAGG - Intergenic
1068937526 10:62650426-62650448 TAGACATGGGCTCCAGCTTCTGG + Intronic
1068965458 10:62907540-62907562 AAAGTAGGGACTCCAGTATCTGG + Intronic
1068973596 10:62984313-62984335 AAAGTATAGACTCTGGCTTCAGG + Intergenic
1073896791 10:108170329-108170351 AAAGCATTTATTTCAGCTTCTGG + Intergenic
1076679250 10:132163214-132163236 ACAGCATGGCTTCCAGCTCCAGG - Exonic
1077529576 11:3088878-3088900 AGATCTTGGACTCCAGCCTCCGG + Intronic
1077762243 11:5114958-5114980 AGATCATGCACTCCAGCTTGGGG - Intergenic
1078430599 11:11285235-11285257 AAAGCATGGACCCCAGAGGCAGG + Intronic
1078476030 11:11631039-11631061 CAAGAATGTTCTCCAGCTTCAGG - Intergenic
1079088482 11:17464088-17464110 CATGCATGGGCTCCAGCGTCAGG - Intronic
1081865965 11:46360964-46360986 TGAGCTGGGACTCCAGCTTCTGG - Intronic
1083903949 11:65658174-65658196 CAAGCTCTGACTCCAGCTTCTGG + Intronic
1087309803 11:96528201-96528223 ACAGCATGCACTCCAGCAACTGG + Intergenic
1089964157 11:122641749-122641771 AAAGTGTGGATTTCAGCTTCTGG + Intergenic
1091031834 11:132196960-132196982 AAAGCATCGAATCCAGTTTTTGG + Intronic
1099405757 12:82260274-82260296 AGAGCATGGGCTCCAGATTCTGG - Intronic
1099855134 12:88155181-88155203 AAAGCATGGACTAAAGAGTCTGG + Intronic
1105842350 13:24265689-24265711 AAAGCATGGCCATCAGCTTTAGG - Intronic
1106104233 13:26719697-26719719 AAAGCAAAGACTCCACCTGCTGG + Intergenic
1106199641 13:27525715-27525737 AGAGAATGGGCTCCTGCTTCAGG - Intergenic
1106679807 13:31998431-31998453 AAAGGATGGAGTCCTGATTCTGG + Intergenic
1106857993 13:33873611-33873633 AAAGCAGGCACTCTAGATTCTGG + Intronic
1108539256 13:51422424-51422446 CAAGCATGGACCCTAGGTTCAGG + Intronic
1108780007 13:53818437-53818459 AAAGCCTGCACTGTAGCTTCTGG - Intergenic
1109601152 13:64630164-64630186 AAATCCTGGACTCAAGATTCAGG + Intergenic
1113550335 13:111188072-111188094 AAAGCAGGGCCTGCAGCTTCAGG - Intronic
1113685202 13:112278226-112278248 TAAGCATGGACTGCTTCTTCAGG + Intergenic
1113685328 13:112278974-112278996 TAAGCATGGACTGTATCTTCAGG + Intergenic
1113685365 13:112279178-112279200 TAAGCATGGACTGTATCTTCAGG + Intergenic
1113686047 13:112283052-112283074 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113686342 13:112284718-112284740 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113686474 13:112285466-112285488 TAAGCATGGACTGTATCTTCAGG + Intergenic
1113686760 13:112287097-112287119 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113687064 13:112288797-112288819 TAAGCATGGACTGCTTCTTCAGG + Intergenic
1113687207 13:112289647-112289669 TAAGCATGGACTGTATCTTCAGG + Intergenic
1113687225 13:112289749-112289771 AAAGCATGGACTGTTTCTTCAGG + Intergenic
1113687630 13:112292060-112292082 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113687825 13:112293148-112293170 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113688035 13:112294338-112294360 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113688284 13:112295733-112295755 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113688490 13:112296889-112296911 AAAGCATGGACTGTTTCTTCAGG + Intergenic
1113688893 13:112299166-112299188 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113689162 13:112300662-112300684 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113689415 13:112302056-112302078 TAAGCATGGACTCATTCTTCAGG + Intergenic
1113690068 13:112305692-112305714 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113690182 13:112306338-112306360 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113691066 13:112311267-112311289 TAAGCATGGACTCTTTCTTCAGG + Intergenic
1113727466 13:112615734-112615756 AAAGCATGGCCTCCACCCTCAGG - Intergenic
1114701380 14:24681799-24681821 AAAGCATGGTCACCGGATTCTGG + Intergenic
1115029374 14:28775528-28775550 AAAGCGAGGACTCCAGTTTCTGG - Intronic
1116231075 14:42217633-42217655 AAAGCATGGATTACATCTTTAGG + Intergenic
1118249704 14:64147760-64147782 AAATAATGGACTCTTGCTTCTGG - Intronic
1119168871 14:72517418-72517440 AAAGCTTGGACAACAGCTACCGG - Intronic
1122401431 14:101469701-101469723 AAACCATGGGCTCCAGCCCCTGG - Intergenic
1127361022 15:58245319-58245341 AAAGCATGGACTCCAGCTTCGGG + Intronic
1129327902 15:74811443-74811465 CAAGGATGGACTCAAACTTCTGG - Intergenic
1131391181 15:92050130-92050152 TAAGCATGGCCTTTAGCTTCTGG + Intronic
1133564318 16:6978771-6978793 AGAGCATGAACTCCAGAATCAGG - Intronic
1139073197 16:63409064-63409086 AAATCATGGACTCTATCTTCTGG + Intergenic
1142573832 17:893309-893331 AAAGCATGGAGCCCAGTCTCAGG + Intronic
1142767770 17:2075283-2075305 AAAGGAGGGACTACATCTTCAGG + Intronic
1142776586 17:2144824-2144846 AAAGCTGGGATTCCAGCTTTAGG - Intronic
1143982909 17:10885404-10885426 AAAGTATGTACTCCATCTGCAGG - Intergenic
1144054984 17:11532699-11532721 AAGGCATGGGCTCCTGCTTTGGG - Intronic
1144653340 17:17020368-17020390 ACCGCATGGCCACCAGCTTCAGG + Intergenic
1145064631 17:19753745-19753767 GAGGAATGGACTCCAGCTCCCGG - Intergenic
1149001937 17:51766195-51766217 AGAGCAAGGACTCCATGTTCAGG + Intronic
1151115936 17:71735050-71735072 AAAGTATGAACTCAGGCTTCAGG - Intergenic
1153810172 18:8745461-8745483 AATGAATGAACTCCAGCTGCCGG - Intronic
1155148959 18:23107281-23107303 AAAGCAATGACTCAATCTTCAGG - Intergenic
1157575548 18:48740749-48740771 AAGGAGTGGACTCCAGCTCCTGG + Intronic
1159793218 18:72810378-72810400 AAAGCATAGTCTCCATCTTGGGG + Intronic
1160112982 18:76051248-76051270 AAAGCACAGATTCCAGCTTTTGG + Intergenic
925212294 2:2060146-2060168 CAAGGAAGGACTGCAGCTTCAGG + Intronic
934067742 2:88354972-88354994 TAAGCATGGACCCAAGCTTGTGG + Intergenic
934933294 2:98445410-98445432 ACGGCAAGGCCTCCAGCTTCAGG - Intronic
935537573 2:104311901-104311923 CAAGCATGGACTTCAGAATCTGG - Intergenic
940349839 2:152670616-152670638 AAAACATGGTTTCCAGATTCTGG - Intronic
945142212 2:206698903-206698925 AAAGCAGGGACTCCGGATTTAGG + Intronic
946131843 2:217612616-217612638 CAAGCATGGATTCCAGTGTCGGG - Intronic
948301366 2:236909596-236909618 TGAGCATGGACTCCACCTCCTGG - Intergenic
948850485 2:240703066-240703088 AAAGCCTGGACTTCAGCCCCTGG - Intergenic
1170017444 20:11797650-11797672 AGAGCATGGCCTCCATCTGCAGG - Intergenic
1172031972 20:31988671-31988693 ACAGCATGGACTACAGTGTCTGG + Intronic
1172320344 20:33991583-33991605 AGAGCATGAACTCCATCTTTTGG + Intergenic
1182192559 22:28477943-28477965 AAAGCATCTAATCCAGCTGCAGG + Intronic
1183542386 22:38437066-38437088 AAAGCTTGGTCTCCAGCGTTTGG - Intronic
1183970244 22:41471849-41471871 AGAGCATGGACTCTGGCATCAGG + Intronic
949403423 3:3689285-3689307 AAATCATTGATTCCAGCTTGTGG - Intergenic
954582241 3:51709160-51709182 AAAGCATGGCCTCCAGGCGCTGG - Exonic
958183753 3:90092035-90092057 AAATCATAGAATCCAGCTTTAGG - Intergenic
960395319 3:117130579-117130601 AAATTATGGACTCCAGAGTCTGG + Intronic
961692222 3:128678361-128678383 AAAGAATGGCTTCCAGCTTGAGG - Intronic
964381809 3:156105083-156105105 AATTCATGGCCTCCAACTTCAGG + Intronic
964654330 3:159050042-159050064 AAAGCATGGACTTTAGAGTCAGG + Intronic
965524409 3:169701122-169701144 AAAGCATGGACTCTAGGCTCCGG - Intergenic
968460947 4:724429-724451 ACAGCATGGGCTCCGCCTTCTGG - Intronic
968753647 4:2403238-2403260 AAAGCCTGTACCCCAGCGTCGGG + Intronic
968901643 4:3434970-3434992 AGAGGATGGACTCCACCTGCCGG + Intronic
969040856 4:4294954-4294976 AAAGCATAGACTCCAGTGTTTGG + Intronic
973166884 4:47088959-47088981 AAATCAGGGACTCCATCTGCTGG + Intronic
975822002 4:78280353-78280375 AAAGGAAGGACTCCAGGTCCTGG + Intronic
977105881 4:92883902-92883924 TAAGCATTGACTTCAGCTTAGGG + Intronic
978978707 4:114914777-114914799 AAAGCATGGACTGGAAATTCAGG - Intronic
980902945 4:138922384-138922406 AAAACATAGACTCAAGCTTCTGG - Intergenic
981849891 4:149218035-149218057 CAAGCTTAGGCTCCAGCTTCAGG - Intergenic
984645765 4:182218172-182218194 AAAACATGGACTCCGGGGTCAGG - Intronic
985190441 4:187366799-187366821 GAAGCAGGGGCTCCAGCTTCAGG - Intergenic
986631980 5:9782601-9782623 ACTGCATGGTCTCCAGCTGCAGG + Intergenic
987202942 5:15595749-15595771 AGTGCATTGACTCCAGCATCTGG + Intronic
987843748 5:23255081-23255103 CAGGCATGGACTCCAGCTGCAGG - Intergenic
988534388 5:32053229-32053251 AAAGCAGAGCCTGCAGCTTCAGG + Intronic
988644431 5:33078667-33078689 AAAGCATGGACTTCCCTTTCTGG + Intergenic
990050698 5:51495799-51495821 GAATCAAGGACTTCAGCTTCAGG + Intergenic
991196087 5:63934299-63934321 AAAGTATGGCTTCCAACTTCAGG + Intergenic
995638320 5:114221501-114221523 AAAGGATGGACTCCAGCAAGAGG + Intergenic
996124525 5:119708627-119708649 AAGGCATGCACTGCAGCTGCTGG - Intergenic
998974798 5:147633735-147633757 AGATCATGCACTCCAGCCTCGGG - Intronic
998992335 5:147831737-147831759 ATAGCCTGGCCTCCAGGTTCTGG + Exonic
1000752979 5:165119808-165119830 AAGGCATGAGCTCCAGCCTCTGG - Intergenic
1001640795 5:173242796-173242818 CCAGCAGGGACTCCAGCTGCAGG + Intergenic
1003908777 6:10725148-10725170 GAAGCCTGCACTCCAGCTTGGGG - Intronic
1003911772 6:10749809-10749831 GAAGCCTGCACTCCAGCTTGGGG - Intronic
1005794048 6:29338558-29338580 ACATCACGGACTCCAGCTTCTGG - Intergenic
1011006890 6:82655489-82655511 AAAGGATGGATTCCTGCTGCTGG + Intergenic
1012118636 6:95336219-95336241 AAAGCATGTACTCGATCTTGGGG + Intergenic
1013391881 6:109693572-109693594 ATTGCATGGTATCCAGCTTCTGG + Intronic
1014307591 6:119760975-119760997 AAAGCATGGTCTTTAACTTCTGG - Intergenic
1015911114 6:138168549-138168571 TAAGCAGAGACTGCAGCTTCAGG + Intronic
1018117866 6:160605678-160605700 AAGGCAAGGTCTTCAGCTTCTGG + Intronic
1018833306 6:167462969-167462991 AAAACCTGGGTTCCAGCTTCTGG - Intergenic
1030413994 7:109216830-109216852 AAAGCATGGATTCTAGAGTCAGG - Intergenic
1030442469 7:109604464-109604486 AATGCAGGGACTCCAGATTAAGG - Intergenic
1033055002 7:138043436-138043458 AATGCTTGGACTTCCGCTTCTGG + Intronic
1033755065 7:144391566-144391588 AAAACATGGAGGCCAACTTCAGG + Intergenic
1034162241 7:149002257-149002279 AACGAATGGACTTCTGCTTCCGG + Intergenic
1034564341 7:151901340-151901362 AAAGCCAGAACTCCACCTTCAGG + Intergenic
1034765959 7:153721536-153721558 CAAGCATGGTGCCCAGCTTCTGG + Intergenic
1036694817 8:10967585-10967607 AGAGCCTGGCCTCCAGCTCCAGG - Intronic
1036710764 8:11077196-11077218 AAAGCATTGTGTCCAGCTGCCGG + Intronic
1037404689 8:18529105-18529127 AAATGATGCACACCAGCTTCTGG + Exonic
1038398637 8:27266355-27266377 GAGGCATGGACTCCAGGCTCAGG - Intergenic
1039778421 8:40759742-40759764 AAAACATGAGCTCCTGCTTCTGG + Intronic
1043046965 8:75338604-75338626 ACAGCATGTCCTCCAGTTTCTGG - Intergenic
1044128505 8:88489861-88489883 AAGGTATGGTCTCCAGCTCCAGG + Intergenic
1045352522 8:101355293-101355315 ATGGCATTGACTACAGCTTCAGG - Intergenic
1052394046 9:27916097-27916119 AAAGCATTGACTGCAACTTTGGG - Intergenic
1052790024 9:32866592-32866614 GAAGCATGCACTTCAGCATCTGG + Intergenic
1054954849 9:70897958-70897980 AAAGCATTAACTCCAATTTCTGG + Intronic
1057473872 9:95382378-95382400 AAAGCATGGATTACCTCTTCTGG + Intergenic
1058047401 9:100371168-100371190 AGAACATGGACTTCAGCTTCAGG - Intergenic
1059512516 9:114862648-114862670 AAATCATGGACTCCAACTTTGGG + Intergenic
1062216317 9:135391575-135391597 AAAGCAGGCACTCCTGCCTCGGG + Intergenic
1062425780 9:136505597-136505619 ACATCCTGGACTACAGCTTCGGG - Exonic
1186072997 X:5843142-5843164 ATTGCATAGACTCCAGTTTCAGG - Intronic
1194290405 X:92064911-92064933 AAAGCATGGCCTTCAGCATCAGG + Intronic
1194864903 X:99053843-99053865 ACAGCTTGGGCTGCAGCTTCAGG + Intergenic
1196389878 X:115196100-115196122 ATGGCATGGGCTCCAGCCTCTGG + Intronic
1197286708 X:124603579-124603601 AAAGTGTGGGCTCCAGCATCAGG - Intronic
1197517773 X:127457258-127457280 AAAGAATGGAATCCTACTTCAGG - Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200607918 Y:5289510-5289532 AAAGCATGGCCTTCAGCATCAGG + Intronic