ID: 1127361450

View in Genome Browser
Species Human (GRCh38)
Location 15:58248104-58248126
Sequence AAGTTTTCCCAAAGGGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127361450_1127361454 0 Left 1127361450 15:58248104-58248126 CCCACTGCCCTTTGGGAAAACTT 0: 1
1: 0
2: 4
3: 26
4: 201
Right 1127361454 15:58248127-58248149 ATATTTGAGTTGCTATGATATGG 0: 1
1: 0
2: 2
3: 24
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127361450 Original CRISPR AAGTTTTCCCAAAGGGCAGT GGG (reversed) Intronic
901180878 1:7341121-7341143 AACATTTCCTAAAGGGCTGTGGG + Intronic
901787008 1:11631362-11631384 AAGTTCTCCCCAAGGTCAGCAGG + Intergenic
908842917 1:68296583-68296605 AAGTTCTCCCAAAGGTTATTAGG - Intergenic
909855117 1:80519997-80520019 ATATTTTCTCAAAGTGCAGTTGG - Intergenic
910515087 1:88052021-88052043 AAGCTCTCCCAGAAGGCAGTAGG - Intergenic
911560149 1:99395114-99395136 AAATTTTTCCTAAGTGCAGTTGG - Intergenic
912028701 1:105211605-105211627 AAGCTTTGCCAAAGATCAGTTGG - Intergenic
913426704 1:118739229-118739251 AAGCTTTCCACAAGGTCAGTGGG + Intergenic
913523334 1:119667161-119667183 AAGTTTTGGCCAAGCGCAGTGGG + Intronic
914912601 1:151799843-151799865 GAGTTTTCCCCAAGGGCACTAGG + Intergenic
916487947 1:165275989-165276011 GAGTTTTCACAAAGGGAAGCTGG + Intronic
916889920 1:169105432-169105454 AGGTTTTCCCAAAGGTCCTTTGG + Intergenic
919356326 1:196527114-196527136 CAGTTTTCCCATAGACCAGTGGG - Intronic
920076473 1:203340988-203341010 AACCTTGCCCAAAGGGCAGGTGG + Exonic
924397962 1:243643760-243643782 AATTTTTGCCAAATGGCAATAGG - Intronic
1063469315 10:6271886-6271908 AAGTATTGCAAAAGGGCAATAGG + Intergenic
1063484984 10:6411351-6411373 AAGTTTTCCCAAGGGGCATGAGG - Intergenic
1064197727 10:13259527-13259549 AAGGGCTCCCACAGGGCAGTGGG - Intergenic
1064346386 10:14536568-14536590 AATTTTTCCCAAAGTGCAGTTGG + Intronic
1068111967 10:52690452-52690474 AAGATTTCCCAATTGGCAATTGG + Intergenic
1068183021 10:53546627-53546649 AAGATTTCCCGATTGGCAGTTGG - Intergenic
1068262357 10:54599364-54599386 CAGTTTTCTCAAAGAGCAGATGG - Intronic
1070367826 10:75753260-75753282 AAGTAGTACCTAAGGGCAGTGGG + Intronic
1070441229 10:76445567-76445589 AGGCTTTCCCAATGGGCAGTGGG - Intronic
1071146643 10:82582356-82582378 CTGTTTTCACAAAGGGCAGGGGG + Intronic
1073295337 10:102435267-102435289 AAGCAGTACCAAAGGGCAGTGGG - Intergenic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1075034169 10:119049129-119049151 TAGTTTTCCCAAAGAACAGAAGG - Intronic
1076576316 10:131472085-131472107 AAGATTTTCTAAATGGCAGTTGG + Intergenic
1077972650 11:7211237-7211259 CATTTTACCCAAAGGGCAGAGGG - Intergenic
1078544256 11:12235288-12235310 AAGGGCTCCCAAAGGGCACTCGG - Intronic
1079137192 11:17782261-17782283 AAGCTTCCAAAAAGGGCAGTCGG + Exonic
1080295612 11:30723657-30723679 AATTTTATACAAAGGGCAGTGGG + Intergenic
1083050412 11:59771493-59771515 AAGTTTGTGCAAAGTGCAGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085980108 11:81714531-81714553 AAGTCTTTCCAAAGGAGAGTAGG + Intergenic
1086094507 11:83036951-83036973 AATTTTGTCCAAAGGGCAATGGG + Intronic
1086324240 11:85682402-85682424 AAATTTTTCGAAAGGGCATTAGG + Intronic
1088734675 11:112718960-112718982 AATTTTTCCCAAGGGGCTCTTGG + Intergenic
1089884574 11:121807227-121807249 AAGTTTTCACAAAGCGCATTGGG - Intergenic
1091015820 11:132050032-132050054 AGGCTATCCCAAAAGGCAGTCGG + Intronic
1095858403 12:46887279-46887301 AAGCTTTTCCTAAGGGCAGGGGG + Intergenic
1095869841 12:47014470-47014492 AAGTTTACACAAAGAGGAGTAGG - Intergenic
1095923216 12:47552078-47552100 AAGGTTTTCCAAAAGGCAGGGGG - Intergenic
1096860962 12:54527780-54527802 AAGTTTGCCCAGAGGTCAGGAGG + Intronic
1096900768 12:54878909-54878931 AATGCTTCACAAAGGGCAGTTGG + Intergenic
1097046669 12:56191776-56191798 AAGGAATCCCAAAGGGCAGGGGG + Intergenic
1098134655 12:67389645-67389667 AGCTTTTCCCAAAGGGCAATAGG + Intergenic
1098628142 12:72698330-72698352 TAGTTTACCAAAAGAGCAGTAGG + Intergenic
1099663852 12:85600636-85600658 AAGTATTCTAAAAGGTCAGTAGG + Intergenic
1099952098 12:89315111-89315133 AAGTTTTCCCACAAACCAGTAGG + Intergenic
1100796647 12:98189165-98189187 AAGTTGTCCCAAAGGGTATGTGG + Intergenic
1101368964 12:104107325-104107347 AAGATTTAACAAAGGACAGTGGG - Intergenic
1104593032 12:130099785-130099807 AAGTGTTCCCAGTGGGTAGTGGG + Intergenic
1107422440 13:40261059-40261081 AAGGTTTCCCAAAAGCCAGCAGG + Intergenic
1108676414 13:52740747-52740769 AGGCTTCCCCAAAGGGCAGCGGG + Intergenic
1108739172 13:53317449-53317471 AAGTTGTGACAAATGGCAGTTGG + Intergenic
1108917066 13:55627650-55627672 AAATTTTCCACAAGTGCAGTGGG + Intergenic
1109726968 13:66354159-66354181 AACTTTACCCAAAGAGGAGTTGG + Intronic
1111141943 13:84130217-84130239 AAGCTTTCCTGAAGGGCAGATGG - Intergenic
1111600946 13:90473223-90473245 AAGAGTTCACAAAGGGCAGTTGG - Intergenic
1112466293 13:99647652-99647674 GTGTTTTTCCAAAGGGCAGAGGG + Intronic
1112886243 13:104176043-104176065 AACTTTTCCGAAAAAGCAGTTGG + Intergenic
1113051962 13:106222176-106222198 GACTTTTCCCAAAGGGCTTTAGG + Intergenic
1116305189 14:43244809-43244831 ATGTTTTGCCAAAGATCAGTTGG + Intergenic
1117188021 14:53261555-53261577 AAGATTTCTCAAAGGTCAGGAGG + Intergenic
1117612841 14:57502350-57502372 GATTTTTCCCTAAGGACAGTGGG - Intergenic
1117742817 14:58835387-58835409 GTTGTTTCCCAAAGGGCAGTGGG + Intergenic
1117801982 14:59453976-59453998 AACATTTCCAAAAGGGAAGTGGG + Intronic
1117869881 14:60189056-60189078 GAACTTTCCCAAAGGGCATTTGG - Intergenic
1119821657 14:77621457-77621479 ATGATTTCCCAAAGGGAAATGGG + Intergenic
1120193336 14:81459244-81459266 AAATTCTCCCAAAGGTCACTTGG + Intergenic
1202828390 14_GL000009v2_random:1455-1477 AAATTATCCCAAAGCCCAGTGGG - Intergenic
1123791863 15:23729637-23729659 AAGTTTTCCAATATGGCTGTTGG + Intergenic
1127361450 15:58248104-58248126 AAGTTTTCCCAAAGGGCAGTGGG - Intronic
1128549532 15:68589559-68589581 AAGTTTTCCCAAGGGGGTATAGG + Intronic
1128982133 15:72196004-72196026 AAATTCTCCCAAGGGGAAGTTGG + Intronic
1129415046 15:75371747-75371769 AACTTTTCCCAAAGGGTTTTGGG - Exonic
1129797552 15:78389572-78389594 GCGATTTCCCAAAGTGCAGTTGG + Intergenic
1130103954 15:80915124-80915146 ATGTTTTCCCCAGGAGCAGTTGG + Intronic
1131339895 15:91589048-91589070 CATTTTTCCTAATGGGCAGTAGG - Intergenic
1134016393 16:10891411-10891433 CAGTTTTCTCACAGGGCATTGGG - Intronic
1135964023 16:27021219-27021241 AGGTTTTCTCTAAGTGCAGTGGG - Intergenic
1138722928 16:59102870-59102892 ATTTTTTAACAAAGGGCAGTGGG - Intergenic
1139307565 16:66000392-66000414 ACATTTTCCTAATGGGCAGTGGG + Intergenic
1140242384 16:73214921-73214943 AAGTTTTCCCACAGAGGAGTTGG - Intergenic
1142788064 17:2240801-2240823 AGCTTTTCCGAAAGGGCAGGCGG + Intronic
1142962447 17:3559200-3559222 AACTTTTCTCAGAGGGCAGGTGG + Intergenic
1144592571 17:16536868-16536890 AAGTCTTCCCAAAGGAAACTTGG - Intergenic
1144856388 17:18270683-18270705 AATTCATCCCAAAGGGCAGTGGG + Intergenic
1145874643 17:28307526-28307548 AAATCTTCCCAAAGGGTGGTGGG - Intergenic
1148530486 17:48385682-48385704 TCGTTTTCCCAAAGTGCTGTTGG - Intronic
1148961002 17:51392725-51392747 AAATTCTCCCAAGGGGCTGTGGG + Intergenic
1149394175 17:56221959-56221981 AAGTTTCCACACAGGGCAGTAGG - Intronic
1149889595 17:60375111-60375133 AAGTTTTACAAAAGTGCTGTTGG + Intronic
1152076109 17:78160994-78161016 AAGTTTTCCCCAAAGGCCGCTGG + Exonic
1153604207 18:6815345-6815367 AAATTTTCCCAAAGGGGCATGGG - Intronic
1155488813 18:26377302-26377324 AAGTTTTCCCAAAGAGCACAGGG - Intronic
1156509246 18:37621745-37621767 TTGTTTGCACAAAGGGCAGTAGG + Intergenic
1157744633 18:50124353-50124375 AATCATTCCCAAAGGGGAGTTGG + Intronic
1158346048 18:56518145-56518167 AAATTTTTCCAAAGGGCAGATGG - Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1160469127 18:79111636-79111658 ACGTTTTCCTAAAGGTCAGCAGG + Intronic
1161029082 19:2049761-2049783 CAGTTTTCCCCTAGGGCAGCAGG - Intronic
1162220785 19:9174445-9174467 AAGTTTTTCCAATAGGCAGTTGG - Intergenic
1163475854 19:17525720-17525742 GTGCTTTCCCAAAGGGCAATGGG + Intronic
1166226348 19:41397956-41397978 CGGTTTTCCCAAAGGGGATTAGG + Intronic
1168521524 19:57054731-57054753 AACTTTTTCCAGAGGGCAGCAGG - Intergenic
1202644308 1_KI270706v1_random:126366-126388 AAATTATCCCAAAGCCCAGTGGG + Intergenic
926782195 2:16483576-16483598 AAGTTTTTACAAAGGGTAGAAGG + Intergenic
928114660 2:28538398-28538420 AGGGCTTCCCCAAGGGCAGTGGG + Intronic
929457737 2:42077860-42077882 TTGTTTTCCCACAGGACAGTGGG - Intergenic
930036304 2:47087432-47087454 ACCTTCTCCCAAAGGGCACTTGG + Intronic
930285504 2:49422850-49422872 AAGATTTTCCAATTGGCAGTTGG - Intergenic
931224313 2:60316433-60316455 ATGTCTGCCCAAAGGACAGTTGG - Intergenic
934506677 2:94899909-94899931 AAATTATCCCAAAGCCCAGTCGG + Intergenic
934674574 2:96240603-96240625 TTGTTTTCCCAGCGGGCAGTTGG + Intergenic
936834042 2:116685077-116685099 AAGATTGCACAAAGAGCAGTGGG + Intergenic
937522229 2:122725816-122725838 AAGTTTTCCCAATTGGCAGTTGG - Intergenic
941385011 2:164841650-164841672 AACTTTTCCCGAAGAGAAGTTGG + Intronic
945506289 2:210645177-210645199 AGGTTTTCCCACAGGGCAAAAGG - Intronic
946108503 2:217393242-217393264 AAGTTTTCACACAGGGCACATGG + Intronic
1168799578 20:635519-635541 ATGTTTTCCCAAGGAGAAGTGGG - Intergenic
1171894278 20:30745302-30745324 AAATTATCCCAAAGCCCAGTGGG + Intergenic
1173545552 20:43895029-43895051 AAGTTGTCTAAAAGGGCAGGAGG + Intergenic
1173947613 20:46964229-46964251 AATTTAGCCCAAGGGGCAGTGGG + Intronic
1174245470 20:49176244-49176266 AAATTTTACCAAAAGGCATTGGG + Intronic
1175184496 20:57170858-57170880 AAGGTCTCACAAAAGGCAGTTGG + Exonic
1176191319 20:63811439-63811461 AAGTTCTTCCACAGGGCAGGAGG + Intronic
1176607571 21:8846283-8846305 AAATTATCCCAAAGCCCAGTGGG - Intergenic
1176956050 21:15105281-15105303 AAGGCTGCCCCAAGGGCAGTGGG + Intergenic
1179281007 21:39934294-39934316 AAGACTTCCTAAAGGGCAATGGG - Intergenic
1180357659 22:11856075-11856097 AAATTATCCCAAAGCCCAGTGGG - Intergenic
1180380606 22:12136258-12136280 AAATTATCCCAAAGCCCAGTGGG + Intergenic
1180633168 22:17243866-17243888 GAGTGCTCCCAAAGGGCTGTGGG - Intergenic
1181379766 22:22492479-22492501 GAGTTTTCCCACAGGACATTTGG - Intronic
1182308464 22:29388128-29388150 GAGTTTTCCCTCAGGCCAGTGGG + Intronic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
949823684 3:8141871-8141893 AAGGTTTCCCAAAACACAGTTGG - Intergenic
950868669 3:16210606-16210628 TATTTTTCCCCTAGGGCAGTGGG + Intronic
952573207 3:34742678-34742700 AAGTTTTCCAGAAGGTCTGTGGG - Intergenic
954198260 3:49008719-49008741 ACTTTATCCCTAAGGGCAGTGGG + Intronic
956456433 3:69425445-69425467 AACTTTCCCCCATGGGCAGTAGG - Intronic
956537740 3:70296886-70296908 AAGTTTACTCTAAGGGCAATGGG - Intergenic
957508934 3:81162069-81162091 AAGTTTACCTTAAAGGCAGTTGG - Intergenic
958267332 3:91454039-91454061 AGGTCTTCCCCAAGTGCAGTAGG - Intergenic
960546917 3:118926139-118926161 AACTTCTCCCAAAGGTAAGTTGG + Exonic
961943964 3:130666421-130666443 TGGTTTTCCTAAAGGGAAGTAGG + Intronic
963309928 3:143698980-143699002 ATATTTTCCCAAAGGACATTTGG - Intronic
963944720 3:151133264-151133286 AACTTTTCCCAAAGTTAAGTGGG + Intronic
965372698 3:167884168-167884190 TAGTTTTCCCAATAGGCAGTGGG - Intergenic
965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG + Intergenic
967016602 3:185487991-185488013 TTGTTGTCCAAAAGGGCAGTGGG - Exonic
969901746 4:10356350-10356372 AAGTTATCACAAAGTTCAGTTGG + Intergenic
974337911 4:60575298-60575320 AAGTAATTCCAAAGTGCAGTTGG - Intergenic
976631348 4:87240063-87240085 AAGTGTTCTCAAAGTGCTGTGGG - Intronic
977562421 4:98545857-98545879 AAGTTATTTCAAAGGGCAGAAGG + Intronic
979597544 4:122550923-122550945 AAGTTTTCACAGAGGGCAATAGG + Intergenic
981677137 4:147355229-147355251 GAGTTTTCCCATAGGACAGAGGG + Intergenic
984411570 4:179404433-179404455 AAGTTTGCCCACAGTGAAGTAGG - Intergenic
986373287 5:7102899-7102921 AAGTTATTCTAAAAGGCAGTAGG - Intergenic
987171996 5:15269024-15269046 AGTTTTTCCCAAAGGGAAGTAGG + Intergenic
987538650 5:19223810-19223832 AAGTCTTCCCAAATTGCAGAAGG + Intergenic
987608575 5:20172005-20172027 AAGCTTTGTCAAAGGTCAGTTGG + Intronic
991681984 5:69149199-69149221 AAGGCTTCCCAAAGGGCCTTGGG + Intergenic
993492013 5:88563337-88563359 AAATTTCCCTGAAGGGCAGTTGG - Intergenic
994331627 5:98513114-98513136 ATGTTTTCCCAAAGATCAGGTGG - Intergenic
995741084 5:115356329-115356351 AAGTTTTCTGAAAGGACAGTGGG + Intergenic
998521153 5:142801810-142801832 AATGTTTCCCTAAGGGCTGTGGG - Intronic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
999614500 5:153407626-153407648 ATGTTTCCTCAAAGGGCATTTGG + Intergenic
1001067834 5:168553258-168553280 AAGGTACCCCAAAGGGGAGTAGG + Exonic
1002371868 5:178761298-178761320 AAGATTTCCCGATCGGCAGTTGG + Intergenic
1003601739 6:7523937-7523959 AAGTTTTAACAAAGGGCACAGGG + Intergenic
1003951380 6:11119190-11119212 TAGTTCTCCCAAAGAGCTGTTGG + Intronic
1005778684 6:29165574-29165596 AAATCTTCCCAAAGGGTAGTGGG + Intergenic
1006583727 6:35091896-35091918 AAGTGTTCCCAGAGGGCTGGTGG + Intergenic
1007099672 6:39237214-39237236 AGGTATTCCCAAAGGGCTGCTGG - Intergenic
1007602242 6:43089796-43089818 AAGTTTTGCTAAAGGGGAGGGGG - Intronic
1008093907 6:47319214-47319236 CAGTTTACTCAAAAGGCAGTGGG + Intergenic
1011920065 6:92563113-92563135 AAGTTTAACCAAACGGAAGTGGG - Intergenic
1013431572 6:110061069-110061091 AAAAATTCCCAAAGGGGAGTGGG + Intergenic
1015709008 6:136119125-136119147 AATTTTTCTCAAGGGGGAGTTGG + Intronic
1017363491 6:153604547-153604569 AGCTTTTCCAAGAGGGCAGTAGG - Intergenic
1017419746 6:154261337-154261359 AAGTTTATCCAAAGGACAATGGG + Intronic
1018091069 6:160347694-160347716 AACTTTCCCCAGAGGGCAGCCGG - Intergenic
1021172510 7:17415018-17415040 AAGTTTTCCTATAGGGAAGGAGG - Intergenic
1021518711 7:21516838-21516860 AAGTTAACCCAAAAGGCAGACGG + Intergenic
1021688110 7:23206613-23206635 AAATCTTCCCAAAGGGTGGTGGG - Intergenic
1023907640 7:44533656-44533678 AGGAGTTCCCAGAGGGCAGTGGG - Intronic
1025030687 7:55554362-55554384 AATTTTTCCCATAGGCCAATAGG + Intronic
1028336163 7:89658725-89658747 AAGTTTTCCCAGAGGGTAGTTGG + Intergenic
1029526756 7:101099367-101099389 AAGTTTTCCCAAAGAGGAAGAGG + Intergenic
1032649661 7:133863881-133863903 CAGATTTCACAAAAGGCAGTGGG + Intronic
1035646333 8:1223740-1223762 TGGTTTTCCCTAAGGGAAGTGGG + Intergenic
1038137355 8:24802157-24802179 AAGTTTACCCAAAGGAAAGAAGG - Intergenic
1039843812 8:41311565-41311587 CAGTTTTCCCGAATGGCAGGAGG + Intergenic
1042046342 8:64656475-64656497 AGCTTTTCCCAAAAGGCAGTGGG - Intronic
1044054493 8:87551782-87551804 AAGTTGTGCTAAAGCGCAGTGGG - Intronic
1044870448 8:96614706-96614728 AAACTTTCCCAGAGGCCAGTTGG - Intergenic
1045047425 8:98293416-98293438 AAGTTTTCCCAAAGGGCCGGTGG + Intronic
1047606709 8:126481867-126481889 AAGTTTTCTGGCAGGGCAGTGGG + Intergenic
1048020574 8:130535275-130535297 ATGTTTGCCCAAAGGGAAGCTGG - Intergenic
1048080537 8:131121837-131121859 AAGTTTCCCCAGAGGAAAGTGGG - Intergenic
1048714217 8:137249704-137249726 CAGCTTTGCCAAAGGTCAGTTGG - Intergenic
1053143576 9:35697288-35697310 AAGTTTTCTCCCAGGGCAGTAGG - Exonic
1053231706 9:36416001-36416023 AAGTTTGCCCTAAGGTCACTTGG + Intronic
1053612831 9:39732557-39732579 AAGTTTTCCCAAAGCGCCTTTGG - Intergenic
1053870872 9:42490519-42490541 AAGTTTTCCCAAAGCGCCTTAGG - Intergenic
1054085423 9:60738598-60738620 AAGTTTTCCCAAAGCGCCTTTGG + Intergenic
1054240685 9:62609833-62609855 AAGTTTTCCCAAAGCGCCTTTGG + Intergenic
1054354378 9:64047472-64047494 AAATTATCCCAAAGCCCAGTGGG - Intergenic
1054554819 9:66644357-66644379 AAGTTTTCCCAAAGCGCCTTTGG + Intergenic
1055832754 9:80401538-80401560 AAGATTTCCTGAATGGCAGTTGG - Intergenic
1058349131 9:103999952-103999974 AAATCTTCCCAAAGGGTGGTGGG - Intergenic
1060488137 9:124062556-124062578 ACCCTTTCCCAGAGGGCAGTGGG - Intergenic
1061605870 9:131710373-131710395 AATTGTTCCCAAAGTGCAGTGGG - Intronic
1062104732 9:134748631-134748653 GTGTTTTCCAAAATGGCAGTTGG + Intronic
1203742713 Un_GL000218v1:16595-16617 AAATTATCCCAAAGCCCAGTGGG - Intergenic
1203702911 Un_KI270742v1:11176-11198 AAATTATCCCAAAGCCCAGTGGG - Intergenic
1203567388 Un_KI270744v1:102834-102856 AAATTATCCCAAAGCCCAGTGGG + Intergenic
1186714366 X:12234575-12234597 AAGTTGTCACAAAGTGCAGTAGG - Intronic
1187161561 X:16769861-16769883 AAATCTTTCCAAATGGCAGTCGG + Intergenic
1187220497 X:17321088-17321110 GAGTTTTCCCAAAGGACCCTGGG + Intergenic
1187225084 X:17368008-17368030 AAGTTGTCCCCAAAGTCAGTAGG + Intergenic
1190435557 X:50421245-50421267 ATCTTTTCCCAGAGGGCAGGAGG + Intronic
1191716619 X:64198074-64198096 CAGTTTTCCCAAATGGCAAATGG + Intronic
1195385064 X:104306379-104306401 AAGTGCTCCCTAATGGCAGTCGG + Intergenic
1196829323 X:119763770-119763792 AAGTTTAGCCAAAAGGTAGTTGG + Intergenic
1197104688 X:122700336-122700358 AAGTTGTGCCAAAGGCCAGGCGG + Intergenic
1197376119 X:125683757-125683779 AAGTTTTGTCAAAGATCAGTTGG - Intergenic
1201156247 Y:11134067-11134089 AAATTATCCCAAAGCCCAGTGGG - Intergenic