ID: 1127361465

View in Genome Browser
Species Human (GRCh38)
Location 15:58248200-58248222
Sequence CCCCGGATGGCAGCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127361456_1127361465 24 Left 1127361456 15:58248153-58248175 CCTGATTTAACTCCCTCCACAAA 0: 1
1: 0
2: 2
3: 16
4: 144
Right 1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG 0: 1
1: 0
2: 3
3: 35
4: 301
1127361455_1127361465 25 Left 1127361455 15:58248152-58248174 CCCTGATTTAACTCCCTCCACAA 0: 1
1: 0
2: 2
3: 18
4: 258
Right 1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG 0: 1
1: 0
2: 3
3: 35
4: 301
1127361460_1127361465 8 Left 1127361460 15:58248169-58248191 CCACAAAGCAGCACACAATGGAG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG 0: 1
1: 0
2: 3
3: 35
4: 301
1127361458_1127361465 11 Left 1127361458 15:58248166-58248188 CCTCCACAAAGCAGCACACAATG 0: 1
1: 0
2: 1
3: 14
4: 218
Right 1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG 0: 1
1: 0
2: 3
3: 35
4: 301
1127361457_1127361465 12 Left 1127361457 15:58248165-58248187 CCCTCCACAAAGCAGCACACAAT 0: 1
1: 1
2: 1
3: 25
4: 244
Right 1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG 0: 1
1: 0
2: 3
3: 35
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127361465 Original CRISPR CCCCGGATGGCAGCCAGGCC TGG Intronic
900105305 1:978574-978596 ACCCTGAAGGTAGCCAGGCCTGG + Intronic
900210878 1:1455340-1455362 CCCCGAATCACAGCCAGGACCGG - Intronic
900521387 1:3106991-3107013 GCCAGGATGGCAGCATGGCCAGG + Intronic
900608212 1:3533231-3533253 CTCTGGATGGCAGACAGGACGGG - Intronic
900613882 1:3555698-3555720 CCCCGCAGGGCTGCCAGGTCAGG + Intronic
901019638 1:6249299-6249321 CCACGGACGCCAGGCAGGCCAGG - Exonic
901045403 1:6393094-6393116 CCCCGGACGCCCGCCCGGCCGGG - Intronic
901237098 1:7672956-7672978 GCCGGGGTGGCAGCCAGGCCGGG + Intronic
901631610 1:10650907-10650929 CCCCCTATGGGAGCCAGCCCCGG - Intronic
901663584 1:10814021-10814043 CCACGGGTGCCAGCCAAGCCCGG + Intergenic
901680536 1:10910272-10910294 CCCAGGATGGCCTCCAGGCTGGG - Intergenic
902217829 1:14945554-14945576 CCCCGGCTGGCTCCCCGGCCCGG + Intronic
902271497 1:15308357-15308379 TCCCCAGTGGCAGCCAGGCCTGG + Intronic
902398127 1:16143463-16143485 CCCCGGTTGTCTGGCAGGCCTGG + Intronic
902625004 1:17671400-17671422 CCCCGGCTGCCATCCAGGCAGGG - Intronic
904603099 1:31684267-31684289 CCGGGGCTGGCACCCAGGCCAGG + Intronic
904610562 1:31723948-31723970 CCCTGGACAGCAGCCAGGGCTGG + Intergenic
904624272 1:31793361-31793383 CCCAGGGTGGCAGGCAGGGCAGG + Exonic
904678324 1:32212120-32212142 CCCAGGCTGCCAGCCAGGACTGG + Exonic
905028696 1:34867404-34867426 CCCCAGAAGGCATGCAGGCCTGG + Intronic
905306288 1:37020851-37020873 CCACGGAGAGCAGCCAGGGCCGG - Intronic
906065089 1:42974987-42975009 CCCTGGCAGGCAGCCAGGGCAGG + Intergenic
906196572 1:43933844-43933866 GCCCGGGTGGCAGCGAGGGCTGG - Exonic
906346492 1:45018734-45018756 CCTGGGATGCCGGCCAGGCCAGG + Exonic
907316824 1:53577580-53577602 CACCTGAGGGCAGCCAGGCCTGG + Intronic
908401308 1:63774671-63774693 CCCCGGAGCCCCGCCAGGCCAGG + Intronic
912429248 1:109620499-109620521 CCCAGGAAGGCAGGAAGGCCAGG - Intronic
915734343 1:158075275-158075297 GCCCGGCTGGCAGCTCGGCCGGG - Intronic
918104482 1:181404809-181404831 CCCCATCTGGCTGCCAGGCCTGG - Intergenic
918260487 1:182791054-182791076 CCCCAGATGGCAGACAGTCTAGG + Intronic
919921626 1:202169606-202169628 CCCCGGGTGGCAGCCAATCTGGG + Intergenic
920207871 1:204306268-204306290 GCTCAGATGGCAGCCAGGCCAGG + Intronic
922152006 1:223014735-223014757 CCCAGCATGGCAGCCAGACATGG + Intergenic
922221102 1:223609241-223609263 CCCCAGGGGGCAGCCGGGCCCGG + Exonic
922604878 1:226883767-226883789 TCCCGGGCGGCCGCCAGGCCTGG + Exonic
922779551 1:228240709-228240731 CCCCTCATGGCAGACATGCCTGG - Intronic
922925958 1:229346751-229346773 CCCTGGATGGGAGGCAGCCCTGG - Intergenic
923227269 1:231949625-231949647 CCCCGTAAGGCAGCCAGATCCGG - Intronic
1063162117 10:3426020-3426042 CTCAAGATGGTAGCCAGGCCAGG - Intergenic
1063298095 10:4826422-4826444 CGCCCGATGGGACCCAGGCCGGG + Intronic
1063467042 10:6253529-6253551 CCCCCGCTGGCACCCTGGCCTGG - Intergenic
1063662450 10:8043776-8043798 CCCCAGAGGGCAGACAGACCTGG + Intergenic
1066745818 10:38603801-38603823 CCCCGGCTGGCCCCCAGGTCTGG + Intergenic
1069822208 10:71235035-71235057 CCCGGCATTGCAGCCAGGCCGGG - Intronic
1069952153 10:72026473-72026495 CCCCAGAGCTCAGCCAGGCCAGG - Intergenic
1070189165 10:74095652-74095674 CCCCGGATGGCAGCCTGACCTGG - Exonic
1070606051 10:77899185-77899207 GCCTGGATGGCTGCCTGGCCTGG - Intronic
1070681428 10:78451880-78451902 CCCAGGCTAGAAGCCAGGCCTGG - Intergenic
1072964129 10:99956517-99956539 CCCAGGAAGGCAGCCTTGCCAGG - Exonic
1072983017 10:100115336-100115358 GCCCCGACGGCAGCCGGGCCGGG - Intergenic
1073083316 10:100873324-100873346 TCAGGGATGGCAGCCAGGCAGGG + Intergenic
1074434673 10:113424065-113424087 CCCACCATGGCGGCCAGGCCAGG - Intergenic
1076653139 10:132003766-132003788 TCCCAGATGGCAGCCAGGGATGG - Intergenic
1076776480 10:132700623-132700645 CCCGGCCTGGCAGCCTGGCCGGG + Intronic
1076792818 10:132785963-132785985 GCCCGGATGGGAGCCCGGGCCGG - Exonic
1076811362 10:132888267-132888289 CCCAGGATGGGAGCCAGGTGAGG - Intronic
1076887600 10:133269720-133269742 CCACGGAGGCCACCCAGGCCGGG + Intronic
1077089194 11:770775-770797 CCCTGGATGGCAGCCTGGTCTGG - Exonic
1077228466 11:1448429-1448451 GCCCTGAGGGCAGCCAGGGCAGG - Intronic
1077522221 11:3043183-3043205 GCCAGGTTGGAAGCCAGGCCTGG - Intronic
1077556118 11:3226955-3226977 TCCTGGATGGCAGCCAGGCCTGG + Intergenic
1077776119 11:5273237-5273259 CCCTGGATGCAAGCCAGGTCTGG - Intronic
1078518408 11:12044628-12044650 CCCAGGAAGGCTGCCAGGCTGGG + Intergenic
1079690050 11:23406412-23406434 CCCCGTCTAGCAGCCAGGCAGGG + Intergenic
1080384169 11:31800719-31800741 CCCCGGATACCAACCAGGGCGGG + Exonic
1081659632 11:44880078-44880100 CCCAGGATGGATGACAGGCCAGG - Intronic
1082814526 11:57499473-57499495 CCACGGAAGGCTGCCAGGCCTGG + Intronic
1082885491 11:58077864-58077886 CCCAGCATGTCAGCCAGGCATGG + Intronic
1082996641 11:59260903-59260925 CACAGGCTGGGAGCCAGGCCAGG + Intergenic
1083624405 11:64064731-64064753 CCCCAGCAGGCAGCCAGGCCTGG + Intronic
1083625959 11:64072120-64072142 CCCCGGCTGGCAGCCAGGGGTGG + Intronic
1083864123 11:65444528-65444550 CCCTCCATGGCAGCCAGGACAGG + Intergenic
1084086963 11:66859247-66859269 CCCCCTCAGGCAGCCAGGCCAGG - Intronic
1084534306 11:69747673-69747695 CCCCCAATGGCGGCCAGGCGTGG + Intergenic
1085803181 11:79610828-79610850 CTCCGCATGGCAGCCACTCCTGG - Intergenic
1089166841 11:116483915-116483937 CCCCAGACAGCAGCCATGCCGGG + Intergenic
1089770261 11:120797345-120797367 CCCAGCCAGGCAGCCAGGCCTGG + Intronic
1090447417 11:126776057-126776079 CCCCAGAGGGAAGTCAGGCCTGG + Intronic
1090473113 11:126997412-126997434 CCCTTGTTGGGAGCCAGGCCTGG + Intronic
1091603975 12:1935019-1935041 GCCCTGCTGGCAGCCAGGCCCGG + Intergenic
1091782784 12:3224523-3224545 CCCTGAACGGGAGCCAGGCCTGG - Intronic
1091986215 12:4911434-4911456 CCCAGGATGGCAGCTACCCCCGG + Exonic
1093195044 12:16120820-16120842 CCCAGGTGGGGAGCCAGGCCCGG - Intergenic
1094526367 12:31233896-31233918 CCCAGGATGACAGTCAGGCCTGG + Intergenic
1096199914 12:49674096-49674118 CCCAGGTTGGCAGCGAAGCCAGG - Intronic
1101680116 12:106956165-106956187 CCCCGCTGGGCAGCCAGGCCGGG - Intronic
1102016945 12:109654386-109654408 CCCCAGAGGGCAGCCAGGTCAGG - Intergenic
1102094335 12:110224212-110224234 TGGCGTATGGCAGCCAGGCCTGG + Intergenic
1103936838 12:124481489-124481511 CCCTGGAGGGCAGCCAGGGCTGG + Intronic
1105034241 12:132907448-132907470 CGGCGGGTGGCAGCCAGGACGGG - Intronic
1107710490 13:43146015-43146037 CCTCATAAGGCAGCCAGGCCTGG - Intergenic
1111371803 13:87328876-87328898 CCCCCGAAGGCAGCCCAGCCTGG + Intergenic
1112543174 13:100337229-100337251 CCCCTCATGGCAGCCAGGCAGGG + Intronic
1113454336 13:110437370-110437392 CCCCGGATCCCACCCTGGCCTGG - Intronic
1113484604 13:110645115-110645137 GCACTGAAGGCAGCCAGGCCGGG - Intronic
1118316197 14:64727654-64727676 ACCAGGATGGCAGCCAGGAGCGG + Exonic
1119715033 14:76853116-76853138 CCCCTGTTGGCATCCAGACCGGG - Intronic
1119805911 14:77482352-77482374 CCCCGGGGGCCAGCCAGCCCTGG + Exonic
1121776342 14:96593340-96593362 CCCTGGATGCCAGCCAGAGCTGG + Intergenic
1121803993 14:96798039-96798061 CTGAGGATAGCAGCCAGGCCTGG + Intronic
1122975362 14:105168661-105168683 CGCCGGGTGGGAGCCGGGCCGGG - Exonic
1123122464 14:105923744-105923766 CCCAGGAGGGCACCCAGGCCTGG - Intronic
1123405110 15:20015168-20015190 CCCAGGAGGGCACCCAGGCCTGG - Intergenic
1123514441 15:21021816-21021838 CCCAGGAGGGCACCCAGGCCTGG - Intergenic
1125535927 15:40441202-40441224 CGCCGGATTCCAGCCCGGCCGGG + Exonic
1125577225 15:40764147-40764169 CCCCCGGTGGGAGCCAGGCCGGG + Exonic
1125609518 15:40961034-40961056 CCCGGGTTGGCAGCCAGGGAAGG + Intergenic
1126163541 15:45635002-45635024 GCCCGGATGGCAGGCGGGCGGGG + Exonic
1127361465 15:58248200-58248222 CCCCGGATGGCAGCCAGGCCTGG + Intronic
1127417070 15:58768651-58768673 CCCAGGACTGCAGGCAGGCCTGG - Intergenic
1129393873 15:75234022-75234044 CCCCGGGTGGCAGGCAGAACAGG - Intergenic
1129972026 15:79787238-79787260 CCCCAAATGGCAGCCTGTCCCGG + Intergenic
1132544767 16:528049-528071 CCCCGGCTGGGCGCCCGGCCGGG - Intronic
1132727378 16:1344867-1344889 CCCCGGGTGCCTGCCAGGCATGG + Intronic
1132883157 16:2171159-2171181 CCTCAGAGGACAGCCAGGCCTGG + Intronic
1132983537 16:2751949-2751971 TCCGGTAGGGCAGCCAGGCCGGG - Intergenic
1133002316 16:2857582-2857604 CCCCGGAAGGCAGGCTGGACGGG - Intronic
1133017170 16:2949400-2949422 CCCGAGATGGGAGCCAGTCCAGG + Exonic
1133206505 16:4237347-4237369 CCCAGCTTGGGAGCCAGGCCAGG - Intronic
1133237165 16:4392724-4392746 CCGCTGCTGGCAGCCAGGGCCGG - Intronic
1136028441 16:27485233-27485255 CTCCGGGTCTCAGCCAGGCCAGG - Intronic
1136618734 16:31413869-31413891 TCCGGGATGGCAGCCTGGCCAGG + Intronic
1136737248 16:32475846-32475868 CCCCGGCTGGCCCCCAGGTCTGG - Intergenic
1137732580 16:50699582-50699604 CCCAGGACAGCAGCCAGTCCAGG - Exonic
1138086853 16:54141315-54141337 CCCAGGATGGGTGCCTGGCCTGG - Intergenic
1139825037 16:69750293-69750315 CACTGGATGTCAGCCAGGCTCGG - Intronic
1141181115 16:81754003-81754025 CCTGTGATGGCGGCCAGGCCAGG - Intronic
1142147866 16:88499984-88500006 GCACGGCAGGCAGCCAGGCCCGG - Intronic
1203015822 16_KI270728v1_random:353731-353753 CCCCGGCTGGCCCCCAGGTCTGG + Intergenic
1203034157 16_KI270728v1_random:626889-626911 CCCCGGCTGGCCCCCAGGTCTGG + Intergenic
1143503636 17:7352362-7352384 CCCGCGCCGGCAGCCAGGCCAGG + Exonic
1143753733 17:9051111-9051133 CTCGGGAAGGCAGCCTGGCCTGG + Intronic
1144498932 17:15768987-15769009 CCCGGGGTGCCGGCCAGGCCAGG + Intergenic
1144626838 17:16848173-16848195 CCAGGGATGCCAGCCAGCCCAGG + Intergenic
1144850547 17:18241978-18242000 CCCGCGATGCCACCCAGGCCAGG + Exonic
1144879600 17:18424539-18424561 CCAGGGATGCCAGCCAGCCCAGG - Intergenic
1145152640 17:20519848-20519870 CCAGGGATGCCAGCCAGCCCAGG + Intergenic
1145162313 17:20584022-20584044 CCCGGGGTGCCGGCCAGGCCAGG + Intergenic
1146163977 17:30574012-30574034 CCAGGGATGCCAGCCAGCCCAGG + Intergenic
1147326733 17:39673250-39673272 CCCCCACTGGCACCCAGGCCTGG - Exonic
1147580981 17:41626866-41626888 CCAGGGATGCCAGCCAGCCCAGG + Intergenic
1147686496 17:42289295-42289317 CCCTGGACCGCGGCCAGGCCAGG - Intronic
1147891501 17:43720669-43720691 CTACGGCTGGCAGCCTGGCCTGG + Intergenic
1147895647 17:43749672-43749694 GCCCTGAAGGCGGCCAGGCCAGG - Intergenic
1148031965 17:44627933-44627955 GCCCAGAAGGCAGGCAGGCCGGG + Intergenic
1148080255 17:44964036-44964058 CCCCTGATGGCACCAAGTCCTGG - Intronic
1148131433 17:45264678-45264700 CCCCTGATGGCAGCTTCGCCTGG - Exonic
1148489352 17:48013145-48013167 CCCCGGCTGGCAGCCTTGCAAGG + Intergenic
1148770275 17:50062472-50062494 GCCAGGGTGGCAGCCAGGCCTGG - Intronic
1148921242 17:51036662-51036684 TGCAGGATGGCAGCCAGGCTTGG - Intronic
1150249745 17:63699207-63699229 CCCCGGACAGGAGCCTGGCCTGG - Intronic
1152299171 17:79485329-79485351 CCCAGCCTGGCAGCCAGTCCAGG + Intronic
1152610764 17:81314113-81314135 CCCCAGAGGGAACCCAGGCCCGG + Intronic
1152718491 17:81911211-81911233 CCCCGGAAGGAAGCCGGCCCCGG + Intronic
1153225081 18:2893836-2893858 GCCAGGATGGAAACCAGGCCAGG + Intronic
1153523002 18:5969424-5969446 GCCCGGATGTCAGCCACGCCTGG + Exonic
1157293388 18:46425389-46425411 CCCCGGGTGGGTGGCAGGCCAGG + Intronic
1157586115 18:48802341-48802363 GGCAGGATGGCAGCCAGGCAGGG + Intronic
1157816959 18:50736492-50736514 CCCCAGCTGGCAGCCATGACTGG - Intergenic
1158505467 18:58043699-58043721 CCTCGGCTGGCAGCCGGGCCGGG + Intergenic
1160394654 18:78562923-78562945 GCCCGCATGGCAGCCCGGCAAGG + Intergenic
1160779394 19:871146-871168 CGCTGGCTGGCAGCCAGTCCAGG + Exonic
1160993133 19:1869080-1869102 CCCTGGATGGGGGCCGGGCCAGG + Intergenic
1161072229 19:2268378-2268400 GCCTGGGTGACAGCCAGGCCCGG + Intronic
1161457596 19:4377306-4377328 TCCCTGCTGGCAGCCAGGCAGGG - Intronic
1162184225 19:8892142-8892164 TCCCGGCTGCCAGCCAGCCCAGG + Intronic
1162805431 19:13135832-13135854 GGCCGGTTGGCAGCCAGGTCCGG - Exonic
1163134149 19:15297226-15297248 CATAGCATGGCAGCCAGGCCTGG + Intronic
1163152320 19:15422748-15422770 CCCCGTCTAGCAGCCAGGCAGGG - Exonic
1163548666 19:17953116-17953138 CCCCGGAAGAGAGCGAGGCCGGG - Intronic
1166364705 19:42272609-42272631 TCCCGGTAGGCAGCCACGCCGGG - Intronic
1167272224 19:48511880-48511902 CCCCCGAGGGCAGCCAGGATTGG + Intronic
1167304805 19:48701583-48701605 GCCAGGAGGGCAGGCAGGCCAGG + Intronic
1167557167 19:50203680-50203702 CCCCGGAGGGCTGCCGGCCCCGG - Intronic
1167690193 19:50980327-50980349 CCATGGATGACAGCCTGGCCTGG + Exonic
1167889389 19:52527630-52527652 CGCAGGACGGAAGCCAGGCCTGG - Intronic
1167890503 19:52535974-52535996 CCCAGGACTGAAGCCAGGCCTGG - Intronic
1167921553 19:52786783-52786805 CCCAGGACTGAAGCCAGGCCGGG + Intronic
1168323658 19:55525901-55525923 CCCCGGCAGGCAGGCAGGCAGGG - Intergenic
925128476 2:1477840-1477862 CCCCGGAGGGCCGCCAGCTCCGG - Intronic
925884184 2:8380298-8380320 CTCAGGATAGCAGCCATGCCTGG + Intergenic
926043268 2:9691632-9691654 CTCCCAGTGGCAGCCAGGCCTGG - Intergenic
927542467 2:23926046-23926068 CTCCAGTTGGCAGCCAGGCAGGG - Intronic
927645322 2:24873602-24873624 CCCTGCCTGGCGGCCAGGCCTGG + Intronic
927809700 2:26174076-26174098 CCGGGGCTGGCAGCCAGGCCGGG + Intronic
930712110 2:54558912-54558934 CCCCCGTTGGCACCCAGGACAGG - Intronic
932402311 2:71489502-71489524 GCCCAGATGGCACCAAGGCCAGG - Intronic
932446971 2:71787260-71787282 CCCATTGTGGCAGCCAGGCCTGG + Intergenic
932635571 2:73385581-73385603 CCCCGGAAGGCGCCCAGTCCCGG + Intergenic
934321440 2:91974984-91975006 CCGGCGGTGGCAGCCAGGCCAGG + Intergenic
934556443 2:95289304-95289326 CCCAGGCTGGCATCCAGGCCTGG + Exonic
935217062 2:100982741-100982763 CTCCTGATGGCAGCCTGGGCTGG - Intronic
937093811 2:119223496-119223518 CCACGGAGGGCACCGAGGCCAGG - Intergenic
937099419 2:119257358-119257380 CCACGGATGGGAGGCAGGCCTGG - Intronic
937932977 2:127219953-127219975 CCCCGGGAGGGAGCCAGCCCGGG - Intronic
940612367 2:156007055-156007077 CCCAGGCTGGCATCCAGGGCAGG + Intergenic
941747915 2:169106753-169106775 CCCAAGATGGAAGCCTGGCCTGG + Intergenic
942459056 2:176157163-176157185 CCCCGGCTGCCAGCGAGCCCCGG - Intronic
942459724 2:176160528-176160550 TCCCGGAGCGCAGCCAAGCCTGG - Intronic
946164893 2:217857916-217857938 CCCAGGCTGGCACCCTGGCCTGG - Intronic
946308829 2:218871662-218871684 CCCCGGAAGGCAGCGCCGCCTGG + Exonic
946378208 2:219327085-219327107 CCCCTCATGCCAGACAGGCCTGG - Intergenic
946600572 2:221355790-221355812 CCCCGGAAAGCAGCCTGCCCTGG + Intergenic
948772022 2:240256344-240256366 CCCCTGAGTGCAGCCATGCCAGG - Intergenic
948829908 2:240593667-240593689 ACCCGGATGGCAGCCGAGTCAGG + Intronic
948993153 2:241564701-241564723 CCCCGGAAGGAAGCCAGGGGTGG + Intronic
1168868420 20:1108576-1108598 CCACAGATGGCAGCCACGCAGGG - Intergenic
1168956580 20:1838575-1838597 CACCTGTTGGCAGCCAGGCCAGG - Intergenic
1169120841 20:3094782-3094804 CCCTGAATTTCAGCCAGGCCTGG - Intergenic
1169329959 20:4708599-4708621 CCCCTGAAGGCAGACCGGCCAGG - Intergenic
1170347644 20:15404730-15404752 CCCAGGAGGACAGCAAGGCCTGG - Intronic
1171006074 20:21467046-21467068 CCACAGAGGGCACCCAGGCCTGG - Intergenic
1171795364 20:29561930-29561952 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1171853088 20:30322335-30322357 GCCCAGATGGCAGGCAAGCCTGG + Intergenic
1173460068 20:43236065-43236087 CCCAGGATGGCAGGCAGAGCAGG + Intergenic
1173643947 20:44622127-44622149 TCCAGGATGGGAGCCAGGCAGGG + Intronic
1174417480 20:50377044-50377066 CACCTGATGTCAGCAAGGCCTGG + Intergenic
1174503792 20:51004002-51004024 CCACAGATGGCAGGCAGGGCAGG + Exonic
1175248548 20:57595696-57595718 CCCCGAGTGGCAGCCAGGCCTGG - Intergenic
1175989120 20:62778811-62778833 CACCGGAAGCCAGCAAGGCCGGG - Intergenic
1176089241 20:63311707-63311729 GCCCTGAGGGCAGCGAGGCCCGG + Exonic
1176122159 20:63458786-63458808 CCCAGGCTGGCAGCTAGGCCTGG + Intronic
1176189834 20:63803152-63803174 CCCAGGATGCCATCCAGGCAGGG + Intronic
1179781203 21:43702183-43702205 GGCGGGAGGGCAGCCAGGCCTGG + Intergenic
1179842582 21:44087032-44087054 AGCAGGATGGCAGCAAGGCCAGG - Intronic
1180535305 22:16390073-16390095 CCCCGGCTGGCCCCCAGGTCTGG + Intergenic
1180733654 22:18000679-18000701 CCTCGGAAGGCAGCCAGGGAAGG + Intronic
1180877825 22:19183249-19183271 CTCCTGAAGGCAGCCAGGGCTGG + Intronic
1180910718 22:19447970-19447992 CCCAGGATGCCCGCCTGGCCCGG - Exonic
1183271059 22:36862880-36862902 CCTTGGAGGGCAGCCAGGGCAGG - Intronic
1183457917 22:37932751-37932773 CCAGGCATGGCAGCCAGCCCTGG + Intronic
1183546644 22:38457726-38457748 CCCAGGATGGCTACCAGGTCAGG - Intergenic
1184038398 22:41929171-41929193 CCCTGGAGGGGAGCCAGGGCAGG + Intergenic
1184118664 22:42436581-42436603 CCCGGGCTGGAAGCCTGGCCTGG + Intergenic
1184776529 22:46626235-46626257 ACCAGGACGGCAGCCACGCCTGG - Intronic
1184861842 22:47176792-47176814 CCCAGGAAGGCAGCCCTGCCTGG - Intergenic
1185117523 22:48946103-48946125 CACCTCATGGCAGCCAGGTCTGG - Intergenic
1185373187 22:50470189-50470211 CCCTGGGTGCCAGCCAGGGCTGG - Intronic
950113987 3:10438709-10438731 TCTCGGATGACAGGCAGGCCTGG + Intronic
952301249 3:32106478-32106500 CCCCGGCCGGCCTCCAGGCCCGG - Intronic
952342885 3:32460042-32460064 GCCCAGAAGACAGCCAGGCCTGG - Intronic
952816908 3:37453593-37453615 GCCCAGGTGACAGCCAGGCCGGG + Intronic
954763955 3:52897490-52897512 CGCCGGCAGGCAGCGAGGCCGGG - Exonic
960517524 3:118618472-118618494 CACAGGATGGGAGCCAGCCCTGG + Intergenic
961446336 3:126983336-126983358 CCCCGGACCCCAGCCCGGCCCGG - Intergenic
961455370 3:127021214-127021236 CCCCGTGTGGCAGCAAGCCCAGG - Intronic
961724222 3:128915440-128915462 CCCTGGCTGTGAGCCAGGCCTGG + Exonic
962960734 3:140309223-140309245 CCTCGGATGCCAGGTAGGCCAGG - Intronic
963888878 3:150611732-150611754 CCCCTGGGGGCGGCCAGGCCGGG - Intronic
964590866 3:158360973-158360995 CCCAGGCTGGCAACCAGGGCAGG + Intronic
967359637 3:188614880-188614902 CCCTGCCTGGCACCCAGGCCTGG + Intronic
967805532 3:193711655-193711677 CTCCAGCTGACAGCCAGGCCGGG + Intergenic
967910348 3:194537519-194537541 CCAGGGCTGGCAGCCAGTCCTGG - Intergenic
968746709 4:2364229-2364251 CCCTGGTCTGCAGCCAGGCCGGG - Intronic
969288364 4:6222316-6222338 CGCCGGGAGGCGGCCAGGCCGGG - Intergenic
970394951 4:15655879-15655901 CGCTGGGTGGGAGCCAGGCCCGG - Intronic
972072444 4:35038487-35038509 CCCCGGCTGGCGTCCAGGGCAGG - Intergenic
985574916 5:669564-669586 ACCAGGCTGGCAGTCAGGCCTGG - Intronic
985724864 5:1510818-1510840 ACCTGGAGGGCAGGCAGGCCTGG + Intronic
990553718 5:56909631-56909653 CCCCGCGGGGCAGCCATGCCTGG + Exonic
993903321 5:93598573-93598595 CCCCGGCTGGCAGGCGAGCCAGG + Intergenic
997234954 5:132267411-132267433 CCAGGGATGCCAGCCAGGCAGGG - Intronic
998157740 5:139796010-139796032 TCCCCGCTGGCGGCCAGGCCGGG + Intronic
998817529 5:146029269-146029291 GCCCGGAAGACAGCCAGACCTGG - Intronic
999205741 5:149846712-149846734 ACCCGGCTGGGTGCCAGGCCAGG + Intronic
1000341575 5:160280875-160280897 CCCAGGATGGCAGCCCCGCCTGG + Intronic
1000356388 5:160400027-160400049 ACCCGGATGGAACCCGGGCCTGG - Exonic
1000385678 5:160672631-160672653 CCTCTGAAGGCAGCCAGACCGGG + Intronic
1000867120 5:166527374-166527396 CCCCAGATGCCAGCCAGACATGG + Intergenic
1001298802 5:170518715-170518737 CCCCGGATGTCAGCTTGGCCTGG + Intronic
1001688711 5:173616295-173616317 CGCCGGGAGGCAGCGAGGCCGGG + Exonic
1002670467 5:180861790-180861812 CCCCGGGTGGGAGCGTGGCCCGG - Intergenic
1006505596 6:34486682-34486704 CCCCGGAAGGCAGCCCTGCAGGG - Intronic
1007406051 6:41637092-41637114 CCGCGGCTAGCAGCCCGGCCTGG + Intronic
1007428786 6:41764384-41764406 ACCCAGAGGGCAACCAGGCCAGG + Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007713343 6:43838628-43838650 CCCAGGCTGGAACCCAGGCCAGG + Intergenic
1007735943 6:43982227-43982249 CCATGCAGGGCAGCCAGGCCTGG - Intergenic
1010336452 6:74690038-74690060 CCACGTTTGGCAGCCAGGACTGG + Intergenic
1013459049 6:110358107-110358129 GCCCAGGTGGCCGCCAGGCCGGG + Exonic
1015389190 6:132662130-132662152 CCCCTCAGGGCAGCCAGGACAGG + Intergenic
1015398746 6:132764576-132764598 CTCTGGGTGGCAGCCAGGCATGG + Intergenic
1016739048 6:147509043-147509065 ACCCCGATGGCATCCAGGTCCGG - Exonic
1016836142 6:148478835-148478857 CACCAGCTGGCAGCTAGGCCAGG - Intronic
1017085881 6:150712292-150712314 ACCTGGAAGGCAGCCAGGCAGGG + Intronic
1017951238 6:159137015-159137037 CCCCGGCTGGCTGACTGGCCTGG + Intergenic
1019457610 7:1138533-1138555 CCCGGGACGCCAGCCCGGCCGGG - Intergenic
1019687201 7:2388470-2388492 CCCTGGATGGACCCCAGGCCTGG - Intergenic
1019996536 7:4728095-4728117 CCCTGGATGGCAGCCGGGACCGG + Intronic
1020116254 7:5478110-5478132 CCCAGGACGGCAGCCAGGACGGG - Intronic
1021015498 7:15526164-15526186 ACCCGGGTGGGAGCAAGGCCTGG + Intronic
1022174554 7:27860940-27860962 CCCAGGATGGCAGCCATGCAGGG - Intronic
1022981165 7:35606115-35606137 CCTGGGGTGGCAGACAGGCCAGG + Intergenic
1023181092 7:37484624-37484646 TCCCGGATGGCAGCCAGCCTGGG - Intergenic
1023983575 7:45082826-45082848 GCCCTGAGGTCAGCCAGGCCCGG - Exonic
1024874722 7:54008941-54008963 CCCTGGCTGGCATCCAAGCCAGG + Intergenic
1025234776 7:57227298-57227320 CACCAGATCGCAGCCCGGCCTGG - Intergenic
1026773504 7:73216854-73216876 CCCAGCATGGTAGCCAGGCATGG - Intergenic
1027073670 7:75175783-75175805 CCCAGCATGGTAGCCAGGCATGG + Intergenic
1029148616 7:98464594-98464616 TGCCGGAAGGCAGCCTGGCCTGG + Intergenic
1029276510 7:99408400-99408422 CACCGGCTGAGAGCCAGGCCTGG - Intronic
1029339310 7:99930025-99930047 CAGCTGATGGCTGCCAGGCCTGG + Intergenic
1029365340 7:100112860-100112882 CCCCTGAAGTCAGCCAAGCCAGG - Exonic
1030060633 7:105618228-105618250 CCCAAGACGGCAGCCAGCCCTGG - Intronic
1032087496 7:128891576-128891598 CCCCGGAAGGCAGCACGCCCTGG - Intronic
1032217828 7:129971028-129971050 CCTCGGAGGGCAGCCAAGGCTGG + Intergenic
1032486290 7:132289984-132290006 CCCAGGATAGCAGCCTTGCCTGG - Intronic
1034285393 7:149880368-149880390 CCCCAGCTGGGAGCCAGGCAAGG - Exonic
1035279364 7:157767626-157767648 CCACGGAAGGCAGACTGGCCTGG - Intronic
1035360657 7:158311177-158311199 CCCCGGATGCCATCCCAGCCAGG + Intronic
1035746189 8:1963421-1963443 CCCCGGATGGCACCAGGGCACGG - Intergenic
1036701533 8:11016536-11016558 TTCCGGGTGGCAGCCAGGCAGGG - Intronic
1036756248 8:11473112-11473134 CCCCTTATGGAAGCCAGGACAGG + Intronic
1038331035 8:26609694-26609716 CCCCAGAGTGCAGCCTGGCCAGG + Intronic
1039542275 8:38382116-38382138 CTGCGGCTGGCAGCCCGGCCTGG + Exonic
1043523543 8:81072375-81072397 CCCCAAATGTCAGCAAGGCCAGG - Intronic
1047760365 8:127949853-127949875 CCCTGAATGGGGGCCAGGCCAGG + Intergenic
1048037824 8:130693809-130693831 CCCCTGCTGACTGCCAGGCCGGG - Intergenic
1048469552 8:134695198-134695220 CCCCGGGAGGCACCCCGGCCAGG + Intronic
1049189622 8:141279656-141279678 CCAGGGAGGGCAGCCTGGCCAGG - Intronic
1052867035 9:33470161-33470183 CCCCAGCTGGGAGCCATGCCTGG + Exonic
1052902644 9:33807328-33807350 CCCAGGCTCACAGCCAGGCCTGG + Intergenic
1053163601 9:35829585-35829607 GCCGGGATGGGGGCCAGGCCAGG - Exonic
1053487940 9:38474557-38474579 CCCAGGCTCACAGCCAGGCCTGG - Intergenic
1053790886 9:41685634-41685656 GCCCAGATGGCAGGCAAGCCTGG + Intergenic
1054154268 9:61629138-61629160 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1054179233 9:61897328-61897350 GCCCAGATGGCAGGCAAGCCTGG + Intergenic
1054474053 9:65560258-65560280 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1054658305 9:67683493-67683515 GCCCAGATGGCAGGCAAGCCTGG - Intergenic
1057047708 9:91898812-91898834 CACATGATGGCAGGCAGGCCCGG + Intronic
1058005132 9:99906570-99906592 CCCCGCAGGGCCCCCAGGCCGGG - Intergenic
1061443999 9:130627271-130627293 CCCCCGCTGGCAGCGAGGCCTGG - Intronic
1061562478 9:131414858-131414880 CCCGAGATAGCAGCCAGGCACGG - Intronic
1062266603 9:135689442-135689464 GCCCAGCTGGCAGCCGGGCCAGG - Intergenic
1062424081 9:136498075-136498097 CCCCAGAGGGCATCAAGGCCTGG - Intronic
1062488490 9:136792680-136792702 CCCCGCATTGGACCCAGGCCTGG + Intronic
1062491289 9:136806289-136806311 CCCCGGGCTGCAGCCAGGCTGGG + Intronic
1062544410 9:137055110-137055132 CCCCGCATCCCAGCCCGGCCAGG + Intergenic
1192308576 X:69989155-69989177 CCCCTGATGCCAGCAGGGCCTGG + Intronic
1200116789 X:153773023-153773045 CACCCGACGGCAGCCAGGCCGGG - Intronic