ID: 1127372184

View in Genome Browser
Species Human (GRCh38)
Location 15:58351812-58351834
Sequence GCCAGGGAAATGCTTATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127372184 Original CRISPR GCCAGGGAAATGCTTATGAT AGG (reversed) Intronic
901132770 1:6972647-6972669 GCCAGGGAAGTGCTGATTAGAGG + Intronic
901428077 1:9196163-9196185 GCCTGGGGAATGCTACTGATTGG - Intergenic
904330421 1:29754817-29754839 GTCAGGGAAATGCTTGTGAGGGG + Intergenic
905168000 1:36094393-36094415 TGCAGGGAAAGGCTTTTGATTGG - Intergenic
910235926 1:85036563-85036585 GCCATGGAAGGGCTTTTGATAGG - Intronic
913166968 1:116197122-116197144 GCCAGGTAAATGATCAAGATAGG - Intergenic
916487890 1:165275579-165275601 GCCAAGGAACTGGATATGATGGG - Intronic
916854786 1:168738256-168738278 CCAAGGGAAATGCTTCTGCTAGG + Intergenic
917733619 1:177900719-177900741 GCCAGGGGAAGTCTTATGATGGG - Intergenic
918174691 1:182032751-182032773 GCCCGGGATATGCCTTTGATAGG - Intergenic
921377562 1:214490278-214490300 CCCAGGGAAATGCTTATTTTGGG - Intronic
1071237787 10:83669290-83669312 GTCAGGGATATTCTTAGGATAGG + Intergenic
1073615348 10:104989686-104989708 ACCAGGGAAATGCTGCAGATGGG + Intronic
1074246603 10:111700020-111700042 GATAGGGAAATGCTTATGGTAGG + Intergenic
1074707749 10:116150434-116150456 GTCATGGAAATGCTTCTGAGGGG + Intronic
1080215531 11:29835840-29835862 GCCAGAGATACTCTTATGATAGG - Intergenic
1081409532 11:42740169-42740191 GGCAAGGAAATGCCTATGAGGGG - Intergenic
1081641282 11:44756036-44756058 ACCAGGGAAAGGCTTATCACTGG + Intronic
1085157865 11:74312367-74312389 GCCTGGGAAATGCATAAGAGGGG - Intergenic
1085776701 11:79372994-79373016 GACAACGAAATGCTTAGGATAGG + Intronic
1088217127 11:107523470-107523492 GCCGGGGAGATGCTAATGAAAGG + Intronic
1090157957 11:124461344-124461366 GCCAGGGAACTGGTTATGGCGGG - Intergenic
1090984124 11:131750825-131750847 GCCTGGGAAGCGCTTAGGATTGG - Intronic
1096091925 12:48907921-48907943 GCCAGGGTAATGTGTAAGATTGG - Intronic
1096821553 12:54239725-54239747 GCCAGGAAAATCCTTCTGAATGG - Exonic
1097958418 12:65509845-65509867 TCCAGGAAAATGCTTTTGTTTGG + Intergenic
1099335193 12:81347546-81347568 GCCAGGGAAATGGATCGGATGGG - Exonic
1104368341 12:128198464-128198486 GAAAGGAAAATGCTTATGAATGG - Intergenic
1105830556 13:24160541-24160563 GCCGGGGAACTGTTTTTGATGGG + Intronic
1105938727 13:25128128-25128150 TCCAGGGAACTGTTTAGGATTGG + Intergenic
1106649462 13:31674276-31674298 GCCACTGAAATGCTTCTGACTGG + Intergenic
1107598888 13:41992357-41992379 GCCAGAGAAATGCTCAGGATTGG - Intergenic
1112552384 13:100433796-100433818 GCCATGGACACCCTTATGATGGG - Intronic
1114709091 14:24759978-24760000 GAAAGGGAAATTCTTTTGATTGG + Intergenic
1118141964 14:63093596-63093618 GCCAGAGAATTGCTTAGCATGGG + Intronic
1124009707 15:25828695-25828717 TACATGGAAATGCTTATGACTGG - Intronic
1124209211 15:27748273-27748295 GGCTGGGAAATGCTCATGGTCGG + Intergenic
1126180736 15:45782700-45782722 GACAGGGAAACCCTAATGATGGG + Intergenic
1127372184 15:58351812-58351834 GCCAGGGAAATGCTTATGATAGG - Intronic
1127389989 15:58497647-58497669 GCCTGGGAAAGGCATATCATGGG - Intronic
1131825002 15:96313521-96313543 AATAGGGAAATGGTTATGATAGG + Intergenic
1133296109 16:4753103-4753125 GCAAGGGAAATCCTTCTAATAGG + Intronic
1134836703 16:17367418-17367440 GCCTGGGAAAAGCTAATTATCGG - Intronic
1135984825 16:27176410-27176432 GCCAGGGATGTGCTTGTGAATGG + Intergenic
1138337055 16:56261536-56261558 GCCTGGAAAATGCTTTTCATAGG - Intronic
1141055764 16:80812367-80812389 CCCAGGCAGATGCTTATGAGTGG - Intergenic
1141120992 16:81356069-81356091 GCAAGGGAGATGCTTAAGGTTGG + Intronic
1151473558 17:74332558-74332580 AGCAGGTAAATGCTAATGATGGG - Intronic
1155700247 18:28734398-28734420 GCCAGGTAATTGCTGCTGATTGG - Intergenic
1156786206 18:40918327-40918349 GACAGTGAGATCCTTATGATAGG + Intergenic
1159026468 18:63187015-63187037 AACAGGGAAATGCTTAAGGTTGG - Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1168568001 19:57440609-57440631 GCCATGGAAATGCTCCTGGTTGG + Intronic
928310850 2:30208526-30208548 GTCAGGGTAATGCTCATGAGTGG + Intergenic
935538437 2:104321752-104321774 GACAGGGAAATGTTTATTTTGGG + Intergenic
940556207 2:155232044-155232066 GACAGGCAAGTGCTTATGAAGGG - Intergenic
940653527 2:156461065-156461087 GCCAGGGACCTGCTAGTGATAGG - Intronic
942051629 2:172146170-172146192 GACATGGAAATGCTTTTGATGGG + Intergenic
943121297 2:183739418-183739440 ACCAGGGAAAAGCTTCAGATTGG - Intergenic
946014634 2:216594072-216594094 TCCAGGGAGATGCTTCTGAGGGG - Intergenic
946229218 2:218281452-218281474 GGCAGGGACATGCTTGTGTTTGG - Intronic
946457315 2:219837928-219837950 GGCGGGGGAATGCTTATGACAGG - Intergenic
946785206 2:223236289-223236311 GGCAGGGAACAGCTGATGATGGG - Intergenic
1179318744 21:40270092-40270114 GGAAGGGAAATGCATATGTTTGG + Intronic
1180597622 22:16989028-16989050 GGCAAGGAAGTGCCTATGATGGG - Intronic
1183488050 22:38100154-38100176 GCCAGGTAGATGCTTCTGAGGGG + Intronic
1184425458 22:44406678-44406700 GCCGGGGAATTGCCTTTGATGGG + Intergenic
950719308 3:14871206-14871228 GCCAGGGAAAGGCAAACGATGGG - Intronic
950794902 3:15502887-15502909 GCCTGGGAAATGCTGAGCATGGG - Intronic
952871094 3:37902145-37902167 GCCAGGGAAAAGCTTTAGGTGGG + Intronic
953567752 3:44047695-44047717 GCCAGGGAACTGCTCATGGTGGG - Intergenic
959587094 3:108034762-108034784 GCCATGGAAATGCTACTGCTAGG - Intergenic
960717192 3:120587507-120587529 CCCAGGGAAAAGATGATGATAGG + Intergenic
966223607 3:177574523-177574545 GGGAGGGAAATACTGATGATAGG - Intergenic
969286050 4:6202463-6202485 GCCAAGGAAATGCCAAAGATGGG + Intergenic
969845413 4:9916656-9916678 CCCAGGGAAGTGACTATGATTGG + Intronic
973583658 4:52370226-52370248 GCCAGGGAAAAGCATGTGACAGG + Intergenic
974108842 4:57502549-57502571 GGGAGGGAAATGCTTTTGAGAGG + Intergenic
977873716 4:102124362-102124384 CCCAGGGAAATAATTATTATAGG + Intergenic
981238791 4:142449958-142449980 GCCTGGGAAGTGCTGATGGTAGG - Intronic
982665163 4:158252368-158252390 CCCAGGGAAAAGATGATGATGGG - Intronic
983109756 4:163735029-163735051 ACCAGGAACATGCTTATGTTCGG - Intronic
984440634 4:179765252-179765274 GACAGGAAAATTCTCATGATGGG - Intergenic
984816460 4:183841837-183841859 GTAAGGTAAATGCTTATGGTGGG + Intergenic
986274967 5:6265757-6265779 GTCAGGGAAATGCCTGTGAAGGG - Intergenic
986534954 5:8777195-8777217 GCAAGGGAAATGCTTCAGCTGGG + Intergenic
990995368 5:61727846-61727868 ACAAGGGAAATGGTTATGCTTGG - Intronic
992256478 5:74926175-74926197 CCTAGGGAAATGCTTATAGTAGG - Intergenic
998472448 5:142393695-142393717 GCCAGGGCTATTCTTATGATGGG - Intergenic
998834236 5:146188765-146188787 GCCAGGGAAGAGATTATTATGGG - Intergenic
999205533 5:149845334-149845356 TCCAGGGAAATGGGAATGATAGG + Intronic
1000950802 5:167480188-167480210 GCCAGGGAAAGCCTTAGGCTGGG - Intronic
1002548482 5:179969162-179969184 GCCAGGGTTATGCTTTTTATTGG - Intronic
1002570054 5:180135056-180135078 GCCAGGGAACAGTTGATGATTGG - Intronic
1005753871 6:28908361-28908383 GCCAGGGACATGGTTAGGAGCGG - Intronic
1007562446 6:42821277-42821299 GCCAGTGAAATGACTATGCTTGG - Intronic
1012024324 6:93969038-93969060 GCCAAGGAAGAGCTTATGAAAGG + Intergenic
1012589523 6:100963026-100963048 GACAGGGAACTGATTAGGATTGG - Intergenic
1015223354 6:130829562-130829584 GGCAGGGAAGTGCTGAAGATAGG - Intronic
1017433734 6:154396155-154396177 GCCAGGGAAAAGTTAATGGTGGG - Exonic
1020093828 7:5356674-5356696 GCCAGGCAGGTGCTTGTGATTGG - Intronic
1020703921 7:11518294-11518316 GCAAGGGGAAAGCTTTTGATTGG + Intronic
1024617351 7:51126989-51127011 ACCAGGCATATGCTTATGACTGG + Intronic
1033763523 7:144462713-144462735 GCCAGGAAAATGCTGCTGCTTGG + Intronic
1035985356 8:4424725-4424747 GCCCTAGAAATGCTCATGATGGG + Intronic
1036134505 8:6147938-6147960 CCCATGCAAATACTTATGATAGG - Intergenic
1037474385 8:19242144-19242166 CCCAGTGAAAGTCTTATGATGGG - Intergenic
1040763501 8:50878229-50878251 CCCAGGGAAAAGCTGATGTTGGG + Intergenic
1042885963 8:73552127-73552149 GCCAGGGAACTCCTTATGAATGG - Exonic
1043839600 8:85086939-85086961 GCCAGAGAAATGTTTAGCATTGG + Intergenic
1048894356 8:138976260-138976282 GCCAGGCAAATGAATATGTTAGG + Intergenic
1050818622 9:9848455-9848477 GCCATGTAAATGCTTATTAATGG - Intronic
1053513987 9:38713776-38713798 GCAAGGTAAATGGTGATGATAGG + Intergenic
1060897958 9:127230850-127230872 CCTAGGGAAATGGTTAGGATTGG + Intronic
1061234305 9:129333740-129333762 GCCAGGGAAGGGCTTATGTGTGG - Intergenic
1185625448 X:1478179-1478201 TACAGAGAAATGCTTAGGATTGG - Intronic
1186599955 X:11025909-11025931 GTAAGGGAAATGTTTGTGATTGG + Intergenic
1187982416 X:24772064-24772086 TACAGAGAAATGTTTATGATAGG - Intronic
1192288136 X:69760653-69760675 GACAGGGAAATGGGTATGAAGGG + Intronic
1194127579 X:90039333-90039355 GCCAGGGAACTCCTTATGAATGG - Intergenic