ID: 1127376548

View in Genome Browser
Species Human (GRCh38)
Location 15:58390114-58390136
Sequence CTGTTGGACTGGAAGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127376548_1127376553 -5 Left 1127376548 15:58390114-58390136 CCAACTCCCTTCCAGTCCAACAG 0: 1
1: 0
2: 0
3: 20
4: 249
Right 1127376553 15:58390132-58390154 AACAGCTCTGTAACTTGCTAAGG 0: 1
1: 0
2: 0
3: 17
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127376548 Original CRISPR CTGTTGGACTGGAAGGGAGT TGG (reversed) Intronic
900924921 1:5699017-5699039 GTGTAGGAATGGAAGGGAGAGGG - Intergenic
900945776 1:5830702-5830724 CTGGGGGACAGGGAGGGAGTGGG - Intergenic
901184318 1:7362670-7362692 CTGGTGGACTCGAATAGAGTTGG + Intronic
903437316 1:23360441-23360463 ATGTTGGGGTGGAAGGGAATTGG - Exonic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
904095581 1:27974539-27974561 ATGTTGTGCTGGAAGAGAGTGGG + Exonic
904623523 1:31789454-31789476 CTGCTGGACTGGAAGGGGTGGGG - Intergenic
904860370 1:33533249-33533271 CTGTTGGACTGGAGGAGATTAGG + Intronic
905358868 1:37404623-37404645 CTGGTGGACTGGGAGGGGTTGGG - Intergenic
905409406 1:37757937-37757959 CTCTAGGACTGGAAGGGAGGAGG - Intronic
906710570 1:47926799-47926821 GTGCTGGAGAGGAAGGGAGTAGG - Intronic
906710652 1:47927361-47927383 TTGTTGGCTTGGAAGGGAGAAGG - Intronic
907908793 1:58809304-58809326 TTGTGGGACTGGATGGGTGTGGG - Intergenic
910261105 1:85294626-85294648 TTGATGGACTGGAAGAGAGATGG - Intergenic
912811738 1:112800302-112800324 CTGATGGACTGGATGGGGGCAGG - Intergenic
912963099 1:114213475-114213497 CTATGGGTCTGGAACGGAGTTGG + Intergenic
913346174 1:117813328-117813350 TGGTTGGCCTGGAAGGCAGTAGG + Intergenic
913966861 1:143383747-143383769 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914061237 1:144209354-144209376 CTGAGGGACTGGATGGGAGGGGG + Intergenic
914117913 1:144757015-144757037 CTGAGGGACTGGATGGGAGGGGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
916290865 1:163164972-163164994 CTGTTGGGCAGGAAGGGAGAGGG - Intronic
917701614 1:177587384-177587406 CTGTGTGGCTGGAAGGGAATTGG - Intergenic
919125917 1:193393730-193393752 CTGCTGGAGTGAAAGGGAGGAGG + Intergenic
919768680 1:201143454-201143476 CTGGTGGACTGGACGGCAGCAGG - Intronic
920234523 1:204494121-204494143 CTGCTGGAGTGGAGTGGAGTGGG + Intronic
920455713 1:206099640-206099662 CTTGTGGGCTGGAAGGGAGAGGG - Exonic
920624631 1:207585081-207585103 CTGGTGGAGTGGAAGAGGGTGGG + Intronic
923232396 1:231999497-231999519 CTCTGGGAGGGGAAGGGAGTTGG - Intronic
924552293 1:245089917-245089939 CTTTTGGAGAGGAAGGTAGTAGG + Intronic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063494465 10:6494209-6494231 CAGTTTAACCGGAAGGGAGTAGG - Intronic
1064160257 10:12939261-12939283 CTGATGGACTGGACAGAAGTTGG - Intronic
1064857178 10:19782462-19782484 CTGATAGACTGGAAGGGGGTAGG - Intronic
1064890062 10:20161269-20161291 CTGGTGGACTGGCTGGGAGCTGG + Intronic
1065708278 10:28491252-28491274 GTGTAGGACTGGAAGGGAGGAGG + Intergenic
1067476042 10:46567059-46567081 CTGTTGCAGTGGGAGTGAGTAGG - Intergenic
1067618696 10:47774721-47774743 CTGTTGCAGTGGGAGTGAGTAGG + Intergenic
1068280936 10:54868911-54868933 CTTTTGGAGAGGAAGGGAGTTGG - Intronic
1071932162 10:90484711-90484733 CTTTTGGGCTGCATGGGAGTGGG - Intergenic
1073735946 10:106346594-106346616 GGGTTGGAAAGGAAGGGAGTGGG - Intergenic
1073834245 10:107422826-107422848 CTGTTGGAGTGGAGGTTAGTGGG - Intergenic
1076509614 10:131003228-131003250 CTGTTAGACTGGCAGGGAACGGG - Intergenic
1076898065 10:133324162-133324184 CTGATGGCCTGCAAGGGAGGGGG - Intronic
1078080318 11:8199685-8199707 CAGCTGGACTGGGTGGGAGTGGG + Intergenic
1079528361 11:21417896-21417918 CTGTTGAGCTGGATGGGATTTGG - Intronic
1081450560 11:43167415-43167437 CTGTTAGACTGGGATAGAGTTGG - Intergenic
1082009805 11:47442273-47442295 CAGATGGATTGGAAGGGAGTGGG + Intronic
1083138129 11:60699337-60699359 TTGTTGGACTTGAAGAGATTAGG - Intergenic
1084356282 11:68640978-68641000 CTGCTGGACTGGCTGGGTGTTGG + Intergenic
1084490221 11:69474389-69474411 CAGTTGGACTGGATGAGACTGGG + Intergenic
1086957512 11:92948896-92948918 CTGTTAGACTGGGATCGAGTTGG - Intergenic
1088301962 11:108367390-108367412 CTGTTGGAAGGGAAGGGCTTAGG + Exonic
1088627067 11:111737171-111737193 CTGTTGGACTGGGAGGTGATAGG + Intronic
1089869615 11:121660490-121660512 CTATGTGACTGGAAGGTAGTAGG + Intergenic
1090370058 11:126244199-126244221 ATGTTGGACAGGAGTGGAGTGGG - Intronic
1092347903 12:7731371-7731393 CTCTTGGTCTGTAAGAGAGTGGG + Intronic
1092778846 12:11966813-11966835 CTGCTGGTCTGGAAGAGGGTAGG - Intergenic
1092830958 12:12443861-12443883 CTGGTGGACTGGAAATGAGCAGG - Intronic
1095092963 12:38124027-38124049 CTGTTAGACTGGGATAGAGTTGG + Intergenic
1096281062 12:50254180-50254202 CTGCTGGATTGGAAGACAGTTGG + Intronic
1096650874 12:53061359-53061381 CTCTAGGACAGGGAGGGAGTAGG - Exonic
1101198335 12:102408608-102408630 CCGTTGTACTGGCAGGGGGTGGG - Intronic
1101541215 12:105667161-105667183 TTGTTGGATTGGAAGAAAGTGGG - Intergenic
1107805251 13:44147617-44147639 CTGTTGGATAGAAAGGCAGTGGG + Intronic
1108598964 13:51974215-51974237 CTGATGGAGCCGAAGGGAGTGGG - Exonic
1108705461 13:52981493-52981515 CTTTTGAACTGGAAGACAGTGGG + Intergenic
1109190247 13:59314614-59314636 GTGATGGACTGGGAGTGAGTTGG - Intergenic
1112008322 13:95273343-95273365 CTGTCGGCCTGGATGGGCGTGGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114216874 14:20663763-20663785 GTGTTGGCCGGGAAGGGAGTAGG - Intergenic
1115172684 14:30527470-30527492 CTGGTGGAGTGTAAGGGAGATGG - Intergenic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118748467 14:68790425-68790447 CTGCTGGACAGAAAGGCAGTGGG - Exonic
1119216973 14:72876543-72876565 CTGTTTGGCTGGTTGGGAGTAGG - Intronic
1119490483 14:75028366-75028388 ATCTTTGACTGGATGGGAGTTGG - Intronic
1120520022 14:85516270-85516292 CTGGTAGAGTGGCAGGGAGTGGG + Intergenic
1123043248 14:105499181-105499203 CTGGTGGTCTGGAGGGGACTCGG + Intronic
1126842366 15:52729711-52729733 CTTTGGGGCTGGAAGGGAGGAGG - Intergenic
1127376548 15:58390114-58390136 CTGTTGGACTGGAAGGGAGTTGG - Intronic
1128892892 15:71346710-71346732 CTGTTTGACTGCAAGGGTCTAGG - Intronic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1133487996 16:6238964-6238986 CTGTTGTGCTGTAAGGTAGTAGG + Intronic
1134428932 16:14182417-14182439 CTGTGGCACTGGAATGGAATTGG + Intronic
1135282805 16:21167300-21167322 CTGTTGGCCTGCAAGGCCGTAGG + Intronic
1136141053 16:28288912-28288934 CTGTAGAACTGAGAGGGAGTCGG + Intergenic
1136156857 16:28388848-28388870 CTGTGGGACTGGAAGGTTCTGGG - Intronic
1136206229 16:28726433-28726455 CTGTGGGACTGGAAGGTTCTGGG + Intronic
1136504233 16:30692519-30692541 CTGTTGGGATGGAAGAGAGCAGG + Intergenic
1137804004 16:51286699-51286721 ATGTTGGTCTGGAAGGGGCTTGG + Intergenic
1138086281 16:54136509-54136531 CTGGTGGACTGAAGGGGAGAGGG - Intergenic
1140999012 16:80290314-80290336 CTGTTCTACTGGAAGCCAGTGGG + Intergenic
1141186353 16:81790263-81790285 GGTTTGGACTGGAGGGGAGTAGG + Intronic
1141427644 16:83954045-83954067 CTGTTTTACTGGAGGGGACTTGG + Intronic
1141569445 16:84925412-84925434 ATATTGGACTGGAAGGAAGAGGG - Intergenic
1142797970 17:2323632-2323654 CTGTTGATATGGAAGGGAGTAGG - Exonic
1143537721 17:7551045-7551067 CTGATGGCCGGGAAGGGAGTGGG - Intronic
1145807860 17:27747198-27747220 CTATTCGACAGGATGGGAGTCGG - Intergenic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1147608467 17:41787106-41787128 CTGTTGGACAGGTAGGGGGAAGG - Intergenic
1148698583 17:49575509-49575531 CTCTTGGAGAGGAAGGGAGAGGG - Intergenic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1152794579 17:82300904-82300926 TTCCTGGCCTGGAAGGGAGTTGG - Intergenic
1155852062 18:30786396-30786418 CTGGGGGGCAGGAAGGGAGTGGG - Intergenic
1157431036 18:47626945-47626967 AGGCTGGACTGGAAGGGAGGGGG - Intergenic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1160009127 18:75090234-75090256 CTGTTGGCCTGGAAGGCTGGAGG + Intergenic
1160590440 18:79941585-79941607 CCGTTGGATAAGAAGGGAGTGGG - Intronic
1163943531 19:20515977-20515999 CTATTGGACTGAAGGGGACTGGG - Intergenic
1164635928 19:29791524-29791546 CTGATGGACTGTGAGGGAGGAGG - Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1167502959 19:49857670-49857692 CTGTTGGAAGGGAACGGGGTGGG - Intronic
1202700645 1_KI270712v1_random:161242-161264 CTGAGGGACTGGATGGGAGGGGG + Intergenic
925735163 2:6957554-6957576 CTGTGGGATTGGCAGGGAATGGG + Intronic
931252773 2:60549072-60549094 CGATTGAAGTGGAAGGGAGTGGG + Intronic
932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG + Intergenic
932642146 2:73460011-73460033 CTGTAGTACTGGAATGGAATTGG - Intronic
933293137 2:80459892-80459914 CTGCTGGACTGGCAGAGACTTGG + Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934281881 2:91619032-91619054 CTGAGGGACTGGATGGGAGGGGG + Intergenic
934778091 2:96951466-96951488 CTGTTGGGCTGGCGGGGAGCTGG + Exonic
935248382 2:101239023-101239045 CTGTTAGACTGGGATAGAGTTGG + Intronic
936053958 2:109246719-109246741 CAGATGGACTGGGAGGCAGTGGG + Intronic
937873553 2:126803555-126803577 TTGGTGGACTAGACGGGAGTGGG - Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
942763379 2:179426813-179426835 GTGTTGGAGGGGATGGGAGTGGG - Intergenic
945688912 2:213008077-213008099 CTTTTCCCCTGGAAGGGAGTGGG + Exonic
946228887 2:218279547-218279569 GTGTTGGACAGGAGGGGAGATGG - Intronic
948519133 2:238524433-238524455 CTGTTGGACAGAAAGCGGGTGGG + Intergenic
1169116055 20:3066701-3066723 CTGATGGATTGGATGTGAGTGGG - Intergenic
1170396970 20:15936755-15936777 CTGTTTGAATGGGAGGGAGTAGG + Intronic
1170554042 20:17501634-17501656 CTGTTGCATTAGAAGGGAGGAGG + Intronic
1171251810 20:23654583-23654605 CTGATGGAGGGCAAGGGAGTGGG + Intergenic
1172165852 20:32898652-32898674 CGGTGGGGCTGGAAGGGAGGGGG + Intronic
1172765144 20:37346778-37346800 CTGCCGGCCTGGAAGGGACTGGG + Intronic
1172822692 20:37751765-37751787 TAATTGGACTGGGAGGGAGTTGG + Intronic
1174844096 20:53926922-53926944 CTGTTGGACTGGATGAGGGTAGG - Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1178450689 21:32696720-32696742 CTGAGGGGCTGGCAGGGAGTTGG - Intronic
1180710356 22:17835407-17835429 ATCATGGACTGGAAAGGAGTTGG - Intronic
1181010062 22:20035045-20035067 CTGTGGGGCTGGAAGTGGGTTGG - Intronic
1181029038 22:20141202-20141224 CCCTTGGACTGGGAGGGAGCGGG - Exonic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181778892 22:25178780-25178802 TTGTTGAACTGGCAGGGGGTGGG - Intronic
1182442651 22:30373300-30373322 GTGTATGACTGGAAGGAAGTGGG + Intronic
1183535982 22:38401706-38401728 CTGTGGGACTGGAAGGGGCCTGG + Intergenic
1184390303 22:44199910-44199932 CTGGTGGACTGGCTGGGAGCTGG + Intronic
1203291534 22_KI270736v1_random:280-302 CTATTGTAATGGAATGGAGTGGG + Intergenic
1203304020 22_KI270736v1_random:96774-96796 ATATTGGAATGGAATGGAGTGGG + Intergenic
950654507 3:14428196-14428218 CAGTTGGAATAGAAGGGAGGGGG + Intronic
950837517 3:15935168-15935190 CTGTTGAACTAGAAGTGACTGGG + Intergenic
953211402 3:40878200-40878222 CTCCTGGGCTGGAAGGGAGTTGG + Intergenic
956371893 3:68571700-68571722 CTGTTGCACTGGAAGGGCTGAGG - Intergenic
958481256 3:94648377-94648399 CTGTTAGACTGGGATAGAGTTGG + Intergenic
959889205 3:111534845-111534867 CTGAGTGACTGCAAGGGAGTAGG + Intronic
961061562 3:123833072-123833094 CTGTGGGACTGTAATGGGGTGGG - Intronic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961356347 3:126342269-126342291 TTGGTGGACTGGATGGGGGTAGG + Intergenic
962435851 3:135366072-135366094 CTGTTGGGCTGGACGGAACTGGG - Intergenic
962794000 3:138835033-138835055 CAGTTGGGCTGGCAGGGTGTGGG + Intergenic
964522736 3:157585387-157585409 CTATTGGACTGAAGGGGACTGGG - Intronic
968095108 3:195923903-195923925 CTGTCTGACTGCAAGGGAGCTGG - Intergenic
968122619 3:196136328-196136350 CTGGGAGACTGGAAGGGAGCCGG - Intergenic
969028188 4:4191173-4191195 CTGATGGACTGGATGGGAGGGGG - Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
973247109 4:48020721-48020743 ATGTTGGGCTGGAAGTAAGTTGG - Intronic
977375875 4:96203394-96203416 CTGTTGTTCAGGAAGTGAGTTGG + Intergenic
978436359 4:108688985-108689007 CTGTGGGACTTGAAGTGTGTTGG - Intergenic
980285940 4:130778502-130778524 CTGTTGGAGGGTAGGGGAGTAGG + Intergenic
980963935 4:139502496-139502518 CTCCTGGACTGCAAGGGGGTGGG + Intronic
981621939 4:146710641-146710663 CTGTAGGACTTCAAGGGAGCTGG + Intronic
981701926 4:147617046-147617068 GAGTTGGACTGGAAGAGAGAAGG - Intergenic
982829755 4:160044599-160044621 CTGTTGTACTGGAGTGGAGTAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985268903 4:188176191-188176213 CTACTGGACTGGAAGGAAATAGG - Intergenic
986128025 5:4901718-4901740 CTGATGGAGTGGAAGGATGTGGG - Intergenic
988774703 5:34467311-34467333 CTGTTAGACTGGGATAGAGTTGG - Intergenic
989740865 5:44769894-44769916 CAGATGGACTGGAACGGAGAAGG + Intergenic
990132721 5:52607422-52607444 CTGTTGAACTGAGAGGAAGTAGG - Intergenic
990493080 5:56321035-56321057 CTGCTGGCTTGGATGGGAGTGGG - Intergenic
991028116 5:62052488-62052510 CTGTTGGACTTGAACAGAGCAGG - Intergenic
991125705 5:63067493-63067515 CTGGGGGACTGAAAGGGAGAGGG - Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
994176717 5:96719230-96719252 TTGTGAGACTGGATGGGAGTAGG - Intronic
995531394 5:113095186-113095208 CTGTTGGTCTGCATGGGAGTGGG + Intronic
995632463 5:114149014-114149036 CTGTTAGACTGGGATAGAGTTGG - Intergenic
995819100 5:116206877-116206899 CTGTTGGATTGGTAGGCATTAGG + Intronic
997445700 5:133938391-133938413 CTGTTGGAGTTGGAGTGAGTTGG + Intergenic
997530988 5:134581175-134581197 CGGGTGGACTCGGAGGGAGTGGG + Exonic
999452468 5:151688643-151688665 TTGAAGGACTGGAAGGAAGTTGG - Intergenic
1000642439 5:163718576-163718598 CTGTTAGACTGGAACAGAGCAGG + Intergenic
1000918673 5:167113089-167113111 GTGTTGGAGTCAAAGGGAGTGGG + Intergenic
1001040411 5:168330662-168330684 CTGTTAGTCTGGAAGGGGTTGGG + Intronic
1002277738 5:178114359-178114381 CTGGTGGACCGGCAGGGGGTTGG - Intronic
1002787271 6:411989-412011 CTGCTGGACTGGAAGTTAGTAGG - Intergenic
1003033562 6:2623518-2623540 CTGTTGATCTTGAAGGGTGTGGG + Exonic
1004583095 6:16973387-16973409 CTTTGGGACTGGAAGACAGTGGG - Intergenic
1007626189 6:43247562-43247584 CTGTGGGACTGCACCGGAGTGGG + Intronic
1008272590 6:49507343-49507365 CTGTTAGACTGGGATAGAGTTGG - Intronic
1009345700 6:62611139-62611161 CTGTTGGACTGGTATGGTTTTGG - Intergenic
1012638788 6:101582224-101582246 CTGTTGGCCTGTTGGGGAGTAGG - Intronic
1012692149 6:102327738-102327760 CTGTTGCACTGGAAGGGCCGAGG + Intergenic
1014405263 6:121043267-121043289 CTGTTAGACTGGGATAGAGTTGG + Intergenic
1017015891 6:150099246-150099268 TTGTTGGACTGGATGGATGTTGG - Intergenic
1017739567 6:157394935-157394957 ATTCTGGAATGGAAGGGAGTGGG - Intronic
1017790709 6:157796411-157796433 CTGTTGGTCAGCAAGGCAGTGGG + Intronic
1017900311 6:158713906-158713928 CGGCTGGCCTGGAAGGTAGTGGG - Intronic
1018641781 6:165910334-165910356 CTGTTCGTCAGGGAGGGAGTTGG - Intronic
1018911017 6:168101061-168101083 GTGTTGGACTGGAGGGGAGGTGG + Intergenic
1019215613 6:170441118-170441140 CTGTTGGACTAGATGGGAAATGG - Intergenic
1019642249 7:2110035-2110057 CTCCTGGACTGGAAAGGCGTGGG - Intronic
1019979900 7:4613790-4613812 CGGGAGGTCTGGAAGGGAGTAGG - Intergenic
1021111033 7:16694910-16694932 CTGCTGGACTCGGAGGAAGTCGG - Exonic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023438778 7:40165615-40165637 CTGATGGGCTGGGTGGGAGTAGG - Intronic
1023829678 7:44031510-44031532 CTGTCTGCCTGGAAGGGAGCAGG + Intergenic
1024294724 7:47833044-47833066 CTGCTGGACTGGCAGGAAGGGGG + Intronic
1024307003 7:47937713-47937735 CTGCTGGACTGGAAGTGAGATGG + Intronic
1027853844 7:83483931-83483953 CTGTTGACCTGGAAGTGGGTCGG - Intronic
1029739988 7:102485769-102485791 CTGTCTGCCTGGAAGGGAGCAGG + Intronic
1029757985 7:102584948-102584970 CTGTCTGCCTGGAAGGGAGCAGG + Intronic
1030983900 7:116218025-116218047 CTGTTAGAATGGTGGGGAGTCGG + Intronic
1031584894 7:123522256-123522278 CTGTTGGACTGGGTGGGGCTTGG + Intronic
1032077245 7:128841964-128841986 GTGTTGGACAGGAAGAGTGTGGG - Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1035889583 8:3329049-3329071 CTGTTGGCATGGAATGGAGGTGG + Intronic
1036661788 8:10713988-10714010 GTGTTGGACTGGACGGGATGGGG - Intergenic
1038158279 8:25011889-25011911 CTGAGGGACGGGAAGGTAGTTGG - Intergenic
1038200880 8:25411486-25411508 CATGTGGACTGGAAGGGAGGTGG - Exonic
1038618480 8:29117578-29117600 CTGCTGAACTGGAAGGGTGCCGG + Intronic
1039471001 8:37813903-37813925 AGGCTGGACTGGAAGGGAGGGGG - Intronic
1039895516 8:41714089-41714111 CTGAGGGACTGGAAGGTAGCAGG + Intronic
1041166532 8:55097988-55098010 CTGGTGAACAGCAAGGGAGTTGG + Intergenic
1041489344 8:58414016-58414038 AGGTTGGACGGGGAGGGAGTGGG + Intronic
1046732998 8:117745919-117745941 TAGTAGGACTGGGAGGGAGTGGG - Intergenic
1047106014 8:121731060-121731082 CTTTTGGACTGGCAGTGGGTTGG + Intergenic
1047373104 8:124272467-124272489 CTCTGGGAATGGAAGGGATTAGG + Intergenic
1047901898 8:129431912-129431934 CTTTTGGGCTGCATGGGAGTTGG - Intergenic
1049315555 8:141965151-141965173 CTGGAGGATTGGAAGGGAGCAGG - Intergenic
1049441365 8:142611271-142611293 CTGTGGGGCTGGCAGGGTGTGGG + Exonic
1051721187 9:20039293-20039315 CTGGTGTACTGCAGGGGAGTGGG + Intergenic
1052072021 9:24093212-24093234 TTGTTGGAATGGATGGGAGCCGG + Intergenic
1052577736 9:30311889-30311911 CTAATAGACTGGAAGTGAGTGGG + Intergenic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1055437538 9:76307578-76307600 CTGTTGGAGGGAAAGGGAGAAGG + Intronic
1059113844 9:111583064-111583086 CTGTTGTACTAGAAGGAAATGGG - Intronic
1059422757 9:114202654-114202676 CTGTATGACTGGAATAGAGTGGG - Intronic
1060356327 9:122912484-122912506 CTGTTGTAGTGGTGGGGAGTAGG - Intronic
1060722764 9:125989621-125989643 CTGCTGCACAGCAAGGGAGTTGG - Intergenic
1062384913 9:136305397-136305419 CTGTAGGAATGGAAGGGGGCTGG - Intronic
1186613213 X:11159132-11159154 CTGTGAGGCTGGAAGAGAGTAGG + Intronic
1187018706 X:15357395-15357417 CTCTTAGCCTGGCAGGGAGTAGG - Intronic
1187302225 X:18061831-18061853 CTGCTGGACAGTGAGGGAGTAGG + Intergenic
1187388769 X:18872254-18872276 CTGTAGCACTGGTAGGCAGTGGG - Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189181032 X:39004639-39004661 CTGTTAAACTGGGAAGGAGTGGG - Intergenic
1189679109 X:43496485-43496507 CTGGAGGACTGGAAAAGAGTGGG + Intergenic
1189830421 X:44967241-44967263 GTGTTGGAGAGGAAGGGAGAGGG - Intronic
1190510361 X:51168069-51168091 GGGGTGGACTGGAAGGGAGAGGG - Intergenic
1195852746 X:109300975-109300997 CTCTTGGGCTGGAAAGGACTGGG - Intergenic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1197551482 X:127897872-127897894 CTGTTGGACCTGAATGGAGCAGG + Intergenic
1197666925 X:129234136-129234158 CTCTGGGAATGCAAGGGAGTGGG + Intergenic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1199323017 X:146463332-146463354 GTGTTTGACTGGAGTGGAGTGGG - Intergenic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1199913697 X:152315682-152315704 CTGTTGGGTTGCAAGGGAGCTGG + Intronic
1200123582 X:153802733-153802755 CTGATGGCTGGGAAGGGAGTTGG - Exonic
1201623068 Y:15981455-15981477 CTGTTAGACTGGGATAGAGTTGG - Intergenic