ID: 1127378015

View in Genome Browser
Species Human (GRCh38)
Location 15:58402740-58402762
Sequence AGTCATGGCAGTAATGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127378015_1127378019 -10 Left 1127378015 15:58402740-58402762 CCGTGCCCATTACTGCCATGACT 0: 1
1: 0
2: 0
3: 25
4: 206
Right 1127378019 15:58402753-58402775 TGCCATGACTGTCACATGGAAGG 0: 1
1: 0
2: 0
3: 15
4: 190
1127378015_1127378022 7 Left 1127378015 15:58402740-58402762 CCGTGCCCATTACTGCCATGACT 0: 1
1: 0
2: 0
3: 25
4: 206
Right 1127378022 15:58402770-58402792 GGAAGGAGAGGCAGTAGCTTAGG 0: 1
1: 0
2: 0
3: 27
4: 415
1127378015_1127378021 -5 Left 1127378015 15:58402740-58402762 CCGTGCCCATTACTGCCATGACT 0: 1
1: 0
2: 0
3: 25
4: 206
Right 1127378021 15:58402758-58402780 TGACTGTCACATGGAAGGAGAGG 0: 1
1: 1
2: 2
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127378015 Original CRISPR AGTCATGGCAGTAATGGGCA CGG (reversed) Intronic
900206857 1:1435337-1435359 AGTCACGGCAGTGGTGGGCATGG + Intronic
902677837 1:18021193-18021215 AGTCACTGCAGCAAAGGGCAAGG - Intergenic
903452921 1:23466846-23466868 AATAATGGCTGTAATGGTCATGG - Intronic
903452969 1:23467157-23467179 AATAATGGCTGTAATGGGCCGGG - Intronic
903469623 1:23576920-23576942 AGTTATGGAAGGAATGGGGAAGG - Intergenic
904629315 1:31829457-31829479 AGTCAGGGCAGAAATGCGCCGGG + Intergenic
905361873 1:37426361-37426383 TGTCATGGCAGTACTGTGCATGG + Intergenic
906344147 1:45004770-45004792 AGTGATGGAAGGAATGGACAAGG - Exonic
907403900 1:54241991-54242013 AGGCCTGGGAGTAATGTGCAGGG - Intronic
908044875 1:60157874-60157896 AGTCATGGAACTATTGGGCAGGG - Intergenic
908102666 1:60807669-60807691 AGTACTGGCTGTGATGGGCAAGG + Intergenic
908189997 1:61692562-61692584 AGTCATGGCAAGAATGGGGAAGG + Intronic
911164729 1:94714404-94714426 AGGCAAGCCAGCAATGGGCAGGG + Intergenic
911938993 1:104018568-104018590 AAACACCGCAGTAATGGGCATGG - Intergenic
912301584 1:108522350-108522372 AGTCAAGGCAGTTATGGGAAGGG + Intergenic
914838999 1:151232266-151232288 AGTCATTGTAGTGATGAGCAGGG - Exonic
915117546 1:153610206-153610228 AGTCCTTCCAGAAATGGGCACGG - Intronic
918095207 1:181328664-181328686 AGTGATGAGAGTAATGGGGAAGG + Intergenic
919189514 1:194197713-194197735 AATCATGGCAGAAATAGGAAAGG - Intergenic
923627548 1:235626633-235626655 TGTCTTGGCAGCAATGGTCACGG - Intronic
924445751 1:244128737-244128759 AGTGATGGCAGTAATTGGGCGGG - Intergenic
924490684 1:244534998-244535020 AGTCATAGCATTACTGGGCTTGG - Intronic
1064614490 10:17138606-17138628 AGTCATTGTAATAATGAGCATGG - Intergenic
1065041850 10:21705452-21705474 AGTCATGGTAGGCAGGGGCAGGG + Intronic
1070933187 10:80274951-80274973 ACTCAGGGCAGAACTGGGCAGGG + Intronic
1071101300 10:82041036-82041058 ACTCATGGCAGAAATATGCATGG - Intronic
1071443781 10:85727619-85727641 AGGAATGACAGCAATGGGCAGGG + Intronic
1071686359 10:87762033-87762055 ACTCATGTCAGTGCTGGGCATGG - Intronic
1074076695 10:110133372-110133394 TGTCATGGTAGTAAATGGCAAGG + Exonic
1076197032 10:128526226-128526248 AGCCATGGCAGTAAGGGGAAAGG - Intergenic
1078666594 11:13331045-13331067 AGTCATGGCAGAGGTGGGCTGGG + Intronic
1079482846 11:20900256-20900278 AGTCAGAGCAGAAATGTGCATGG + Intronic
1080781843 11:35436748-35436770 AATCATGCCAGTAATAGACATGG - Intronic
1084229697 11:67742715-67742737 AGTAATGGCAGAAATTGGCTGGG + Intergenic
1085468180 11:76738255-76738277 GGTCAGGGCAGGAATGGGAAGGG + Intergenic
1088235986 11:107723432-107723454 AGGTATGGCAGTTATGGGTAAGG - Intergenic
1091081411 11:132672360-132672382 AATCAGGGCAGTAATACGCAAGG + Intronic
1094022663 12:25930572-25930594 TGTAATGGCAGTAAGTGGCAAGG - Intergenic
1095772034 12:45970440-45970462 TGTCATGGCAGGATTGGGCTTGG - Intronic
1097175050 12:57137841-57137863 AGGCTGGGCAGGAATGGGCAGGG - Intronic
1097319756 12:58211946-58211968 AGTCATGGCAGCCATGGGCCTGG + Intergenic
1097555126 12:61127358-61127380 AGTGATGGCTTTAATGGGCTTGG + Intergenic
1098319979 12:69233092-69233114 AGTCATGGCAGAAAGGCGAAGGG - Intergenic
1099536379 12:83850325-83850347 AGTAATGGCTGTAAAAGGCATGG - Intergenic
1099770108 12:87041402-87041424 AGTGATGGAAACAATGGGCATGG + Intergenic
1100354364 12:93815113-93815135 AGTCATGCCAGATATGGGCCAGG - Intronic
1101671702 12:106881468-106881490 TGTAATGGCAGTGATGGACATGG - Intronic
1104596949 12:130126373-130126395 AGTCAGGGCAGGGAAGGGCAGGG + Intergenic
1105401396 13:20099382-20099404 AGCCTTGTCAGTAAAGGGCACGG + Intergenic
1108191826 13:47949516-47949538 AGTCATGGCAGTAAAAGACTTGG - Exonic
1111641469 13:90976164-90976186 TGTGATGGCAGTAAGAGGCAGGG + Intergenic
1112447029 13:99473519-99473541 AGTCATGGCAGGAATGGATGCGG + Intergenic
1114468146 14:22939386-22939408 AGTCATGGCTGGGCTGGGCACGG + Intergenic
1116708722 14:48337322-48337344 AGTAATGGAAGTCATGGCCAGGG - Intergenic
1117265159 14:54079026-54079048 AGTCATGGCCGAGAAGGGCATGG - Intergenic
1121330974 14:93049689-93049711 AGGCTTGGCAATAATGGGTAAGG + Intronic
1121452289 14:94016646-94016668 AGTTTTGGCAGCAAAGGGCACGG - Intergenic
1121944803 14:98109617-98109639 CTTTATGGCAGTAAAGGGCAAGG + Intergenic
1123479494 15:20617895-20617917 ATTCAGGGCAGAAATGGGGAGGG - Intergenic
1123638513 15:22382469-22382491 ATTCAGGGCAGAAATGGGGAGGG + Intergenic
1124930853 15:34118055-34118077 AGTCAGGGGAGTATTGGGAAGGG - Intergenic
1125306769 15:38326205-38326227 TGTCATGGCAGTAATGTGGGAGG + Intronic
1125356402 15:38821081-38821103 AGTCATGGCAGGGATGGTGAGGG + Intergenic
1125779132 15:42248294-42248316 AGTGTTGGAAGTAATGGCCAGGG - Intronic
1127126102 15:55813375-55813397 AGTAATGGCAGTCATAGGGATGG + Intergenic
1127139941 15:55964996-55965018 AGTCATGACAGAAACGGGAAGGG - Intronic
1127378015 15:58402740-58402762 AGTCATGGCAGTAATGGGCACGG - Intronic
1128044178 15:64603033-64603055 AGTCAGGGCAGTGCCGGGCACGG - Intronic
1132929440 16:2451363-2451385 AGTCATGGCAGTGAGGGGTGAGG + Intronic
1133103826 16:3494493-3494515 TGTCAAGGCAGGACTGGGCACGG - Intronic
1139166623 16:64573376-64573398 GGTCATGCCAGTAGTGGGAAAGG + Intergenic
1140649446 16:77071228-77071250 AGTGATGGGATTACTGGGCAGGG - Intergenic
1141773819 16:86108930-86108952 AGTCATAGCAGTAGTAGTCATGG - Intergenic
1141786944 16:86207438-86207460 AGGCATGGCTGTAATTGGCCAGG + Intergenic
1145259610 17:21346961-21346983 TGTCATGGCTTGAATGGGCAGGG + Intergenic
1145317008 17:21740987-21741009 TGTCATGGCTTGAATGGGCAGGG - Intergenic
1146430681 17:32791066-32791088 AATCATGTCAGTAATGAGCTGGG + Intronic
1146591431 17:34131280-34131302 GGTCATGGGAATAATGGGGATGG + Intronic
1148874009 17:50675849-50675871 AGCCATGGCAGTCAGGGACAGGG - Intronic
1151746367 17:76013935-76013957 AGGCATGGCAGTCAGGGGAAAGG - Intronic
1152722629 17:81930304-81930326 AGGCGTGGCAGAATTGGGCAGGG + Intergenic
1153897670 18:9581319-9581341 AGTAATGGGAGTTATGGGGACGG + Intronic
1156135570 18:34032814-34032836 AGTGATGGCAGCAATGGGCTGGG - Intronic
1156308947 18:35905086-35905108 AGTCTTGGCTGTGATGGGCGAGG + Intergenic
1156787672 18:40935126-40935148 AGTGATAGCAGCATTGGGCATGG + Intergenic
1157934753 18:51860622-51860644 AGTCATTGAAGTAATTGGAAAGG + Intergenic
1159501226 18:69273080-69273102 ATTAATGGCAGTAGTGGGTACGG + Intergenic
1160100800 18:75917536-75917558 AGTCCTGGAAGTATTGTGCAGGG - Intergenic
1160257480 18:77259567-77259589 GGTCATGGCAGTGATGGTGATGG + Intronic
1162565274 19:11442514-11442536 AGGTATGGCAGAAATGGCCAAGG + Exonic
1163766416 19:19165808-19165830 AGTCATGGCTGCTGTGGGCATGG - Intronic
1164989204 19:32672630-32672652 AGTGATAGCTGGAATGGGCAGGG + Intronic
1167760268 19:51442385-51442407 AAGCATGGCAGTGGTGGGCATGG - Intergenic
925698815 2:6612775-6612797 AGTCATAGCATTACTGGGCTTGG - Intergenic
927906032 2:26857915-26857937 AGAGATGGCAGTGATGGGCATGG + Intronic
928191717 2:29176565-29176587 AGACATGGCAGAAAGGGGGAGGG + Intronic
928300052 2:30116999-30117021 AGTCCTGGGAGTAAGGGGAAGGG - Intergenic
929582729 2:43093358-43093380 AGTCAAGGCACTGATGGCCATGG - Intergenic
931183259 2:59924923-59924945 AGTCATGGCAGAAATAGCCTTGG - Intergenic
932053647 2:68423340-68423362 AATCATGGCAGTAGTGGGGGTGG + Intergenic
935437000 2:103045849-103045871 AATCATGGCAGAAAGGGGAATGG - Intergenic
936270785 2:111046943-111046965 AGTGGTGGCAGCAGTGGGCATGG + Intronic
936490694 2:112969591-112969613 AGTCAGGGCACTGATGGGGAAGG + Intergenic
937031319 2:118743484-118743506 AGTCCTGGTAGGAATGGGAATGG - Intergenic
937429480 2:121826292-121826314 AGTAATGGCAGGAATGGCCCTGG - Intergenic
937465602 2:122130865-122130887 AGTAATGGCAGTGGTGGGCTGGG + Intergenic
938240766 2:129740988-129741010 AGGCATGGCAGAGCTGGGCAGGG + Intergenic
938676615 2:133642061-133642083 ATTCATGGCAGAAAAGGGAAAGG + Intergenic
939164098 2:138621691-138621713 AGTCATGGCAGAAAGGTGAAGGG + Intergenic
939232934 2:139454349-139454371 AGTAGTGGCAGTAGTGGGCCAGG + Intergenic
939940109 2:148339188-148339210 AGACATGGCAGAAAAGGGGATGG - Intronic
941316042 2:163993955-163993977 GGTTATGGCAGGAATGAGCAGGG + Intergenic
942165470 2:173236598-173236620 AGCCTTGGCAGTAAGGGGGAGGG - Intronic
942334969 2:174873656-174873678 AGTTATGGCAGTTTTGGGCAAGG + Intronic
943207189 2:184915843-184915865 ATTCATGGTAGTAATGGGAAAGG + Intronic
943228342 2:185210182-185210204 AGGGATGGCAGTGATGGGCATGG + Intergenic
943670893 2:190659329-190659351 AATCATGGCACTCGTGGGCATGG + Exonic
944853612 2:203744847-203744869 AGTCATGGCAGAAGGGGGAAGGG - Intergenic
946050383 2:216857329-216857351 AGTCATAGCAGGAAGTGGCAAGG + Intergenic
948273864 2:236693731-236693753 AGTCATGACAGTGATTGGAAAGG + Intergenic
1170454439 20:16519254-16519276 AGGAATGGCAGTGATGGGAATGG - Intronic
1171403527 20:24894219-24894241 GGTCGTGGCAGTAAGGGCCAAGG + Intergenic
1173591629 20:44229301-44229323 AGAGATGGCAGTAATCGGGAGGG + Intergenic
1173667321 20:44772254-44772276 AGTCAGGGCAGAGAGGGGCAGGG - Intronic
1174033814 20:47653035-47653057 AGGCATGCCAGACATGGGCATGG - Exonic
1175709540 20:61208179-61208201 AGTCATGGCAGCAACTGGCGGGG + Intergenic
1178058383 21:28825070-28825092 AGCCAGGCCAGCAATGGGCAGGG + Intergenic
1180178088 21:46099736-46099758 AGTGGAGGCTGTAATGGGCAGGG + Intronic
1181282047 22:21727218-21727240 GGTCCTGGCAGTAGTGGCCAGGG + Intronic
1185174064 22:49309715-49309737 AGTCATCGCAGTAATGCGAATGG + Intergenic
951153953 3:19326278-19326300 TGTCATGGCAGGCAGGGGCACGG - Intronic
951176565 3:19607903-19607925 AGTCAAGGCAGTAAAGTTCATGG + Intergenic
951862257 3:27266255-27266277 AGTCTTTGCAGTATTGGGCTAGG - Intronic
952661276 3:35851254-35851276 AATTATGGCAAGAATGGGCAAGG - Intergenic
953439797 3:42907451-42907473 AGGGATGGCAGGAATGGGGACGG + Intronic
954222486 3:49163185-49163207 AGTCATGGCAGCATGGGCCAAGG - Exonic
955045428 3:55354985-55355007 AATCATGGCAGGAAGGGGAAGGG - Intergenic
955218384 3:57003776-57003798 AGTCATGCCAGGAAGGGGCCAGG + Intronic
955805123 3:62725790-62725812 ACTCATGGCAGCAGTGGCCAAGG + Intronic
956186955 3:66571625-66571647 AGTAATGGCAATAATAGGCAAGG - Intergenic
957046265 3:75377555-75377577 AGTAATGGCAGAAATTGGCTGGG + Intergenic
963802363 3:149688553-149688575 AGTCATGGCATTACTGGGATTGG + Intronic
965721691 3:171668955-171668977 AGACATGGCAGGAAAAGGCATGG - Intronic
965940629 3:174175873-174175895 AATCATGCCAGTAATGAGCCTGG - Intronic
965978959 3:174663478-174663500 AGTCATGGCAGAAAGGGGAAGGG + Intronic
967752953 3:193135397-193135419 AGGCAAGGCAGGAATGAGCAAGG + Intergenic
968942934 4:3648520-3648542 GGGCATGGCAGGAAGGGGCAGGG - Intergenic
968970465 4:3791067-3791089 AGGAATGGCAGTTATGGGAAGGG - Intergenic
968990551 4:3908671-3908693 AGTAATGGCAGAAATTGGCTGGG + Intergenic
969824776 4:9748670-9748692 AGTAATGGCAGAAATTGGCTGGG - Intergenic
969853562 4:9981086-9981108 AGTGATGGTAGTAATGGTGATGG + Intronic
969910059 4:10436108-10436130 AGAAATGGCAGTAATGGCCTTGG - Intergenic
975192792 4:71485150-71485172 AGTATTGGAAGTAATGGCCAGGG - Intronic
975820788 4:78268302-78268324 AGACATGGCTGTCATCGGCAGGG + Intronic
976610023 4:87020771-87020793 AAACATGGCATTACTGGGCATGG - Intronic
978283208 4:107042068-107042090 AGTTATGGCAATAATGTGGAAGG + Intronic
978957471 4:114632017-114632039 AGCCATGTCAGTAATAGGTAAGG + Intronic
979564949 4:122144893-122144915 AGTCATAGCATTAATGGGCTTGG - Intergenic
979914968 4:126420558-126420580 AGTGATGGCAGTAGTAGGCAGGG + Intergenic
982561281 4:156930984-156931006 AGTTATGGGATTACTGGGCAGGG - Intronic
983406892 4:167342616-167342638 AATCATGGCAGTAGGGGGAAGGG + Intergenic
984625753 4:182006077-182006099 AGTCTTGGAAGTACTGGCCAGGG - Intergenic
987402260 5:17490634-17490656 TGTCATGGCTGGAATGGTCAAGG - Intergenic
987572953 5:19688117-19688139 AGTGATGGCAGTAATGGTGGTGG - Intronic
989988377 5:50730882-50730904 AGACAAGGAAGTAATGTGCAAGG + Intronic
990667012 5:58084115-58084137 AGTCATAGAAGTAAGGTGCAAGG + Intergenic
991274674 5:64830499-64830521 ATTCATGACAGGCATGGGCAAGG + Intronic
993013717 5:82512146-82512168 AGTCATGGCAGTCCTGGACCAGG + Intergenic
993047149 5:82880787-82880809 AGTGATGGCAGTGATGGGCCAGG + Intergenic
994494453 5:100492361-100492383 AGTCATTGTGGTAAAGGGCAAGG - Intergenic
995501815 5:112815612-112815634 AGTCATGGCATTAGTGACCAGGG - Intronic
998752702 5:145340419-145340441 GGTCATGGCAGTGGTGGGCTGGG - Intergenic
1000602218 5:163288430-163288452 AAACAGGGCAGTAGTGGGCAAGG + Intergenic
1002206155 5:177563941-177563963 AGTTGTGGCAGTACTGGGCTGGG + Intergenic
1007928104 6:45666156-45666178 AGTCATGGATGTGATGGGCTCGG + Intergenic
1007930690 6:45687889-45687911 AGTCATGGGGGTGATGAGCAGGG - Intergenic
1008640445 6:53456948-53456970 AGTCATCCCAGTTGTGGGCAAGG - Intergenic
1010231416 6:73538642-73538664 ATTCATGCCTGTAATGGGCATGG - Intergenic
1011164224 6:84427876-84427898 AATGATGGCAGTCAGGGGCAGGG - Intergenic
1011737502 6:90326585-90326607 ATTCATTGCAGGGATGGGCATGG - Intergenic
1014972258 6:127831708-127831730 AATCTTGGCAGGAATGAGCAAGG + Intronic
1015255800 6:131178428-131178450 TGTGATGGCAGTAGTGGGAATGG - Intronic
1015278710 6:131409215-131409237 AGTCATGGAAGGAAGAGGCAGGG - Intergenic
1016838581 6:148504231-148504253 CATCAGGGCAGTGATGGGCATGG + Intronic
1017333737 6:153229874-153229896 AATCATGGCAGAAGGGGGCAAGG - Intergenic
1018523430 6:164679219-164679241 AATCATGGCAGAAGTGGGAAAGG + Intergenic
1020313388 7:6886791-6886813 AGTAATGGCAGAAATTGGCTGGG + Intergenic
1021816936 7:24456239-24456261 AGTCATCTCATTCATGGGCAAGG - Intergenic
1021902589 7:25301596-25301618 AGTTATAGCAGTAATGGGAATGG - Intergenic
1022270123 7:28798790-28798812 AGTCATGTCAGTAATAGCCCTGG + Intronic
1022549943 7:31228879-31228901 GGCCATGGCTGTAATGGGCTGGG + Intergenic
1026074726 7:67156196-67156218 AGTGGTGGCAGTCATGGGCTGGG + Intronic
1026572830 7:71546824-71546846 AGTCATGGTACCACTGGGCAAGG + Intronic
1026702140 7:72655966-72655988 AGTGGTGGCAGTCATGGGCTGGG - Intronic
1031190954 7:118550136-118550158 AGGCATGACATTATTGGGCATGG + Intergenic
1031249946 7:119367093-119367115 AGGAATGGGAGGAATGGGCAGGG + Intergenic
1032860859 7:135878062-135878084 AATCATGGCAGGGATGGGCATGG - Intergenic
1035454043 7:158997476-158997498 AATCAGGGCAGAAATAGGCAAGG + Intergenic
1036627473 8:10483622-10483644 AGTCAGGGCAGGAAAGGACATGG + Intergenic
1037383894 8:18317347-18317369 AGGTAAGGCAGTAATAGGCAGGG - Intergenic
1040625908 8:49149834-49149856 AGTAATGGCAGCAATGCTCAAGG + Intergenic
1040947326 8:52897268-52897290 ACTCATGGCAGAAAGAGGCAGGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041477311 8:58280784-58280806 AATCATGTCAGCATTGGGCAGGG + Intergenic
1041838758 8:62246437-62246459 AGTAAAGGCAGCAATGGGAAAGG + Intergenic
1042675818 8:71320261-71320283 AGCCAGGGCAGTGATGGGAATGG + Intronic
1044336316 8:90987893-90987915 AGTAATGCCAGCAATGGGGAGGG + Intergenic
1045602302 8:103732163-103732185 AGTCACAGCATTAATGGGCTGGG - Intronic
1046723559 8:117650419-117650441 AGACATTGCAGAAATGAGCAAGG - Intergenic
1047421878 8:124714032-124714054 TGTCATGGCCGTAATGGCCATGG - Intronic
1047755883 8:127918117-127918139 AGTCATGGCAGAGATGAGCAGGG - Intergenic
1048519742 8:135142353-135142375 AGTCATGGAAGTACAGTGCAGGG + Intergenic
1048815248 8:138327542-138327564 AGTCATGCCAGTAATCGTGATGG + Intronic
1051965544 9:22824113-22824135 AGTCATGCCAGTAATGATCATGG - Intergenic
1052632838 9:31062568-31062590 AGCCATGGAAGTCATGGCCACGG + Intergenic
1053093382 9:35301159-35301181 AGCCATGGCAGTATTGGGGAAGG + Intronic
1054827871 9:69590990-69591012 AGTCATGGCAACAGTGGGAAAGG - Intronic
1059113414 9:111578601-111578623 AGTAATGGGAGCAATGGGGAAGG + Intronic
1059286577 9:113177766-113177788 AGACATGGGACTAGTGGGCAGGG - Intronic
1060786325 9:126454246-126454268 GGTCAGGGCAGCAAGGGGCAGGG - Intronic
1061923778 9:133796106-133796128 GGCCATGGCAGAAATGGACATGG - Intronic
1186946899 X:14578745-14578767 AGTAATGTCAGTAAGGGTCAAGG + Intronic
1192406142 X:70887820-70887842 AGTCTTGGCAGTGGTGGCCATGG + Intronic
1192552197 X:72063272-72063294 AGTGATGTCATTAATGGCCAAGG - Intergenic
1192927219 X:75767637-75767659 AGTCATGGCATTACTGTGCTTGG + Intergenic
1193098193 X:77577758-77577780 AATCAGGGCAGTACTGGGGAAGG + Intronic
1193515128 X:82452784-82452806 AGTGTTGGCAGTAATGGGAGAGG - Intergenic
1194827215 X:98578140-98578162 AGTCATTGTAGGAATGGACAGGG - Intergenic
1197596117 X:128466091-128466113 ATTCATGGTTGTAATAGGCATGG - Intergenic
1199028974 X:142973906-142973928 AGTATTGGAAGTAATGGCCAGGG + Intergenic
1199798594 X:151227541-151227563 AATCATGGCACTCGTGGGCATGG - Intergenic
1201924116 Y:19266244-19266266 AGTCATGGCAGAAAGGAGCCAGG - Intergenic