ID: 1127383005

View in Genome Browser
Species Human (GRCh38)
Location 15:58445510-58445532
Sequence CTGAGGACAGAGCTGGGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 973
Summary {0: 1, 1: 0, 2: 10, 3: 117, 4: 845}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127382990_1127383005 29 Left 1127382990 15:58445458-58445480 CCCACATAGAAGGGTCAAGCCCA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG 0: 1
1: 0
2: 10
3: 117
4: 845
1127382997_1127383005 9 Left 1127382997 15:58445478-58445500 CCAAATTAGAAGGGTGGGATGAT 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG 0: 1
1: 0
2: 10
3: 117
4: 845
1127382991_1127383005 28 Left 1127382991 15:58445459-58445481 CCACATAGAAGGGTCAAGCCCAA 0: 1
1: 0
2: 1
3: 4
4: 96
Right 1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG 0: 1
1: 0
2: 10
3: 117
4: 845
1127382996_1127383005 10 Left 1127382996 15:58445477-58445499 CCCAAATTAGAAGGGTGGGATGA 0: 1
1: 0
2: 0
3: 10
4: 168
Right 1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG 0: 1
1: 0
2: 10
3: 117
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127383005 Original CRISPR CTGAGGACAGAGCTGGGGCT AGG Intronic
900122779 1:1055986-1056008 AGGAGGACTGGGCTGGGGCTGGG - Exonic
900151948 1:1182671-1182693 CTGGGGCCAGGGCTGGAGCTTGG + Intronic
900160298 1:1220133-1220155 CTGAGGTTGGTGCTGGGGCTCGG - Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900334207 1:2153437-2153459 GGGAGGGCAGAGCTGGGGCTGGG + Intronic
900338498 1:2176637-2176659 TGGAGGACAGAGCTAGAGCTGGG - Intronic
900344766 1:2205350-2205372 CCGAGGACACAGCTGGGGCGGGG - Intronic
900415819 1:2534175-2534197 CTGGGGACAGAGGTTCGGCTTGG + Intergenic
900516029 1:3082619-3082641 GTCAGGACAGAGCCGGGGTTGGG + Intronic
900593837 1:3471572-3471594 CTGGGGGCAGAGCTGGGGGAGGG - Intronic
900777619 1:4596456-4596478 CTGAGAACAGGGCTGGAGCCCGG + Intergenic
901105652 1:6754095-6754117 CTGAGGACAGAGTAAGGACTGGG - Intergenic
902138855 1:14334669-14334691 CTGAAGGCTGGGCTGGGGCTGGG + Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902374990 1:16026419-16026441 CTGAGGACAGCCCTGGGGGTTGG + Intronic
902534237 1:17110026-17110048 CTCAGAACAGGGCTGGTGCTGGG - Intronic
902609384 1:17588276-17588298 CTGATGACTGAGCCAGGGCTGGG + Intronic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
903125907 1:21247446-21247468 CAAAGGAAAGAGCTTGGGCTTGG + Intronic
903167594 1:21531726-21531748 CTAAGGTCAGAGCTGGGTGTGGG - Intronic
903219301 1:21860080-21860102 CTGGGGACAGGGCTGAGGGTGGG - Intronic
903373641 1:22852566-22852588 GGGAGGCCAGACCTGGGGCTGGG + Intronic
903451183 1:23454846-23454868 CAGATGAGAGACCTGGGGCTTGG + Intronic
903462402 1:23529109-23529131 CTAAGGTCAGAGATGGGGATGGG - Intronic
903739730 1:25551814-25551836 CTGGGGCCAGGGCTGGGGATGGG + Intronic
903994391 1:27296757-27296779 CTGGGGCTAGGGCTGGGGCTGGG - Intronic
903994407 1:27296793-27296815 CTGGGGCTAGGGCTGGGGCTGGG - Intronic
904200510 1:28816396-28816418 CTGAGGGAGGAGCTGTGGCTGGG + Intronic
904354556 1:29930672-29930694 TTGAGGACAGAGCTGGGGGTGGG - Intergenic
904377040 1:30088183-30088205 GTGAGGACACAGGTGGTGCTGGG + Intergenic
904418894 1:30378948-30378970 GTGAGCACTGTGCTGGGGCTGGG - Intergenic
904420609 1:30388714-30388736 CAGAGGACACAGCTGGCTCTTGG - Intergenic
904424698 1:30415820-30415842 CTGAGGAGGGAGCTGAGGCTGGG - Intergenic
904477183 1:30772940-30772962 CAGAGGAGAAAGCTGGGGTTGGG + Intergenic
904914366 1:33959461-33959483 CTGAGGACAGAGAGGCTGCTGGG - Intronic
905541667 1:38764955-38764977 CTGAGGAGAGACCAGGGGGTGGG + Intergenic
905653905 1:39673629-39673651 CTGGGAGCTGAGCTGGGGCTGGG - Intergenic
906200753 1:43958691-43958713 CTGGGGACCAAACTGGGGCTGGG + Intronic
906484268 1:46222195-46222217 CTGAGGAGAGAGCAGAGCCTGGG + Intergenic
906661156 1:47583318-47583340 CAGAGGGCAGAGCCAGGGCTGGG - Intergenic
907266742 1:53266354-53266376 CTCAGGACAGAGTTGGGACTTGG - Intronic
907575153 1:55519773-55519795 CAGAGGAAAGAACTGGGGCTGGG - Intergenic
907853961 1:58283140-58283162 GAGAGGAGAGCGCTGGGGCTTGG - Intronic
907868682 1:58423466-58423488 ACCAGCACAGAGCTGGGGCTGGG - Intronic
908131947 1:61082861-61082883 CCGGGGGCAGGGCTGGGGCTGGG + Intronic
909549579 1:76882874-76882896 CTGAGGGCAGTGGTGGGGGTAGG - Intronic
910801952 1:91155845-91155867 ATGAGGACAGAGCTGAGGATGGG - Intergenic
910864718 1:91777582-91777604 CTGGGGCTAGAGCTGGGGTTGGG - Intronic
912528959 1:110306361-110306383 CTGAGCCCAGAGCTGGCCCTAGG + Intergenic
912722628 1:112032905-112032927 GTTAGGCCAGATCTGGGGCTCGG - Intergenic
912949027 1:114107726-114107748 GTGAGGGCCGAGCTGGGGCCTGG - Intronic
912971721 1:114289984-114290006 CGGAGGACTGAGCTGGGAGTAGG + Intergenic
914779699 1:150773999-150774021 CTGAGGCCAGTGCAGTGGCTTGG - Intergenic
914825038 1:151133717-151133739 CTCAGGCCAGAGCTTGGGCCTGG + Intronic
915273426 1:154771933-154771955 CTGAGTACAGAGCCTGTGCTGGG - Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915590251 1:156866569-156866591 CTGAGGCCACAGCTGGGGGAAGG - Intronic
916078849 1:161219424-161219446 CTGAGGATGGAGCTGGAGCAGGG + Intronic
916207336 1:162328091-162328113 CTGTGGAAAGAGCATGGGCTTGG - Intronic
918136740 1:181680672-181680694 CTGAGGACAGGGATGGGGTGTGG - Intronic
918241490 1:182624127-182624149 CTGAGGCCAGAGCTGAAACTTGG + Intergenic
919748107 1:201021210-201021232 CTTAGGACTGAGCTGGGGCTGGG - Intronic
920131674 1:203736857-203736879 CTGAGGCCAGTGCTGGAGTTGGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
921300309 1:213745596-213745618 TGGGGGACAGAGGTGGGGCTGGG - Intergenic
921314555 1:213878032-213878054 CTGAGGACAGGTCTGTGACTTGG + Intergenic
922067010 1:222154146-222154168 CTGAGGACAGTGCAGGAGCACGG - Intergenic
922725371 1:227920613-227920635 CTGAAGACAGTGCTGGTGTTGGG + Exonic
922734608 1:227972449-227972471 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
922800720 1:228363664-228363686 CTGAGGACTGGGCTGGAGCGAGG - Intronic
922800766 1:228363828-228363850 ATGAGGACAGGGCTGGAGCGAGG + Intronic
922882335 1:228990388-228990410 TTGATGTCAGAGCTGGGGGTGGG + Intergenic
922894375 1:229088905-229088927 CTGAGGACAGGGGTGGGGCTGGG + Intergenic
923001777 1:230012039-230012061 CTGAGGACAGAGCCAGGGAGAGG - Intergenic
923203820 1:231738971-231738993 CTGAGGCCAGGGCTGAGGCAGGG - Intronic
923621137 1:235580529-235580551 CTGAGGAGAGAGCTGAACCTAGG - Intronic
924240596 1:242036347-242036369 TAGAGGACAAAGCTTGGGCTTGG + Intergenic
924343271 1:243054064-243054086 GAGAGGACAGAGCTGGGCCCGGG + Intergenic
924343323 1:243054259-243054281 GTGAGGCCTGAGCTGGGCCTAGG + Intergenic
924453614 1:244200426-244200448 AAGGGGACAGAGCTGGGCCTGGG + Intergenic
924557187 1:245128491-245128513 CTGGGGACAGGGCTGGAGATGGG + Intergenic
1062830771 10:604018-604040 CTGAGGGCAGGGCTGGGGGGTGG - Intronic
1063535265 10:6876832-6876854 CTGCGCACACACCTGGGGCTGGG + Intergenic
1063663279 10:8048189-8048211 CTGAGGCCAGCGCTGGGGGTTGG + Intergenic
1065514069 10:26507065-26507087 CTGAGGACAGAGAGGCAGCTGGG + Intronic
1066485863 10:35844074-35844096 CTGAGGCTAGAGCCGGGGTTAGG - Intergenic
1066635244 10:37493451-37493473 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1066733152 10:38451270-38451292 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1067058521 10:43065947-43065969 GTGAGGCCAAAGCTGGGCCTGGG - Intergenic
1067107766 10:43377077-43377099 CTGAGGCCAGGGCTTGGGCTGGG + Intergenic
1067168012 10:43880519-43880541 CGGATGACAAAACTGGGGCTCGG - Intergenic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1067654230 10:48178861-48178883 CAGGGGACAGAGCTGGGATTCGG - Intronic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1067713705 10:48671249-48671271 CTGAGGGCAGGGCAGGGGCAGGG + Intergenic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069313834 10:67073039-67073061 CTGAGGACTGGACTGGGCCTAGG - Intronic
1069511906 10:69048785-69048807 CTGTGGACAGAGGAGGGGCAGGG - Intergenic
1069534676 10:69244287-69244309 CTGATTCCAGGGCTGGGGCTAGG - Intronic
1069851348 10:71407255-71407277 GCAATGACAGAGCTGGGGCTGGG + Intronic
1069898323 10:71692635-71692657 CTGAGCAGGGAGCTGGGGGTGGG - Intronic
1069921569 10:71818861-71818883 CTGAGGAAAGCGATGGGGCTTGG + Intronic
1070147516 10:73785771-73785793 CTGAGGGGCGAGCCGGGGCTGGG - Exonic
1070383849 10:75906044-75906066 CTGGGGTGAGAGCTGGGACTGGG - Intronic
1070732916 10:78843869-78843891 TTGAGCACAGAGCTGATGCTTGG + Intergenic
1070752039 10:78969659-78969681 CTGAGCACAGAGCAGGGCATGGG - Intergenic
1071510228 10:86256861-86256883 CAGAGGGCTGAGCTGGGCCTGGG + Intronic
1071514393 10:86287583-86287605 TTGTGGTCAGGGCTGGGGCTAGG - Intronic
1072800645 10:98390332-98390354 CCCAGGAAAGTGCTGGGGCTGGG - Intronic
1073114889 10:101086299-101086321 CTCAGGACAGAGTAGGCGCTAGG + Intergenic
1074537227 10:114337206-114337228 CTGAGGGCAGAGCCAGGGCTTGG - Intronic
1074814586 10:117134680-117134702 CTGCGGATAGGGCTGGGACTTGG - Intronic
1075077161 10:119359185-119359207 CAGAGGCCAGGGGTGGGGCTGGG + Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075409391 10:122216141-122216163 GTCAGGACAGAGCTGCAGCTGGG - Intronic
1075646414 10:124099689-124099711 CTGAGGTCAGAGCTGGAGTCTGG - Intergenic
1075671382 10:124265999-124266021 CTGGGCACTGTGCTGGGGCTGGG - Intergenic
1075816967 10:125271862-125271884 CTGAGTGCAGAGCTTGAGCTGGG - Intergenic
1076076018 10:127534451-127534473 CTGTGGACAGAGCTGTGGATGGG - Intergenic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076769964 10:132657483-132657505 CAGACTACAGAGCTGGGGGTGGG - Intronic
1076870348 10:133189832-133189854 CTGGGGGCAGGGCTGGGGCAGGG - Intronic
1077169244 11:1159014-1159036 GAGAGGGCGGAGCTGGGGCTGGG + Intronic
1077295813 11:1825781-1825803 CTGCGGGCAGACCTGGGGCAAGG - Intergenic
1077323979 11:1955659-1955681 CTGTGGCCTGGGCTGGGGCTTGG + Intronic
1077488952 11:2851653-2851675 CTGAGCACCCAGCTGGGGCCAGG - Intergenic
1077490559 11:2859069-2859091 CAGAGGCCAGGGCTGGGGATAGG - Intergenic
1077881962 11:6357952-6357974 CTGAGGAAAGAGGTGGGGATAGG + Intergenic
1078335965 11:10463409-10463431 ATGAGCACACTGCTGGGGCTGGG - Intronic
1078470327 11:11581166-11581188 CTGAGGCCTGAGGTGGGGCAGGG + Intronic
1078540129 11:12206582-12206604 CTGAGGCTAGAGATGTGGCTGGG - Intronic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079710800 11:23680278-23680300 CTGAGATCAGAGCTAGGGCTGGG + Intergenic
1080160227 11:29165500-29165522 TTGAGGACCAAGCTGGAGCTTGG + Intergenic
1080614347 11:33932986-33933008 CTCATGACAGAGGTGGGGCCTGG - Intergenic
1080897116 11:36456033-36456055 CTGTGGAGAGAGCAGGGCCTTGG + Intronic
1081741950 11:45447091-45447113 GGGAGTGCAGAGCTGGGGCTGGG - Intergenic
1081861008 11:46333296-46333318 CGGAGGGCAGCGCTGGGACTGGG + Intronic
1081968900 11:47185445-47185467 TTGAGGACAGAGCGGGGGGGAGG + Intronic
1082559867 11:54605661-54605683 TTGAGGAAAGAGCTGGGACTAGG - Intergenic
1082726262 11:56740552-56740574 CTGAGCATAAAGCAGGGGCTTGG - Intergenic
1082922666 11:58512418-58512440 CTGTAGACAGAGCTGGGTTTGGG - Intergenic
1083660321 11:64249042-64249064 TTGGGGGCAGAGCTAGGGCTGGG - Intergenic
1083792793 11:64996763-64996785 CAGAGTATAGAGCTGGGACTAGG + Intronic
1083879701 11:65542041-65542063 CTGAGCACAGAGTTGGGGAGTGG - Intronic
1083882861 11:65557139-65557161 CTAAGGTCAGGGCTGGGGATGGG - Intronic
1083888309 11:65583506-65583528 CAGAGGGCAAATCTGGGGCTTGG + Exonic
1083888835 11:65585679-65585701 CCAAGGACAGAGCTGGCGCGAGG + Intronic
1084080841 11:66823523-66823545 TTAAGAACAGAGCTAGGGCTGGG + Intronic
1084321888 11:68377788-68377810 CTGGGAGCAGAGCTGGGGGTGGG + Intronic
1084461263 11:69297913-69297935 CTGAGCCCAGAGCTTGGGCAGGG - Intronic
1084563325 11:69916082-69916104 CTGAGGACAAGGCGGAGGCTGGG - Intergenic
1084572915 11:69970300-69970322 TTGAGGCCAAGGCTGGGGCTGGG - Intergenic
1084576745 11:69993554-69993576 CTGAAGACCGAGCTGGGACTAGG - Intergenic
1084891306 11:72238400-72238422 CTGGGGCCATAGCTGGGCCTTGG - Exonic
1084930737 11:72553709-72553731 GTGAGCCCAGGGCTGGGGCTGGG + Intergenic
1084969431 11:72762555-72762577 CTCAGTACAGGGCTGGAGCTGGG - Intronic
1085481405 11:76825615-76825637 CTGAGGTCTGAGCTGGGCCGAGG + Intergenic
1087177127 11:95106245-95106267 GTGAGGTCAGAGCTGAGGCTTGG + Intronic
1088090264 11:106030124-106030146 CTGAGGTGAGAGCAGGGGGTGGG + Intergenic
1088090931 11:106038535-106038557 CAGAGGTCAGATCTGTGGCTAGG + Intergenic
1088792808 11:113241098-113241120 CTGAGGACAGGGCTGGCCCCAGG - Intronic
1089139110 11:116272271-116272293 CTGAGGACCCAGCTGGGCCTGGG + Intergenic
1089327361 11:117666516-117666538 CTGAGGACAAAGCTGCTGCCGGG + Intronic
1089353024 11:117832106-117832128 CTGAGGACTGACTTGGGCCTGGG - Intronic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089605492 11:119638944-119638966 GAGAGGCCAGAGCTTGGGCTGGG + Intronic
1089616656 11:119698600-119698622 TGGTGGACAGACCTGGGGCTGGG + Intronic
1089753178 11:120666344-120666366 CTGAGGACAGCGTTGGGACAGGG + Intronic
1090079971 11:123605656-123605678 CGGGGTCCAGAGCTGGGGCTAGG + Intronic
1090408664 11:126492788-126492810 AGGAGGAAAGAGCTGGGTCTCGG - Intronic
1090412002 11:126515705-126515727 CTGGGGACACAGCTGGGGGCTGG + Intronic
1090855878 11:130609035-130609057 GGGAGGGCAGAGCTGGGGCCGGG + Intergenic
1090864000 11:130679607-130679629 CTAAGGACATAGCTGAGACTGGG + Intronic
1091286531 11:134411615-134411637 CCGAGAACCGAGCTCGGGCTGGG - Intronic
1091320231 11:134644387-134644409 CTGAGGAGAGATCTGAGGGTGGG + Intergenic
1202806965 11_KI270721v1_random:10854-10876 CTGTGGCCTGGGCTGGGGCTTGG + Intergenic
1091844992 12:3648903-3648925 CTGTGGAATGAGCTGGGTCTGGG - Intronic
1092076206 12:5675707-5675729 GTAATGACAGAGCTGGGTCTTGG - Intronic
1093139470 12:15491132-15491154 CTGAGGCCAGAGCTGCTGTTTGG - Intronic
1095206766 12:39447146-39447168 GTGAGGTCAGAGTTGGGGCAGGG - Intergenic
1096258453 12:50076697-50076719 CTGCTGACAGAGCTGGGGGCAGG + Intronic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1096504189 12:52082330-52082352 CCCAGGACAGGGCTGGGGCGGGG + Intergenic
1096513097 12:52142680-52142702 CTGAGGACTGAGCTGGCCATGGG + Intergenic
1096550702 12:52369956-52369978 CTGAGCCCAGGGCTGGGGCTGGG + Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1096747788 12:53739592-53739614 CTGCGCTCAGAGCTGGGACTCGG - Intergenic
1097058876 12:56267586-56267608 CTAAGGACAGGGCTGGGGGCGGG - Intronic
1097068679 12:56339094-56339116 CTCAGGGCAGAGCTGTGCCTGGG + Exonic
1097183280 12:57183208-57183230 CTGAGGCCAGAGCATGGGCCGGG - Intronic
1098342802 12:69469725-69469747 CAGAGGCGAGAGCTGGGGTTGGG - Intergenic
1100435504 12:94567714-94567736 CTGAGGAGTGGGCTGGGGGTAGG - Exonic
1100634269 12:96420031-96420053 CTGAGAAAGGAGGTGGGGCTGGG - Intergenic
1100860743 12:98803697-98803719 CTGGGAACAGGGCTGGGGGTGGG + Intronic
1101267002 12:103099481-103099503 CAGAGGCCAGGACTGGGGCTTGG + Intergenic
1101898379 12:108772375-108772397 ATGAGGTCAGGGCTGTGGCTGGG + Intergenic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102080062 12:110090740-110090762 TAGATGGCAGAGCTGGGGCTGGG - Intergenic
1102529401 12:113534985-113535007 CTGAGTGCAGAGCTGCGGGTTGG + Intergenic
1102648226 12:114417793-114417815 CTGAGGACATGGCTGGAGATGGG - Intergenic
1103209265 12:119154651-119154673 CTGAGGGTGGAGCTGGGGCCGGG + Intronic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103727859 12:123007647-123007669 CTGAGGCCACCCCTGGGGCTTGG - Intronic
1103732791 12:123039009-123039031 CTAAGGGCAGAGCTGAGGGTAGG + Intronic
1104086967 12:125484289-125484311 GTGAGGACATTGTTGGGGCTGGG + Intronic
1104280689 12:127373937-127373959 CAGAGGAAAGAACTGGGACTTGG + Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1104709812 12:130977590-130977612 TTGAGAACAGAGCTGGAGCAAGG - Intronic
1104718808 12:131033366-131033388 CTGAGCACAGATGTGGTGCTTGG - Intronic
1104788665 12:131468353-131468375 ATGAGCACAGGGCTGGGGCTCGG + Intergenic
1105628622 13:22138661-22138683 CTGAGGACAGAAGTGGGGACAGG + Intergenic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1106109697 13:26765994-26766016 GTGAGGACAGAGCAGGGGCCGGG + Intergenic
1106340087 13:28819737-28819759 CTGGGGCTGGAGCTGGGGCTGGG + Intergenic
1106340097 13:28819761-28819783 CTGAGGCGGGAGCTGGGGCGGGG + Intergenic
1106563300 13:30864623-30864645 CAGAGGCCAAGGCTGGGGCTGGG + Intergenic
1106652524 13:31707145-31707167 CTGAGGTCAGACCTGTGCCTAGG - Intergenic
1107086310 13:36431475-36431497 CGGGCGACAGAGCTGGGGCTTGG - Intergenic
1108091504 13:46854607-46854629 CTGATGTCAGAGCCAGGGCTGGG - Intronic
1109115012 13:58371107-58371129 CTAAGGCCAGGGATGGGGCTTGG + Intergenic
1110008148 13:70297546-70297568 CTGAGATCAGAGCAGGTGCTGGG - Intergenic
1111402307 13:87755760-87755782 CTTATGTCAGAGCCGGGGCTTGG + Intergenic
1111546275 13:89741213-89741235 CCGGGTACAGAGCTGCGGCTGGG - Intergenic
1112062702 13:95756851-95756873 CTGTGCACAGGGCTGGGGTTGGG + Intronic
1112196818 13:97234484-97234506 CTGAGCACAGTGCGGGGGCGGGG + Intronic
1113160696 13:107377254-107377276 TTGAGGAAAGAGGTGGGACTGGG + Intronic
1113480255 13:110615410-110615432 CTTAGGCCAGAGCTGGGACCAGG + Intergenic
1113509140 13:110838066-110838088 GCGAGCACAGAGTTGGGGCTAGG + Intergenic
1114052172 14:18929789-18929811 CTGAGGACAGTGCTTCGGCGTGG + Intergenic
1114054174 14:18952383-18952405 CTGAGGACAGAGCTTTGGTGTGG + Intergenic
1114108382 14:19449549-19449571 CTGAGGACAGAGCTTTGGTGTGG - Intergenic
1114110387 14:19472135-19472157 CTGAGGACAGTGCTTCGGCGTGG - Intergenic
1114424052 14:22607714-22607736 CTGGGGAAAGGGCTAGGGCTGGG - Intronic
1114524241 14:23358582-23358604 GTGGGGTCAGAGCTGGGCCTGGG - Intronic
1114582295 14:23773151-23773173 CAGAGGGCAGGGCTGGGTCTAGG - Intergenic
1115501555 14:34054226-34054248 GTGAGGGGAGAGTTGGGGCTGGG - Intronic
1116915364 14:50520067-50520089 CATAAGACAAAGCTGGGGCTGGG + Intronic
1117585727 14:57201186-57201208 CTGATTCCAGAGCTGGGGCAAGG + Exonic
1117658666 14:57982405-57982427 CTGTGGACATAGCTGGTGCCTGG - Intergenic
1118298281 14:64590729-64590751 CTGAGGACAAACCTGTGGCCTGG - Intergenic
1118318441 14:64739378-64739400 CTGAGATCAGACCTGGGGCTGGG + Intronic
1118324862 14:64773895-64773917 CTGAGGACAGGGCCATGGCTGGG + Intronic
1118765195 14:68904842-68904864 CTGAGGATCGAGCTGGGGCTGGG - Intronic
1118822448 14:69354131-69354153 CTTAGGACAGAACTGGGCCCAGG + Exonic
1118846520 14:69551455-69551477 CTGAGGAAAGAGCTGTGACCAGG - Intergenic
1118867411 14:69714313-69714335 CTGAGGGCTCAGCTGGGACTGGG - Exonic
1119318880 14:73717905-73717927 CTGAGGTCAGAGCAGAGGCAAGG + Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120827644 14:88969915-88969937 CAGTGGCCAGAGCTGGGGCTTGG - Intergenic
1121153031 14:91654648-91654670 CTCTGGACCTAGCTGGGGCTGGG + Intronic
1122225964 14:100279784-100279806 CTGAGGACAGTGCCAGGGCCAGG - Exonic
1122359861 14:101152828-101152850 CGGAGGGCAGAGCTAGGGCCAGG - Intergenic
1122542259 14:102505097-102505119 TAGAGAACAGAGCTGGAGCTGGG + Exonic
1122785135 14:104160061-104160083 CCAAGGGCAGAGCAGGGGCTGGG - Intronic
1122853423 14:104548642-104548664 CTGGGGAGAACGCTGGGGCTGGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1122882146 14:104694996-104695018 CTGAGGACAGAGGAGGGACCTGG + Intronic
1123491298 15:20784381-20784403 CTGAGCACAGTGCAGGCGCTGGG - Intergenic
1123547800 15:21353472-21353494 CTGAGCACAGTGCAGGCGCTGGG - Intergenic
1124964418 15:34422785-34422807 CTGTGGACAGAGCTGGCTCCTGG - Intronic
1124981037 15:34569011-34569033 CTGTGGACAGAGCTGGCTCCTGG - Intronic
1125183296 15:36902062-36902084 CTGAGGAAATAACTGGGCCTGGG + Intronic
1125283032 15:38063403-38063425 CTGGGCACAGAGCCGGGGCTTGG - Intergenic
1125444315 15:39736985-39737007 CTTAGCACAGGGCTGGGGCGTGG + Intronic
1126612461 15:50543737-50543759 CTGATGACAGACATGTGGCTGGG - Exonic
1127247396 15:57192167-57192189 CTGAGACAAGATCTGGGGCTTGG + Exonic
1127362923 15:58260827-58260849 GTGTGGACAGAGCTGGGACTGGG + Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127447205 15:59076153-59076175 CTGTGGAGGGGGCTGGGGCTGGG - Exonic
1127681556 15:61303092-61303114 CCATGGACAGAGCTGGGGGTGGG - Intergenic
1127727891 15:61768279-61768301 CTGGTGTCAGAGCTGGGGCAGGG - Intergenic
1127983608 15:64051670-64051692 CTGAGGCCAGATCAGGGGCTAGG + Intronic
1128229954 15:66027521-66027543 CAGAGGGGAAAGCTGGGGCTTGG - Intronic
1128250357 15:66159679-66159701 ATGAGGATAGACCTGGGGCCTGG + Intronic
1128378266 15:67092637-67092659 CTGAGGAGGGTGCTGGGGGTAGG + Intronic
1128513443 15:68327436-68327458 ATGAGGACAAAGGTGGGCCTGGG - Intronic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1128739833 15:70075994-70076016 CTGAGGCTGGGGCTGGGGCTGGG + Intronic
1129035606 15:72646846-72646868 CTGAGCACAGAGCCAGGCCTGGG + Intergenic
1129214278 15:74090370-74090392 CTGAGCACAGAGCCAGGCCTGGG - Intergenic
1129222268 15:74137844-74137866 CAGAGGACAGACCTGAGGCTGGG - Intronic
1129327444 15:74808411-74808433 CTTAGGACAGAGGTGTGGCATGG + Intergenic
1129384665 15:75189357-75189379 ATGGGGACAGAACTGGGCCTGGG + Intergenic
1129494926 15:75970471-75970493 CAGGGTACAGAGCTGGGCCTTGG + Intronic
1129720410 15:77875005-77875027 CTGAGGTCAGCGGAGGGGCTGGG - Intergenic
1130059480 15:80559334-80559356 CTGTGGCCGGGGCTGGGGCTGGG - Intronic
1130097639 15:80867815-80867837 GTCAGGAGAGAGCTGGGCCTGGG + Intronic
1130232653 15:82108679-82108701 GGGAGCAGAGAGCTGGGGCTGGG + Intergenic
1130380417 15:83367490-83367512 CTGAGAACAGAACTGGAGCAGGG - Intergenic
1130610679 15:85358118-85358140 AAGAGGGCAGGGCTGGGGCTTGG + Intergenic
1131732630 15:95297916-95297938 ATGAGGGCAGAGCTGGGGATGGG - Intergenic
1132381403 15:101369106-101369128 CCGAGGACAAAGCTGGTGCCGGG + Intronic
1202956130 15_KI270727v1_random:80702-80724 CTGAGCACAGTGCAGGCGCTGGG - Intergenic
1132766044 16:1534651-1534673 CTCAGGGCAGAGCAGGGGCCAGG - Intronic
1132784640 16:1649216-1649238 CAAAGGACAGAGCTGAGCCTTGG - Intronic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133234172 16:4380167-4380189 CTGGTGACAGAGCTGGAGCTGGG - Intronic
1133269840 16:4605499-4605521 GGGAGGGCAGGGCTGGGGCTGGG - Intergenic
1133324194 16:4933465-4933487 CTGACTGCAGAGCTGGGTCTTGG + Intronic
1133383007 16:5346776-5346798 TTGACTACAGAGCTGGGACTGGG - Intergenic
1133777414 16:8908094-8908116 CTGAGAGCAGGGCTGGGACTGGG + Intronic
1133812370 16:9170503-9170525 CAGGGGACAGAGCTGGTCCTGGG + Intergenic
1134295296 16:12940191-12940213 CAGAGGCCAGAGCTTGGGCTTGG + Intronic
1134442395 16:14307085-14307107 CTGAGGCCACATCTGGGCCTCGG - Intergenic
1135113982 16:19710647-19710669 CCCAGGACAGAGACGGGGCTGGG + Intronic
1135382694 16:22007998-22008020 GGGAGGACGGAGCTGGGGCGCGG + Intronic
1136077045 16:27824339-27824361 CTGTGGAAAGAGCAGGGGTTTGG - Intronic
1136175995 16:28517172-28517194 CTGAGGCTGAAGCTGGGGCTGGG + Intergenic
1136383659 16:29909542-29909564 CTTAGCACAGAGCAGGGGCTTGG + Intronic
1136777489 16:32879584-32879606 CTGAGGGCTGGGCTGGGGCATGG - Intergenic
1136893135 16:33981930-33981952 CTGAGGGCTGGGCTGGGGCATGG + Intergenic
1137038923 16:35591854-35591876 CTGTGGGCCGAGCTGGGACTTGG + Intergenic
1137253627 16:46757926-46757948 CTGAGGACAGAGGAGAGGCCGGG + Intronic
1137269457 16:46893873-46893895 CTGAGGGCAGGGCAGGGGCGAGG + Intronic
1138271891 16:55701631-55701653 CTGTGGTCAGACATGGGGCTAGG - Intronic
1138386632 16:56639769-56639791 CTGGGGACAGAGCTTGGGCCAGG + Intronic
1138483800 16:57322454-57322476 ATAAGAACAGAGTTGGGGCTGGG + Intergenic
1138498772 16:57425541-57425563 ATGTGGACCGAGATGGGGCTGGG - Intergenic
1139305089 16:65978547-65978569 CTGAGCAGAGAGGTGAGGCTAGG - Intergenic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1139477404 16:67209634-67209656 CTGAGGAAGGTGCTGGGGCGGGG - Intronic
1139599271 16:67976818-67976840 CTGGGGACAGGGCTGGTGCCAGG - Intronic
1139630642 16:68230069-68230091 TGGAGGATGGAGCTGGGGCTTGG + Exonic
1139747934 16:69089446-69089468 CTGAGGTCAAAGCTGCTGCTGGG - Intergenic
1140074805 16:71688714-71688736 ATGAGGACAAGGCTGGGGATTGG - Intronic
1140523527 16:75602844-75602866 CTAAGGATAGAACTGGGGCTTGG - Intronic
1140753352 16:78046023-78046045 CTGAGGGCAGTGCTGCTGCTTGG + Intronic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1141624767 16:85255259-85255281 CAGAGGCCAGAGCCTGGGCTTGG + Intergenic
1141725058 16:85782494-85782516 TTGAAGGCAGAACTGGGGCTTGG - Intronic
1142108295 16:88317999-88318021 CAGAGGACAGGGCTGGGGCCAGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142118994 16:88376766-88376788 CAGACAGCAGAGCTGGGGCTTGG + Intergenic
1142123866 16:88400632-88400654 GTGGGGACAGAGCTGGCTCTGGG - Intergenic
1142261419 16:89044183-89044205 CTGATGCCCGATCTGGGGCTGGG + Intergenic
1142336935 16:89495369-89495391 CTGACCACAGAGCTGAGGCCAGG - Intronic
1142433049 16:90040804-90040826 CTGAGTCCACAGGTGGGGCTGGG + Intronic
1203079902 16_KI270728v1_random:1141693-1141715 CTGAGGGCTGGGCTGGGGCATGG - Intergenic
1142923173 17:3208904-3208926 CAGAGGACAGCGATGGAGCTGGG - Intergenic
1143452581 17:7044311-7044333 CTAAGCACAGAGCTGGCACTTGG - Intergenic
1143747403 17:9004140-9004162 CGGACGGCGGAGCTGGGGCTCGG + Intergenic
1143975880 17:10829277-10829299 CAGAGAAGATAGCTGGGGCTGGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144300116 17:13915550-13915572 TTGAGGAAAGAACAGGGGCTTGG - Intergenic
1144453394 17:15399608-15399630 CTCAGAACAGAGCTGGACCTCGG - Intergenic
1144667648 17:17112708-17112730 CTGAGGACAGGGCTGCAACTGGG + Intronic
1144799408 17:17914694-17914716 CAGAGGACTGGGCAGGGGCTAGG - Intronic
1145017665 17:19409776-19409798 CTGAAGGCAGAGCTGTGGCACGG + Intergenic
1145037451 17:19551264-19551286 CTCAGGACAGGGCTGGGGCCAGG - Intronic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146056681 17:29584871-29584893 CTGTGGGCAGAGCTCAGGCTGGG - Intronic
1146269810 17:31477374-31477396 CTGAGGAAGGAGCCTGGGCTTGG + Intronic
1147438696 17:40433623-40433645 CTGAGGTTAGATCTGGGGCCCGG + Intergenic
1147631994 17:41938241-41938263 CTGAGGACACAGCTTGAACTGGG + Intronic
1147653300 17:42073985-42074007 CTGAGGGGAGAGCAGGGGCAAGG - Intergenic
1148194503 17:45703566-45703588 CTGAGGACAGAGCAGCGCCTGGG - Intergenic
1148664136 17:49362028-49362050 CTGAGGACAGACGTTGGGCAGGG - Intronic
1148851599 17:50558310-50558332 GTGATGTCAGAGCTGAGGCTTGG + Intergenic
1149684796 17:58529115-58529137 CTGAGGACAGGACTGAAGCTGGG - Intronic
1149981303 17:61313592-61313614 TGGAGGACAGAGCTTGGACTCGG + Intronic
1150009817 17:61493239-61493261 CTGAAGCAAGAGCTGGGTCTGGG + Intergenic
1150131975 17:62674380-62674402 CTCAGGACTGGGCTGGGGGTGGG - Intronic
1150484688 17:65535722-65535744 CTGAGGACACAGCCAGGGCGAGG + Intronic
1150576213 17:66433269-66433291 CCGGGGCCAGAGCTGGGGCCGGG - Intronic
1151309672 17:73285608-73285630 CTGCGGGCTGAGCCGGGGCTGGG + Exonic
1151450108 17:74193611-74193633 CTGAGAACAGAGGTCTGGCTGGG - Intergenic
1151716653 17:75834595-75834617 GTAAGGCCAGAGCTGGGGCTGGG - Intronic
1152047985 17:77951025-77951047 CTTAGAACAGAGCTGGCACTGGG - Intergenic
1152073433 17:78145252-78145274 CCGAGGCCAGGGCTGGGGCCAGG - Intergenic
1152100552 17:78299378-78299400 GTGGGGGCAGAGCTGGGACTCGG + Intergenic
1152323902 17:79624605-79624627 CAGAGGACTGAGGTGGTGCTAGG - Intergenic
1152361719 17:79835966-79835988 CTGAGCACAGAGGTGGGGCTTGG - Intronic
1152389413 17:79993792-79993814 TTGATGCAAGAGCTGGGGCTCGG + Intronic
1152423547 17:80206852-80206874 CTGAGGGCAGGGCAGGAGCTGGG - Intronic
1152430581 17:80246400-80246422 CTGGGGACAGGGGTGGGGGTAGG - Intronic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152582142 17:81170875-81170897 GTGGGTACAGGGCTGGGGCTGGG - Intergenic
1152621009 17:81364833-81364855 CTGCGGGCAGCGCTGGGACTGGG - Intergenic
1152669410 17:81593330-81593352 CTGAGCACAGGGCTGGGTCCAGG - Intronic
1152735579 17:81995430-81995452 CTCAGGACAGTGCTGGGCCTGGG - Intronic
1152740481 17:82016374-82016396 CTGAGGGTGGAGCTGGGGCCTGG + Intronic
1152810530 17:82379804-82379826 ATGAGGACGGGGCCGGGGCTGGG - Intergenic
1152899823 17:82934105-82934127 CTGAGGACTAACCTGGGCCTGGG - Intronic
1152938884 17:83155299-83155321 CTCAGGTCTGAGCTGGGGCAGGG - Intergenic
1153929319 18:9864923-9864945 CTGAAGGCTGAACTGGGGCTGGG + Intergenic
1153967496 18:10195116-10195138 TTGAGGACAGGACTGGAGCTGGG - Intergenic
1154354268 18:13612848-13612870 CTGAGGACAGAGCTGAGAAGAGG + Intronic
1154486702 18:14877672-14877694 CTGAGGTCACAGGTGGGACTGGG + Intergenic
1156463296 18:37333653-37333675 GAGAGGGCAGAGCTGGGGCAGGG - Intronic
1157204571 18:45687545-45687567 GTGGGGCCAGGGCTGGGGCTGGG + Intergenic
1157505466 18:48223125-48223147 CTTAGGGAAGAGCTGGGGATGGG + Intronic
1157555555 18:48610782-48610804 ATGGAAACAGAGCTGGGGCTTGG - Intronic
1158242068 18:55388749-55388771 CTGAAGGCAGAGATGGGACTGGG - Intronic
1158306069 18:56107001-56107023 CTGAAGACTGAACTGGGGCCCGG + Intergenic
1158488266 18:57887606-57887628 CTCAAAACAGTGCTGGGGCTCGG + Intergenic
1158535144 18:58301837-58301859 CTGATGACAGAGCTGGGCTTGGG - Intronic
1160591529 18:79947576-79947598 CAGAGAGCAGAGGTGGGGCTGGG - Intronic
1160675708 19:390148-390170 CTGGGGCCTGAGCTGGGGTTGGG + Intergenic
1160811699 19:1015607-1015629 CTGAGGACCCAGCTGGGCCAAGG + Intronic
1160849658 19:1184199-1184221 ATGATGCCAGGGCTGGGGCTGGG - Intronic
1161038181 19:2096776-2096798 CTGAGGACGGAGGCGGGGCTGGG + Intronic
1161149982 19:2702540-2702562 CTGCGGACCGAGTTGGGGGTCGG - Intronic
1161232352 19:3180593-3180615 CAGAGGCCAGAGATGGGGCATGG - Intergenic
1161237684 19:3206056-3206078 CCGGGGGCAGGGCTGGGGCTGGG - Intronic
1161573214 19:5041487-5041509 CTGAGGCCAGAGGTGGGGCCAGG - Intronic
1161778920 19:6279003-6279025 CTCAGGCCAGGGCTGGGGTTGGG + Intronic
1161818736 19:6516309-6516331 CTGAGGAGTGGGCTGGGCCTGGG + Intergenic
1161942111 19:7411725-7411747 ATGAGGACAGAGTTGCAGCTTGG - Intronic
1162013664 19:7832127-7832149 CTGAGGCCAGAGCTGGGAGTGGG - Intronic
1162447149 19:10730547-10730569 CAGAGGACAGCCCTGGGTCTTGG + Intronic
1162597422 19:11640016-11640038 CCGAGGACCGAGCTGGGCCAGGG - Intergenic
1162724097 19:12679612-12679634 CAGAACACAGAGGTGGGGCTGGG - Exonic
1162798716 19:13099516-13099538 CTGCGGCCAGAGCTGCGGCTTGG + Exonic
1163448572 19:17362116-17362138 TGGAGCACAGGGCTGGGGCTGGG - Intronic
1163476039 19:17526812-17526834 CTGAGGTCAGTGCTGGGGCAGGG - Intronic
1163478800 19:17542454-17542476 TGGTGGACAGAGCTGGGGCAGGG + Intronic
1163638767 19:18450136-18450158 CTGCAGTCAGAGCTGGGGCCTGG + Intronic
1163691511 19:18741143-18741165 GTTTGGACAGAGATGGGGCTTGG + Intronic
1163702617 19:18793756-18793778 CTGGTCACAGTGCTGGGGCTTGG + Intergenic
1164211160 19:23098499-23098521 CTGTGGACAGGGCTGAGGCAGGG - Intronic
1164594384 19:29524407-29524429 CTGAGGACAGCAATGGGGCCTGG + Intergenic
1164747198 19:30625143-30625165 ATGAGGCCAGAGCTGAGGGTGGG + Intronic
1164987262 19:32657649-32657671 CTGATGGCAGAGCTTGGCCTGGG + Intronic
1165059448 19:33197970-33197992 CAGCAGACAGGGCTGGGGCTAGG - Intronic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1165169796 19:33883961-33883983 CTGAGCCCAGGGCTGAGGCTTGG + Intergenic
1165352701 19:35284814-35284836 CCCAGGACAGAGCTGGAGCCAGG + Exonic
1165523573 19:36332992-36333014 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1165606293 19:37107461-37107483 GTGAGCACAGGGTTGGGGCTAGG + Intronic
1165723395 19:38095634-38095656 CTGGGGACAGGGCAGGGGCAGGG + Intronic
1165784373 19:38452633-38452655 CCAAGGGCAGAGCTGGGACTGGG - Intronic
1165810910 19:38611191-38611213 GAGAGGGCAGGGCTGGGGCTGGG - Intronic
1165898871 19:39159244-39159266 CTGAGGACAAAGCAGTGGCTAGG + Intronic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1165943750 19:39428884-39428906 AAGGCGACAGAGCTGGGGCTGGG - Intergenic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166214017 19:41324084-41324106 CAGAGGGCATAGCTGAGGCTCGG - Exonic
1166214814 19:41327953-41327975 CCGAGGCACGAGCTGGGGCTGGG + Intronic
1166268585 19:41700187-41700209 GTGAGGGCTGAGATGGGGCTAGG + Intronic
1166541866 19:43611026-43611048 CAGAGGACAGAGTTTGTGCTGGG - Intronic
1166547425 19:43641559-43641581 CTGAGGACAGAGAGGATGCTGGG - Intergenic
1166722663 19:45006030-45006052 CTGAGGACAGGCCTGGCCCTGGG + Intronic
1166732715 19:45067929-45067951 CTGAGGGCAGTGCTGAGGCTGGG + Intronic
1167154333 19:47729163-47729185 GTGTGGTCAGAGCTGGGGCGGGG + Intronic
1167291884 19:48629169-48629191 CTGGGGACTGGGGTGGGGCTGGG + Exonic
1167573446 19:50305249-50305271 ATGAGGCCTGAGCTGGGGCTGGG + Intronic
1167677185 19:50894633-50894655 CAGAGGAAAGGGCTTGGGCTAGG - Intergenic
1167725726 19:51211636-51211658 CTCAGGACAGGGCTTGGGATGGG + Intergenic
1167792885 19:51691879-51691901 GGGAGGACAGAGATGGGGCTGGG + Intergenic
1167820675 19:51925021-51925043 GTGAGCACAGGGTTGGGGCTAGG - Intronic
1167826997 19:51983084-51983106 CTGAGCACAGGGTTGGGGCTAGG - Intronic
1168000710 19:53443901-53443923 GTGAGCACAGGGTTGGGGCTAGG - Intronic
1168056226 19:53866664-53866686 ATGAGGATGGGGCTGGGGCTGGG - Intronic
1168243487 19:55098627-55098649 CTGAGGCTGGGGCTGGGGCTGGG + Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168305503 19:55433137-55433159 CTGAGGCCAGGGCCGGGTCTGGG - Exonic
1168322209 19:55517327-55517349 CAGAGGTCAGCGCTGGGCCTGGG - Exonic
1168331599 19:55573136-55573158 CTGAAGACAGTGCTTGGGCCTGG - Intergenic
1168581148 19:57556834-57556856 GTGAGCACAGGGTTGGGGCTAGG - Intronic
1168614069 19:57823751-57823773 GTGAGCACAGGGTTGGGGCTAGG - Intronic
1168638559 19:58014954-58014976 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
925071940 2:976721-976743 CAGAGGACAGGGCTGGGGAGTGG - Intronic
925192237 2:1893923-1893945 CTGAGGACAGTGCCCAGGCTGGG + Intronic
925750961 2:7090290-7090312 CTGAGGAAAGGCCTGGGGCAGGG + Intergenic
925981507 2:9180991-9181013 CTGAGGCAAGATCTGGAGCTAGG - Intergenic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926295797 2:11567679-11567701 CTGAGTGCAGAGCTGAGGCCAGG + Intronic
926356277 2:12043612-12043634 CTGAGGACAGGAGTGGTGCTAGG + Intergenic
926882050 2:17556580-17556602 CTTAGGACAGAGCGGGGGATAGG + Intronic
927210628 2:20637002-20637024 CAGAGTACAGAGCTGGGGAGGGG + Intronic
927513620 2:23659560-23659582 GTGAGGACAGAGGAGGGGCCTGG + Intronic
927702186 2:25275720-25275742 CTGAGGACCCAGCAGGGCCTAGG + Intronic
927758128 2:25725115-25725137 CTCAGGAGGGAGGTGGGGCTAGG + Intergenic
927838216 2:26418343-26418365 TGCAGGACAGAGCTGGGGGTGGG + Intronic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
928103666 2:28453766-28453788 CTGTGGACAGAGGTGGGCCAGGG + Intergenic
928125807 2:28614999-28615021 CTGAGGAGCGTGATGGGGCTGGG + Intronic
928321934 2:30290879-30290901 GTGAGGTCAGACCTGGAGCTTGG + Intronic
929462212 2:42110919-42110941 TTGAGGCCAGAGCAGGGTCTGGG + Intergenic
930236518 2:48894032-48894054 CAGAGGTCAGAGCTGGGGGTAGG + Intergenic
930600940 2:53442377-53442399 CTGTGGACAGAGCTGAGAATTGG + Intergenic
931219678 2:60277807-60277829 GTGAGGACAGAGTGGGGTCTTGG + Intergenic
931789213 2:65648482-65648504 CTGGGGACAGAGCTCAGGCTGGG + Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
932024933 2:68123268-68123290 CTTAGGCCAGATCTGGGTCTTGG - Intronic
932356394 2:71071628-71071650 TTGAGAAAAGAGCTGGGGCTGGG + Intronic
932418752 2:71589061-71589083 CTGAGGACAGAGGTGGGGACAGG - Intronic
932619439 2:73257138-73257160 CTGAGGACAGGGCTGGTGCAGGG + Exonic
933776643 2:85774942-85774964 CTGAGGAAGGAGCTGGGGTTGGG - Intronic
933973513 2:87489458-87489480 CAGAGGCAGGAGCTGGGGCTGGG + Intergenic
934738734 2:96703732-96703754 CTGAGCACAGAGCTGTGGGGTGG - Intergenic
935211064 2:100939563-100939585 CTGAGGACAGAAGAGGAGCTGGG + Intronic
935230679 2:101093301-101093323 CTTGGAACAGTGCTGGGGCTAGG - Intronic
935308899 2:101763085-101763107 CCGAGGTCACAGCAGGGGCTAGG - Intronic
935788580 2:106570796-106570818 CTGAGGGAAAAGGTGGGGCTCGG + Intergenic
936018429 2:108976880-108976902 CTGACTCCAGAGCTGGGGCAGGG - Intronic
936320212 2:111460755-111460777 CAGAGGCAGGAGCTGGGGCTGGG - Intergenic
937162764 2:119781194-119781216 CTGATTTCAGAGCTGGGGCAAGG - Intronic
937230689 2:120396550-120396572 CTGAGGACAGTGGTGGGTCGGGG + Intergenic
937249462 2:120514520-120514542 CAGAGGGCAGAGCTGGGACTAGG - Intergenic
937777003 2:125789783-125789805 TTCAGGACAGAGCTGGGGTGGGG - Intergenic
937912856 2:127084498-127084520 CTGATGCCAGGGCTGGGGCAGGG - Intronic
938207710 2:129438310-129438332 CTGAGGCCAGGTCTGGGGCATGG - Intergenic
938339128 2:130523790-130523812 GAGAGGGCAGAGCTCGGGCTGGG - Intronic
938350710 2:130596960-130596982 GAGAGGGCAGAGCTCGGGCTGGG + Intronic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
938482578 2:131673763-131673785 CTGAGCACAGTGCAGGCGCTGGG + Intergenic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
941859510 2:170264126-170264148 GCGAGCACAGGGCTGGGGCTAGG + Intronic
942420854 2:175806061-175806083 CTGAGGTCAGAGCTGGCTCTAGG - Intergenic
942457919 2:176150733-176150755 TGGAGGGCAGAGCTGGGACTGGG - Intergenic
943161646 2:184261361-184261383 CAGAGGACAGGGGTGGGCCTGGG + Intergenic
943446391 2:187992947-187992969 ATGTGGACAGAGCTCTGGCTGGG + Intergenic
944763404 2:202840464-202840486 CCGAGGCCATAGCTGAGGCTGGG + Intronic
945007379 2:205423214-205423236 CTGAGGACACAGCACTGGCTGGG - Intronic
946371859 2:219285964-219285986 CTGGGGAGAGAGCAGGGGCGGGG - Exonic
946700208 2:222404678-222404700 CAGATGACAGACATGGGGCTTGG - Intergenic
947963574 2:234260096-234260118 CTGAGGCTGGGGCTGGGGCTGGG - Intergenic
948094745 2:235324670-235324692 CAAAGGAGGGAGCTGGGGCTGGG + Intergenic
948150057 2:235737967-235737989 CAGAGGGCAGGGCTGGAGCTGGG + Intronic
948232997 2:236365583-236365605 CTGAGGACAGAGCCTTGGGTTGG + Intronic
948656158 2:239477749-239477771 GTCAGGACGGAGGTGGGGCTGGG + Intergenic
948692597 2:239715978-239716000 GTGACCACAGAGCTGGTGCTGGG + Intergenic
948697271 2:239738138-239738160 CTGGGGCCGGGGCTGGGGCTGGG - Intergenic
948697281 2:239738156-239738178 CTGGGGCCGGGGCTGGGGCTGGG - Intergenic
948697336 2:239738251-239738273 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
948826523 2:240575775-240575797 ATGAGAACAGGGCTGGGGTTGGG + Intronic
948830329 2:240595472-240595494 CTCAGGTCAGAGCCGGGTCTGGG - Intronic
948834800 2:240620695-240620717 CTGAGCACAGGGCGGGGTCTTGG + Intronic
948908931 2:240993449-240993471 CTGAGAACCGTGCTGGGGTTTGG + Intergenic
1168760325 20:346437-346459 CCCAGGGCAGAACTGGGGCTAGG + Intergenic
1168964420 20:1890721-1890743 CGGAGGACATAGCAGGGGCTCGG + Intergenic
1168992242 20:2104323-2104345 CTGAGACCACAGCTGGGACTCGG - Intronic
1169200677 20:3707753-3707775 ATGGGGACAGAGCTGGGGGCAGG - Intergenic
1169327024 20:4684730-4684752 GGGAGGACAGAGCTGGGGTGGGG - Intergenic
1169916290 20:10686944-10686966 CTGGGGGCAGAGCTGGGGGCGGG - Intergenic
1170693750 20:18638627-18638649 CTGAGGCCAGAGCTGTGACCTGG + Intronic
1171204409 20:23267687-23267709 CTGAGGAAGGGGCTGGGGCTAGG + Intergenic
1171290985 20:23982767-23982789 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1171386078 20:24770202-24770224 CAGAGGAGAGAGACGGGGCTGGG + Intergenic
1171783345 20:29441108-29441130 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1171900373 20:30850719-30850741 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1171946971 20:31387605-31387627 CTGTGGGCAGAGCTAGGGATGGG - Intronic
1172327491 20:34047896-34047918 CTGAGGGCAAAGGTGGGGTTGGG - Intronic
1172482268 20:35277986-35278008 GTGAGGGCAGAGCCGGGGCGGGG - Intergenic
1172763214 20:37336490-37336512 CTGAGGAGAGAAATGGGTCTGGG + Intergenic
1173147151 20:40534741-40534763 CTGAGGACAGGACTGGGGAGGGG - Intergenic
1173219953 20:41124519-41124541 CTCAGGCCAGAGTTGGGGCTGGG + Intergenic
1173530812 20:43768063-43768085 CTCAGGATAGAGCTGGAACTTGG + Intergenic
1173857575 20:46260544-46260566 CTAAGTACAGAACTGGGGCCTGG + Intronic
1174104905 20:48155230-48155252 GTCAGGGCAGAGATGGGGCTGGG - Intergenic
1174419604 20:50391037-50391059 CTGAAGGCAGAGCTGGAACTGGG + Intergenic
1174789246 20:53462511-53462533 CTGAAGCCAGGGCTGGGGCAGGG - Intronic
1175445825 20:59018813-59018835 GGGACGACAGAGCAGGGGCTGGG + Intergenic
1175478826 20:59297152-59297174 ATCAGGACACTGCTGGGGCTCGG - Intergenic
1175507423 20:59495748-59495770 GTGAGGACAGCCCTGGGGCTTGG - Intergenic
1175579132 20:60085777-60085799 CTGAGGACAGGAATGGGGCTAGG + Intergenic
1175581029 20:60099800-60099822 ATGAGGGCAGGGCTGGGGTTGGG + Intergenic
1175810091 20:61853166-61853188 CTGGGGACAGCGGTGGGCCTGGG + Intronic
1175967615 20:62667364-62667386 CCGAGGACTGGGGTGGGGCTGGG + Intronic
1176106550 20:63392249-63392271 TTGAGGGCTGAGCAGGGGCTGGG + Intergenic
1176447324 21:6831434-6831456 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1176794600 21:13361727-13361749 CTGAGGTCACAGGTGGGACTGGG - Intergenic
1176825492 21:13696460-13696482 CTGAGCACAGTGCAGGTGCTGGG + Intergenic
1178249106 21:30985138-30985160 CTGAGGACAGGGCTGTGTTTGGG - Intergenic
1179482164 21:41685360-41685382 CTGAAGGCAGAGCTGGGTGTGGG - Intergenic
1179547380 21:42121928-42121950 GTGAGAACAGAGCTGGTGATGGG + Intronic
1179710086 21:43208219-43208241 CTGGGGTCAGAGAAGGGGCTGGG + Intergenic
1179840598 21:44070493-44070515 CTCAGGGCAGAGCGGAGGCTTGG + Intronic
1179902314 21:44400569-44400591 ATGAGATCAGTGCTGGGGCTGGG - Intronic
1179925911 21:44533943-44533965 CTCAGGACGGGGCTGGGGGTAGG + Intronic
1180024176 21:45149243-45149265 CAGAGGACAGAGCTGGTGTCAGG - Intronic
1180070244 21:45432226-45432248 TGAAGGTCAGAGCTGGGGCTGGG + Intronic
1180470644 22:15652162-15652184 CTGAGGACAGTGCTTCGGCGTGG + Intergenic
1180472645 22:15674762-15674784 CTGAGGACAGAGCTTTGGTGTGG + Intergenic
1180766429 22:18348319-18348341 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1180779886 22:18514059-18514081 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1180812600 22:18771380-18771402 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1180866892 22:19124824-19124846 CCCAGGGCAGATCTGGGGCTGGG - Intergenic
1180951957 22:19724483-19724505 CTGAGGAGAGAACCGGCGCTGGG + Exonic
1180972801 22:19824390-19824412 GGGAGGACAGGGCCGGGGCTGGG - Intronic
1181027561 22:20134625-20134647 CTGAGTGCAGAGAGGGGGCTGGG - Intronic
1181035542 22:20168240-20168262 CAGAACACAGAGCTGGGACTCGG - Intergenic
1181198759 22:21205628-21205650 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1181275215 22:21683718-21683740 CTGAGGTCAGGGTTGGGGCTGGG + Intronic
1181280139 22:21713993-21714015 GTGAGGACACTGCTGGCGCTTGG - Intronic
1181333229 22:22110964-22110986 CTCAGGACAGAGCAGGGGCATGG + Intergenic
1181400978 22:22650171-22650193 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1181515084 22:23405582-23405604 CTGGGGACAGAGGTGGGCGTGGG - Intergenic
1181534843 22:23536188-23536210 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1181687813 22:24541688-24541710 CTCAGGACAGTGGTGGAGCTGGG - Intronic
1183096610 22:35555808-35555830 GTGGGGCTAGAGCTGGGGCTGGG - Intergenic
1183099655 22:35575960-35575982 TTGAGGAGAGAGCCGGGACTCGG - Intergenic
1183185312 22:36288462-36288484 CTGAGTTCAGAGCTAGGGCAGGG - Intronic
1183383959 22:37504339-37504361 CTGAGGACTGGGATGGTGCTGGG - Intronic
1183465390 22:37977837-37977859 CTGATGACAGAGCTGAGGGTGGG - Intronic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1183697741 22:39432745-39432767 CTTAGGGCAGAGCAGGTGCTGGG - Intronic
1184022347 22:41829211-41829233 CTGAGGACAGTGATGGGGAAGGG - Intergenic
1184147394 22:42619504-42619526 ATGAGGACAGGGATGGGGCTGGG + Exonic
1184150689 22:42636647-42636669 CTGAGCACAGAGTAGGTGCTGGG + Intronic
1184244294 22:43228096-43228118 ATCAGGACATAGCTGGTGCTTGG - Intronic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1184549325 22:45196141-45196163 CCGAGGGCAGGCCTGGGGCTGGG + Exonic
1184907346 22:47497776-47497798 CTTGGGGCAGGGCTGGGGCTGGG + Intergenic
1185139033 22:49089992-49090014 CTCAGCAGAGAGCAGGGGCTTGG + Intergenic
1185231689 22:49687480-49687502 TGGAGCACACAGCTGGGGCTGGG + Intergenic
1185285504 22:49998025-49998047 CTTCAGGCAGAGCTGGGGCTGGG + Exonic
1185314646 22:50173833-50173855 GTGAGGACAGAAGTGGGGCTGGG - Intronic
1185376986 22:50487211-50487233 CTGAGGCCAGGGCAGGGGCTGGG + Intronic
1185388630 22:50547680-50547702 ATGAAGCCAGGGCTGGGGCTAGG - Intergenic
1185388652 22:50547758-50547780 CTGAGGTTGGAGCTGGGGCTGGG - Intergenic
1203228046 22_KI270731v1_random:89209-89231 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
949953505 3:9248688-9248710 CTGCAGATAGCGCTGGGGCTGGG - Intronic
950109036 3:10406903-10406925 CAGATGACAAAGCAGGGGCTCGG - Intronic
950126898 3:10515085-10515107 CAGAGCATAGAGCAGGGGCTTGG + Intronic
950207517 3:11092160-11092182 GAGAGGGCAGAGCTGGGCCTGGG + Intergenic
950526310 3:13526311-13526333 CTGAGGACAGGGATGAGGATGGG + Intergenic
950841675 3:15974017-15974039 CTGAGGGCAGAGCTCGGAGTAGG + Intergenic
952210158 3:31222303-31222325 CAGAGGACAGACCTGGGTCAGGG - Intergenic
952531332 3:34265194-34265216 CTGAGCACAGAGCTGGAATTTGG + Intergenic
953574576 3:44102756-44102778 TTCAGGACAGAGCTGGCGATGGG + Intergenic
953666094 3:44927662-44927684 CTCAGGAAAAAACTGGGGCTGGG + Intronic
953670548 3:44958719-44958741 GTGAAGACAGTGCTGGAGCTAGG - Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
953850981 3:46465177-46465199 CTGAGACCAGAGCTGGGACAGGG - Intronic
953980447 3:47410656-47410678 CTGAGGATGGGGCTGGGGCTGGG - Exonic
954099418 3:48357922-48357944 CTAAGATCAGAGCTGGTGCTGGG + Intergenic
954153716 3:48673155-48673177 CAGAGGCCAGGGCTGGGGGTAGG + Intergenic
954430557 3:50468693-50468715 CTGAGGCCAGAGCTGAGGATCGG - Intronic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954636378 3:52073109-52073131 CTGAGGGCAGAGCTGGGGGTGGG - Intergenic
954648226 3:52144259-52144281 CTGAGTGAAGGGCTGGGGCTTGG - Intronic
954675260 3:52311994-52312016 CTGGGGAGGGAGCTTGGGCTGGG - Intergenic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
954976957 3:54705032-54705054 CAGATGACAGTGCAGGGGCTGGG - Intronic
955004167 3:54953854-54953876 CTGAGGAAAGGCCTGGGACTTGG + Intronic
956694118 3:71904218-71904240 GTGAGGACAGAGGTGGGGACTGG + Intergenic
957082130 3:75645454-75645476 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
957409493 3:79819642-79819664 CAGAGGACAAAGCTGGACCTTGG + Intergenic
957436791 3:80187913-80187935 CTGAGGACAAGGATGTGGCTAGG - Intergenic
958994793 3:100891919-100891941 CACAGCATAGAGCTGGGGCTGGG + Intronic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
961021701 3:123513000-123513022 CTGATTCCAGGGCTGGGGCTGGG + Intronic
961039219 3:123665293-123665315 TGAAGGACAGAGCTGGGACTTGG + Intronic
961368176 3:126414518-126414540 GTGAGGGCTGAGCTGGGCCTTGG - Intronic
961384670 3:126516728-126516750 CTCAGGGCAGAGCTGGCGCTGGG - Intronic
961452578 3:127009052-127009074 CTGAGGCGAGAGCTGGTCCTGGG + Intronic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961733834 3:128987900-128987922 CTGAGGGCCAGGCTGGGGCTGGG - Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
962351173 3:134656760-134656782 CTGACAACTGAGCTGGGGCGTGG - Intronic
962419736 3:135217235-135217257 CTGAGGGCAGTGCTGAGGATAGG + Intronic
964010678 3:151887881-151887903 CTGAAGCTGGAGCTGGGGCTGGG + Intergenic
964011579 3:151898490-151898512 CTGAAGCTGGAGCTGGGGCTGGG - Intergenic
964087450 3:152835132-152835154 CTCCGGACAGAGCTGGGCCTGGG + Exonic
964423341 3:156528097-156528119 CTGAGGACAAAGCAGGTTCTAGG - Intronic
966602991 3:181794133-181794155 CTGAGGCAAAAGCAGGGGCTGGG - Intergenic
966882023 3:184355845-184355867 CTGAGGTCAGAGCAGAGCCTTGG + Intronic
968224093 3:196962167-196962189 GTGAGCACAGGGTTGGGGCTAGG - Intronic
968589707 4:1451198-1451220 GTGTGGACAGAGCAGGTGCTCGG + Intergenic
968729840 4:2264525-2264547 CTGAGGGCTGAGCTGCAGCTAGG + Intergenic
968808258 4:2788633-2788655 CTGAGGACAGGGCTGGGGGCTGG - Intergenic
968945529 4:3661573-3661595 CTGAGGACAAGGCTGGTGGTGGG - Intergenic
969255928 4:6001870-6001892 CCAAGGGCAGGGCTGGGGCTGGG - Intergenic
969398755 4:6939731-6939753 CTGAGGAGAGGGGTGGGGGTGGG + Intronic
969511369 4:7619929-7619951 CTGGGGACAGGGCAGGGGCAGGG - Intronic
970144104 4:13014651-13014673 CTGAGCTCAGTCCTGGGGCTGGG - Intergenic
971497626 4:27284003-27284025 CTAAGGAAAGGGCTGGGACTAGG + Intergenic
971805734 4:31355951-31355973 CTGAGGACTGAGCTGGGAAAGGG - Intergenic
972445301 4:39137665-39137687 CTGATTCCAGAGCTGGGGCATGG + Intergenic
974850955 4:67404713-67404735 CTGAGGACTAAGCTTGGGCATGG + Intergenic
976143176 4:82014483-82014505 GAGAAGACAGAGCTGAGGCTGGG + Intronic
976647273 4:87399638-87399660 CTTGTGACAGCGCTGGGGCTGGG - Intergenic
977608499 4:99007863-99007885 CTGATTGCAGATCTGGGGCTGGG - Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
979259488 4:118634218-118634240 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
979351669 4:119650703-119650725 CTGAAGCCAGAGCAGAGGCTTGG + Intergenic
981548496 4:145918707-145918729 CTGGGGTGAGAGCTGGGGGTGGG - Intronic
981681066 4:147398539-147398561 CTGAGGACTGATCAGGGGATAGG - Intergenic
982158131 4:152540877-152540899 CTGAGATCAGAGCAGGTGCTAGG + Intergenic
983131314 4:164022985-164023007 CAGAGGACAGAGGTGTGGCCTGG + Intronic
984885680 4:184447144-184447166 CTGACTCCAGAGCTGGGGCAGGG + Intronic
985305858 4:188538682-188538704 CTGAGGAAGGAGGTGGGACTTGG - Intergenic
985532091 5:439796-439818 AGGTGCACAGAGCTGGGGCTGGG + Intergenic
985580997 5:695059-695081 AGGAGGACAGAGCTGAGCCTTGG + Intergenic
985595622 5:786391-786413 AGGAGGACAGAGCTGAGCCTTGG + Intergenic
985664827 5:1176684-1176706 CTGGGGCCAGAGCCGGGGCTGGG - Intergenic
985936390 5:3101156-3101178 TGGAGGACAGAGCCGAGGCTGGG - Intergenic
986153410 5:5148964-5148986 ATGAGGACAGGGCTTGGACTTGG - Intronic
986370625 5:7077186-7077208 CTGAGGACAGAGCCGGGTGGGGG - Intergenic
986685750 5:10274070-10274092 CTCTGGACAGAGCTGGGCTTTGG - Intergenic
986733941 5:10654311-10654333 CTGTGCACAGGGGTGGGGCTCGG + Intergenic
986835424 5:11631778-11631800 CTGAGGAGCAAGCTGGGGCAAGG - Intronic
989692673 5:44163349-44163371 CTGAGGACAGTGTTTGGACTTGG + Intergenic
990245633 5:53860524-53860546 CAGAGAACAAAGCTGGGGCCTGG - Intergenic
990488703 5:56283351-56283373 GTGAAGACTGAGCTGAGGCTTGG + Intergenic
991105195 5:62835279-62835301 CTGAGGACAGACCTGAGGACAGG - Intergenic
991292559 5:65046792-65046814 GTGAGGGCAGGACTGGGGCTTGG - Intergenic
991667575 5:69014519-69014541 TTGAAGACAGAGGTGGGGCTGGG - Intergenic
993423696 5:87735062-87735084 CTGAGAACAATGATGGGGCTGGG - Intergenic
994471482 5:100213198-100213220 CTGAGTTCAGAGATGGGGCCAGG - Intergenic
995140303 5:108728163-108728185 CTGAGGACAGTACTCGGGCATGG + Intergenic
995527258 5:113059933-113059955 TTGAGGACAGAGGTGGGGCATGG - Intronic
995598344 5:113770818-113770840 CTCAGGACAGTGCTAGGGCTAGG - Intergenic
995752702 5:115470693-115470715 CTGAGGGCAGGTCTGGGTCTTGG - Intergenic
996312020 5:122117265-122117287 CTTTGGACAGCGCTGGGACTAGG - Intergenic
997831519 5:137154675-137154697 CTGAGTACAGATCTGGAGCAAGG - Intronic
997888536 5:137654371-137654393 CTAAGTGCAGAGCTGGGGTTCGG - Intronic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998570694 5:143254005-143254027 GAAAGGACAGAGCTGGCGCTGGG + Intergenic
998952745 5:147408165-147408187 CGGAGCACAGAGCTGGGAATTGG - Intronic
999176874 5:149638128-149638150 CTGAGGGCTTAGCTGGGGTTGGG + Intergenic
999230313 5:150057860-150057882 TTGAGGGTAGAGCAGGGGCTAGG - Intronic
999254707 5:150203884-150203906 CTGAGGAGAGAGGAGGGGCTGGG - Intronic
999317598 5:150594284-150594306 CTTGGGTCAGAGCTGGGGCTTGG + Intergenic
999435153 5:151557915-151557937 CTGAGGCTGGAGCTGGGGGTTGG - Intronic
1000130280 5:158290574-158290596 GAGAGGGCAGAGCTGGGGATCGG + Intergenic
1000883047 5:166719160-166719182 CCCATGACAGAGCTTGGGCTTGG - Intergenic
1001275632 5:170349003-170349025 CTAAGGCCAGAGCTGTGGCGTGG - Intergenic
1001496250 5:172189217-172189239 CTAAGGAGAGTGCTGGGGGTGGG + Intergenic
1001603830 5:172946175-172946197 TCCAGGACAAAGCTGGGGCTGGG - Intronic
1002001315 5:176197784-176197806 CAGAGGACAGAGGTGGTGCAGGG - Intergenic
1002186737 5:177458141-177458163 CTGAGGGCAGAGTTGGGGTCTGG + Exonic
1002253024 5:177941185-177941207 CAGAGGACAGAGGTGGTGCAGGG + Intergenic
1002562235 5:180090382-180090404 CTGAGGCCAGACCTGGGGGAGGG + Intergenic
1002718759 5:181245666-181245688 CTGAGGACAGAGCAGGGAAATGG + Intronic
1003026233 6:2558163-2558185 CCGAGGACAGGGCGGGTGCTGGG - Intergenic
1003110508 6:3248765-3248787 CTGAGGGTGGAGCTGAGGCTTGG - Intronic
1003167371 6:3692521-3692543 CTGATTCCAGAGCTGGGGCAGGG + Intergenic
1003706674 6:8539352-8539374 CTGAACGCAGAGCTGGGACTTGG + Intergenic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1005866205 6:29939326-29939348 CTGAGGGCTTCGCTGGGGCTGGG - Intergenic
1005873566 6:29994976-29994998 CTGAGGTCTGAGCTGGGGTGTGG + Intergenic
1006139597 6:31920442-31920464 CTAAGCCCAGAGCTGGGGTTGGG + Intronic
1006148153 6:31971422-31971444 CTGAGGTCAAAGTTGGGGCCTGG + Exonic
1006445516 6:34077586-34077608 CTCAGGACAGGGCTGAGGATTGG - Intronic
1006718561 6:36135689-36135711 CTGAGCTCTGACCTGGGGCTGGG + Intronic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007164975 6:39822818-39822840 CTCAGGACACAGCTGGGACAGGG + Intronic
1007335425 6:41151867-41151889 CTGAGGGCAGAGCTTGGGCTAGG - Intronic
1007398746 6:41591717-41591739 CTGAAGCCTGAGGTGGGGCTAGG + Intronic
1007400445 6:41599732-41599754 CTGAGGCCAGAGGCGGGGCCTGG + Exonic
1007401690 6:41606143-41606165 CTGGGGACCAAGCTGGGGCTTGG + Intergenic
1007598347 6:43065816-43065838 CTGGAGACAGGGCAGGGGCTGGG + Intronic
1008037876 6:46765114-46765136 CAGAGGACAGAGCTGGAACTTGG + Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1008565258 6:52761956-52761978 GTGAGCACAGGGCTGGGGGTAGG - Intronic
1008661370 6:53671456-53671478 ATGAGGGGAGAGCTGTGGCTGGG + Intergenic
1010489242 6:76453537-76453559 CTGTGTCCAGAGCTGTGGCTGGG + Intergenic
1011380954 6:86741646-86741668 CTGACTAAAGAGCTGGGTCTTGG - Intergenic
1012476698 6:99621514-99621536 CAGGGGGCAGAGGTGGGGCTGGG + Intergenic
1013172227 6:107647032-107647054 CTAAGGACAGAGCTTGGGGCTGG + Intronic
1013271249 6:108547341-108547363 GTGAGGACAGAGCCAGGGCCTGG + Intergenic
1013661907 6:112306630-112306652 CTGGGCACAGAGCAGGTGCTCGG + Intergenic
1013806411 6:114000715-114000737 CAGAGAACAGGGCTGGGGATGGG - Intronic
1014390590 6:120857601-120857623 ATGAGGACAGACCTGGTGCTGGG - Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1017121815 6:151031064-151031086 CTGAGTACAAAGTTGAGGCTGGG - Intronic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017988781 6:159468449-159468471 CAGAGGAGAGAGCTGGCCCTAGG - Intergenic
1018095940 6:160387063-160387085 CAGAGGTAAGAGCTGGGCCTGGG - Intronic
1018191016 6:161308990-161309012 CTGAGGACTGGGCTGGGCCATGG - Intergenic
1018573037 6:165230669-165230691 GTGAAGACAGAGCTTGCGCTGGG - Intergenic
1018754529 6:166837632-166837654 ATGAGGACACAGCTGGGTGTGGG - Intronic
1018859344 6:167699379-167699401 CTGAGGAAAGTGCTGGGTCCTGG + Intergenic
1018859376 6:167699529-167699551 CTGGGGACAAAGCTGGCCCTGGG + Intergenic
1019107163 6:169677789-169677811 CTGAGGCCAGAGCTGGAGACGGG - Intronic
1019404764 7:877527-877549 CTGGGGAGAGAGCCGGGGTTGGG - Intronic
1019481344 7:1268296-1268318 CTGAGGAGAGAGCTGTGCCAGGG + Intergenic
1019506514 7:1394092-1394114 CTGAGCACATAGCTGAGGCTTGG - Intergenic
1019652161 7:2165800-2165822 CTGAGGACCACGGTGGGGCTTGG + Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1019803436 7:3105254-3105276 CTGGGGCCAGAGAAGGGGCTTGG - Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1020261432 7:6532595-6532617 CTGAGGACAGGGCTTGGGGAGGG - Intronic
1020748716 7:12111973-12111995 CTGTGCGCAGAGCTGAGGCTGGG - Intergenic
1021577368 7:22116554-22116576 CTGAGGACTGAGCTAGTGCAGGG - Intergenic
1021621341 7:22553447-22553469 CTGAGCACAGTGATGGGGATTGG - Intronic
1021836588 7:24682445-24682467 TTGAGGACAGAGCTGAGTCCAGG - Intronic
1022244645 7:28546883-28546905 GTGTGGATAGAGCTGGGGTTGGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023185209 7:37525751-37525773 CTGAGGACAGAGGTGTGTCTTGG + Intergenic
1023401216 7:39793842-39793864 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1023662686 7:42486837-42486859 CTGAGGACAAAACTAGGCCTTGG - Intergenic
1023726425 7:43146801-43146823 CTGTGCACAGACATGGGGCTTGG - Intronic
1023822197 7:43986521-43986543 CTGAGGACTGAGGATGGGCTGGG - Intergenic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024032905 7:45479888-45479910 CTGATTCCAGAGCTGGGGCAGGG + Intergenic
1024059588 7:45687830-45687852 CTGTGGAGAGAGCTGTGTCTGGG + Intronic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1024643240 7:51349238-51349260 CTGAGGACAGAGCTGTGGAAAGG - Intergenic
1024648399 7:51386839-51386861 GTGAGGCCGGAGCTGGGCCTGGG + Intergenic
1024648931 7:51388912-51388934 GTGAGGCCGGAGCTGGGCCTGGG + Intergenic
1025176269 7:56803983-56804005 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025177624 7:56810029-56810051 GTGAGGCCTGAGCTGGGGCTGGG + Intergenic
1025177948 7:56811369-56811391 GAGAGGCCAGAGCTGGGCCTGGG + Intergenic
1025178224 7:56812500-56812522 ATGAGGCCCGAGCTGGGCCTGGG + Intergenic
1025180918 7:56823587-56823609 GTGAGGCCTGAGCTGGGCCTGGG + Intronic
1025181345 7:56825327-56825349 GTGAGGCCTGAGCTGGGCCTGGG + Intronic
1025181942 7:56827792-56827814 AAGAGGCCAGAGCTGGGCCTGGG + Intergenic
1025689978 7:63749203-63749225 AAGAGGCCAGAGCTGGGCCTGGG - Intergenic
1025690126 7:63749830-63749852 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025690573 7:63751653-63751675 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025691022 7:63753476-63753498 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025691457 7:63755252-63755274 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025691897 7:63757075-63757097 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025692345 7:63758898-63758920 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025692789 7:63760721-63760743 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025693206 7:63762400-63762422 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025693649 7:63764223-63764245 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025694132 7:63766210-63766232 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1025695523 7:63772439-63772461 GTGAGGCCTGAGCTGGGCCTGGG + Intergenic
1025776182 7:64562782-64562804 CTGAGGACCGAGCTGCGCCAAGG + Intronic
1025788542 7:64666439-64666461 CTGAGGACCGAGCTGCGCCAAGG - Intronic
1026045227 7:66902286-66902308 CTGAAGCAAGAGCTGGGTCTGGG - Intergenic
1026045423 7:66903095-66903117 GTGAGGCAAGAGCTGGGCCTGGG - Intergenic
1026045506 7:66903418-66903440 CTGAGGCAACAGCTGGGACTGGG - Intergenic
1026078267 7:67193408-67193430 CTGATGACAGAGCTGGGACTTGG - Intronic
1026698553 7:72618563-72618585 CTGATGACAGAGCTGGGACTTGG + Intronic
1026962676 7:74418395-74418417 CTGAGGCCTGAGCTGGGGGTGGG - Intergenic
1027174191 7:75892983-75893005 CTGTGCACAGAACTGGGGCCAGG + Intergenic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1028188457 7:87817686-87817708 CTGGGAACAGAGATGGGGATGGG - Intronic
1029124765 7:98288260-98288282 GTGGGGACACAGCTGGTGCTTGG + Intronic
1029298371 7:99559102-99559124 CTGAGGACCGAGCTGGGAGCCGG + Intronic
1029728970 7:102426829-102426851 CTGGGGAGGGTGCTGGGGCTTGG + Intergenic
1029750463 7:102539935-102539957 CTGAGGACTGAGGATGGGCTGGG - Intronic
1029768415 7:102639043-102639065 CTGAGGACTGAGGATGGGCTGGG - Intronic
1030098627 7:105924014-105924036 CTGAGGACTGGGCTGAGGGTAGG + Intronic
1030346095 7:108434183-108434205 CTAATGACAGAGCCGGGGATGGG - Intronic
1030794067 7:113765636-113765658 CTGAGGGCAGAGGTGGGGTGGGG - Intergenic
1030886852 7:114949338-114949360 CTCAGGAAGGAGCTGAGGCTTGG + Intronic
1031203767 7:118726555-118726577 CAGACGACAGACCTGGTGCTAGG - Intergenic
1031230998 7:119106144-119106166 CTGAGAACAAAGCTGCAGCTGGG + Intergenic
1031779067 7:125939827-125939849 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1031876771 7:127150701-127150723 TTGAGGACAGAACTGGGAGTGGG - Intronic
1032051714 7:128654207-128654229 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1032096086 7:128939070-128939092 CGGAGGACTGGGCTGGGCCTGGG + Intronic
1032430265 7:131855326-131855348 TTGAGGAAAGAGCTGGTGGTGGG - Intergenic
1032585805 7:133145239-133145261 CTAAGGCCAGAGCTCTGGCTGGG - Intergenic
1032837723 7:135689460-135689482 CAGAGGTGAGAGATGGGGCTTGG + Intronic
1033163167 7:139015265-139015287 CTGGTGACAGAGCAGGGGCTGGG + Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033657466 7:143382976-143382998 CTGAGGCTTGGGCTGGGGCTGGG - Exonic
1034092820 7:148379797-148379819 CGGAGGACAGAGCTGTGCTTGGG - Intronic
1034275318 7:149821444-149821466 CTGAGGGCAGGGCTGGCTCTGGG - Intergenic
1034629962 7:152523140-152523162 CTGAGGACAGAGGAGGGCCACGG + Intergenic
1034707505 7:153158663-153158685 CTAGGGACAGAGATGGGGGTTGG + Intergenic
1034945814 7:155261029-155261051 CAGAGGACAGAGGCAGGGCTGGG + Intergenic
1034959936 7:155358842-155358864 CCGAGGGCAGCGCAGGGGCTGGG - Intronic
1035450940 7:158976429-158976451 CCGATCTCAGAGCTGGGGCTGGG + Intergenic
1036084394 8:5598055-5598077 ATGTGGGCAGAGCTGGTGCTAGG + Intergenic
1036148331 8:6275258-6275280 CAGAGGACAGCGCTGGGCATTGG - Intergenic
1036425668 8:8643171-8643193 CAGAGGACAGAGCAGGGCTTTGG - Intergenic
1037507044 8:19540952-19540974 CTGGGGACAGGGTAGGGGCTTGG - Intronic
1037818422 8:22124075-22124097 CTGGGGGCAGAGCTGGGTGTGGG - Intronic
1039911272 8:41828816-41828838 CTGGGGAGAGAGTTGGGCCTGGG + Intronic
1039970317 8:42316402-42316424 CTTAGGACAGAGCAGGGGATGGG + Intronic
1040060520 8:43099697-43099719 GAGAGGACAGAGCTGGGCGTGGG + Intronic
1040285047 8:46095254-46095276 GTGAGGCCAGAGCGGGTGCTGGG + Intergenic
1040318484 8:46277238-46277260 CTGAGGCCTGAGCAGGTGCTGGG - Intergenic
1040319934 8:46287368-46287390 ATGAGGCCAGAGCAGGAGCTGGG - Intergenic
1040546485 8:48401885-48401907 CTGAGGCCAGAGATGGGGAATGG - Intergenic
1040573839 8:48633628-48633650 ATGAGGTCACAGCTGGGGTTGGG - Intergenic
1040997556 8:53417469-53417491 TTGAGGACAGAGCTGGGACATGG + Intergenic
1041345580 8:56894097-56894119 CTGGGGACTGAGCTTGGGTTGGG - Intergenic
1043130967 8:76460696-76460718 TTAAGGACAGAGCTGGCACTGGG - Intergenic
1043395595 8:79832675-79832697 CTGAGGAAAGAGCTGGATTTAGG - Intergenic
1043490531 8:80743662-80743684 CTCAGCAGAGAGCTGGGGGTGGG + Intronic
1043568206 8:81571182-81571204 CTGAGATCAAAGCTGGTGCTGGG + Intergenic
1044750496 8:95411183-95411205 CTGAGGACTGTTCTGGGGCAGGG - Intergenic
1045016067 8:98002988-98003010 GTGAGGAGAGAGATGAGGCTGGG - Intronic
1047307954 8:123668546-123668568 CTGAGGGCAGTGATGGGGATGGG + Intergenic
1047788740 8:128180667-128180689 CTGAGCACATAGCTGGTCCTCGG - Intergenic
1048339223 8:133525911-133525933 CTGGGTCCAGAGCTGTGGCTAGG + Intronic
1048838729 8:138546420-138546442 CTGATGTCGGAGGTGGGGCTTGG - Intergenic
1049178635 8:141209041-141209063 CTGAGGACGCAGCTGGAGTTGGG - Intronic
1049245247 8:141558939-141558961 CTGGGAGCAGGGCTGGGGCTGGG + Intergenic
1049344775 8:142132979-142133001 CAGATGACAGAGCTGAGGCCCGG - Intergenic
1049350438 8:142161532-142161554 CTGAGGACAGCACTGGGGTGGGG - Intergenic
1049496469 8:142936633-142936655 CTGAGGACAACGGTGGGGCCAGG - Intergenic
1049536190 8:143183556-143183578 CTGAGGGCTCACCTGGGGCTCGG + Intergenic
1049576872 8:143393640-143393662 CAGTGGACAGAGCTGAGGCCTGG - Intergenic
1049733179 8:144189575-144189597 CTGAGGGCAGAGCTGGGAGCGGG - Intronic
1049741619 8:144243665-144243687 CTGAGGCCAGAGGTGGGGACTGG + Intronic
1049894463 9:100681-100703 CTGTGGGCAGAACTGGGGCGTGG - Intergenic
1050143269 9:2538683-2538705 GTGAGGACAGTGCTAGAGCTAGG - Intergenic
1051029166 9:12653872-12653894 CTGAGTACAGGGTTGGGGCAGGG - Intergenic
1051029690 9:12658856-12658878 CTGAGATCAGAGCAGGTGCTGGG + Intergenic
1051877282 9:21805912-21805934 CTGAGGAGAGAGATGGGGGTAGG + Intronic
1052162377 9:25280730-25280752 CAGAGGGGAGAGCTGGGGATGGG + Intergenic
1053422339 9:37987539-37987561 ATCCGGACAGAGCTGGAGCTGGG - Intronic
1053887635 9:42656449-42656471 CTGAGGTCACAGGTGGGACTGGG + Intergenic
1054172637 9:61855675-61855697 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054226657 9:62463899-62463921 CTGAGGTCACAGGTGGGACTGGG + Intergenic
1054447488 9:65384686-65384708 CTGGGGATGGGGCTGGGGCTGGG + Intergenic
1054664903 9:67725126-67725148 CTGGGGATGGGGCTGGGGCTGGG - Intergenic
1054692707 9:68330727-68330749 CTGTGGGCAGAACTGGGGCGTGG + Intronic
1054848131 9:69818753-69818775 CTGTGGAAAGAGCTTGGCCTTGG + Intergenic
1055385159 9:75753676-75753698 CTGGGTTTAGAGCTGGGGCTGGG + Intergenic
1056674001 9:88657618-88657640 CTGCGGACAGACATGGGACTAGG - Intergenic
1056783300 9:89568136-89568158 GTGGGGACAGAGCAAGGGCTTGG - Intergenic
1057139266 9:92716914-92716936 GTGAGGAGAGGGCCGGGGCTTGG - Intronic
1057184552 9:93049647-93049669 GTGGGGACAGGGCTGGGGCAGGG + Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057687672 9:97250353-97250375 TTGAAGAGTGAGCTGGGGCTGGG + Intergenic
1057700288 9:97359279-97359301 GAGAGGACAGAGCAGGGGTTGGG - Intronic
1057829397 9:98395398-98395420 CTGAGGGGAGAGGTGTGGCTGGG + Intronic
1058967004 9:110048184-110048206 CTGAGGACAGTCGTGGTGCTAGG + Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059486012 9:114627233-114627255 CTGTGGGCAGAGCTTGGGATTGG + Intronic
1060231711 9:121830336-121830358 CAGAGGGCTGAGGTGGGGCTGGG + Intronic
1060445334 9:123681876-123681898 CTGATTCCAGGGCTGGGGCTGGG + Intronic
1060545321 9:124455937-124455959 CAGAGGACAGAACTGGGACTAGG + Intronic
1060551557 9:124487846-124487868 CAGAGGCTAGACCTGGGGCTGGG - Intronic
1060887954 9:127168804-127168826 CTAAGGACAAAAGTGGGGCTGGG - Intronic
1060896037 9:127218223-127218245 CTGAGGGCAGAGCTGTGGGAAGG + Intronic
1060918191 9:127403518-127403540 CTGAGGACACAGGGGGTGCTGGG + Intronic
1061087451 9:128407481-128407503 CTGTGAACAGAGGTGGGCCTGGG - Intergenic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061402584 9:130376475-130376497 CTGAGAGCAGAGCTGGGGGATGG - Intronic
1061460896 9:130737670-130737692 CTGAGCACCGAGCTGGTTCTTGG + Intronic
1061678660 9:132231883-132231905 CTGGGCAGAGAGCAGGGGCTTGG + Intronic
1061779479 9:132987299-132987321 CTAAGGACAGGGCTGTTGCTTGG - Exonic
1061829682 9:133283524-133283546 GTGAGCACAGGGTTGGGGCTAGG - Intergenic
1061877901 9:133554145-133554167 CTGGGAACAGGGCGGGGGCTGGG - Intronic
1061913597 9:133737871-133737893 CTGAGGACAGCCCTGGGCTTGGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062212870 9:135373967-135373989 CTGAGGCCAGGGCTGGGGAATGG + Intergenic
1062344766 9:136109629-136109651 CGGAAGGCAGAGCTGGGTCTTGG - Intergenic
1062457330 9:136645898-136645920 CGGAGGACTGAGCTGGGGTCCGG - Intergenic
1062686664 9:137817150-137817172 ATGGGGACAGAGCTGGGCCTGGG - Intronic
1062697102 9:137881025-137881047 GTGAGGAGAGGGCTCGGGCTGGG + Intronic
1203521866 Un_GL000213v1:53097-53119 CTGAGCACAGTGCAGGTGCTGGG - Intergenic
1203443371 Un_GL000219v1:31983-32005 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1203514179 Un_KI270741v1:150892-150914 GTGAGCACAGGGTTGGGGCTAGG + Intergenic
1203578432 Un_KI270745v1:24216-24238 GAGAGGACAGAGCTGGGCCCAGG - Intergenic
1186280951 X:7992518-7992540 CAGAGGACAGAGCTGGAACCAGG - Intergenic
1186417234 X:9394314-9394336 CTGAGGAAATAGCTGTGGGTCGG + Intergenic
1186455024 X:9703934-9703956 CTGAGGACAGAACCAGGGCCTGG + Intronic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1187921894 X:24211945-24211967 CTGAGTAAAGAGCAGTGGCTGGG + Exonic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1190059618 X:47202452-47202474 CTGAGCACAGAACTGGTGCAGGG - Exonic
1190282221 X:48938729-48938751 TGGAGGACAGAGGTGGAGCTAGG - Intronic
1191659594 X:63635979-63636001 CTGGGGAGAGGGCCGGGGCTCGG - Exonic
1191703568 X:64069413-64069435 TGGATGACAGAGCTGGGGTTGGG - Intergenic
1191953807 X:66622925-66622947 CTGATGGCAGAGCTGGGACTAGG - Intronic
1192148878 X:68699633-68699655 CAGAGGACAGTGATGAGGCTGGG - Intronic
1192179879 X:68909797-68909819 TAGAGGACAGAGCAGGAGCTGGG - Intergenic
1192203667 X:69082581-69082603 CTGAGGCTGGGGCTGGGGCTGGG - Intergenic
1192234100 X:69285304-69285326 CAGAGGTCAGAGCCGGAGCTGGG + Intergenic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1192986032 X:76399110-76399132 TTGAGGAGAGCACTGGGGCTTGG - Intergenic
1193081980 X:77415223-77415245 CTGAGGAAAGGGCAGGGACTGGG + Intergenic
1195095099 X:101494051-101494073 CTGAGGCTGGGGCTGGGGCTGGG + Exonic
1195095113 X:101494087-101494109 CTGAGGCTGGGGCTGGGGCTGGG + Exonic
1195469641 X:105218341-105218363 CTGAGGCCACTGCTGAGGCTTGG - Intronic
1195676721 X:107512322-107512344 CTGAGGGCAGAGCTGGTGGGGGG + Intergenic
1196454110 X:115882708-115882730 CGGGGGGCAGGGCTGGGGCTGGG + Intergenic
1198107260 X:133473542-133473564 AGGAAGACAGAGGTGGGGCTGGG + Intergenic
1198131365 X:133698636-133698658 CAGAGGACGGAGCTTGGGCATGG + Intronic
1200972466 Y:9167909-9167931 CTGGTGAGAGAGCTTGGGCTTGG + Intergenic
1202381004 Y:24276584-24276606 GTGAGGCCTGAGCTGGGCCTGGG - Intergenic
1202489781 Y:25393542-25393564 GTGAGGCCTGAGCTGGGCCTGGG + Intergenic