ID: 1127383968

View in Genome Browser
Species Human (GRCh38)
Location 15:58452645-58452667
Sequence AGATGGAATCTGCAGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127383962_1127383968 5 Left 1127383962 15:58452617-58452639 CCCTTCTCTCATGAGCTAGACTC 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1127383968 15:58452645-58452667 AGATGGAATCTGCAGTGGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 292
1127383963_1127383968 4 Left 1127383963 15:58452618-58452640 CCTTCTCTCATGAGCTAGACTCA 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1127383968 15:58452645-58452667 AGATGGAATCTGCAGTGGGGAGG 0: 1
1: 0
2: 1
3: 26
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127383968 Original CRISPR AGATGGAATCTGCAGTGGGG AGG Intronic
900883209 1:5397115-5397137 AAATGGAATTTGCATTTGGGTGG + Intergenic
901334179 1:8434504-8434526 GGATGGAATCTGTATTGGAGTGG - Intronic
902152138 1:14452007-14452029 AGACGGAGGCTGCAGTGGGCCGG - Intergenic
902521549 1:17020610-17020632 AGATAGCATCTTCAGTGGTGGGG - Intronic
903438927 1:23372432-23372454 AGATTGACTCTGCAGAGGAGGGG + Intergenic
904002740 1:27348057-27348079 AGGTGGAATGTGCAGGGGGCAGG + Intronic
904926118 1:34049523-34049545 AGATGGCATCTGGGGTTGGGGGG - Intronic
905817774 1:40965333-40965355 AAATGGAATCTGGGATGGGGAGG + Intergenic
905939048 1:41848531-41848553 GGATGGAATCGGCAGTGGGCAGG + Intronic
906340519 1:44975897-44975919 AGGTGGAGGCTGCAGTGAGGTGG + Intronic
907894958 1:58679526-58679548 AGTTTGAAGCTGCAGTGAGGTGG - Intronic
908574397 1:65443837-65443859 AGAGGAAATCTGCATTGGTGAGG + Intronic
909258189 1:73451154-73451176 TGATGGAGTGTGCAGTTGGGGGG + Intergenic
909456365 1:75854299-75854321 AGATGGTATCTGCATGGGGGAGG - Intronic
911439581 1:97908609-97908631 TGATGGTGGCTGCAGTGGGGTGG - Intronic
911612386 1:99970931-99970953 AGATAGAATCAACAGTTGGGAGG - Intronic
914859190 1:151372459-151372481 AGCTGGGAAATGCAGTGGGGTGG + Intronic
916755043 1:167761385-167761407 AGATGCAATGTGCAGTGGAGAGG + Intronic
916771426 1:167912597-167912619 AGAGGGAACCCCCAGTGGGGTGG - Intronic
918215320 1:182388517-182388539 GGGTGGGATCTGCAGAGGGGTGG - Intronic
919280846 1:195486195-195486217 ATGTGGCATTTGCAGTGGGGAGG - Intergenic
919808747 1:201396300-201396322 AGTTGAAGTCTGGAGTGGGGAGG - Intronic
920961280 1:210666306-210666328 AGATGCATTCAGCAGTGGGAAGG - Intronic
924710925 1:246529455-246529477 AGATGCTCACTGCAGTGGGGTGG - Intergenic
924863273 1:247949534-247949556 ACATGAAATCTGCAGAAGGGAGG + Exonic
924872271 1:248061358-248061380 ACATGAAATCTGCAGAAGGGAGG + Exonic
1065410975 10:25427790-25427812 TGATGAAATCTGTTGTGGGGTGG - Intronic
1065625113 10:27622313-27622335 ATATAAAATCTGCAGAGGGGAGG - Intergenic
1067393529 10:45888474-45888496 AGATGTTAACTGCAGTGAGGTGG - Intergenic
1067861853 10:49857617-49857639 AGATGTTAACTGCAGTGAGGTGG - Intronic
1068343511 10:55740067-55740089 AGCTGGAATCGGCAATGGGGAGG + Intergenic
1069316831 10:67115094-67115116 AGATGGAATCTGTGGTGTGTAGG - Intronic
1069799563 10:71073726-71073748 ACCTGCAAGCTGCAGTGGGGTGG + Intergenic
1070162199 10:73873570-73873592 AGATGAAACCGGCTGTGGGGGGG - Intronic
1070891088 10:79942610-79942632 AGATGGGACCTGCTGTTGGGAGG - Intronic
1071000821 10:80828583-80828605 CTATGGGATCTGCTGTGGGGAGG - Intergenic
1072124028 10:92429760-92429782 AGATTGAAAAGGCAGTGGGGTGG + Intergenic
1073059925 10:100727560-100727582 AGATGGAGTCAGCAGTCTGGAGG - Intergenic
1073710456 10:106031291-106031313 AGATGGTCTCTGCATTGGGATGG + Intergenic
1076346866 10:129785215-129785237 GGATGGGCGCTGCAGTGGGGCGG + Intergenic
1076438476 10:130462875-130462897 AGATGCACACTGCAGTGGTGGGG + Intergenic
1076833998 10:133011858-133011880 AGGTGGCCTCTGCAGTGTGGGGG + Intergenic
1077286258 11:1767343-1767365 AGATGGTATCTGCGGTGGGGTGG - Intergenic
1077774597 11:5257387-5257409 AGAAGGAATCTGCCATGGGAAGG + Intronic
1080214421 11:29824971-29824993 ACATGGAATCGGCGGGGGGGGGG + Intergenic
1081687881 11:45055246-45055268 GGGTGGAATTTGCAGTCGGGAGG - Intergenic
1082652609 11:55812146-55812168 AGATGGGCTCTGCAGAGGGCAGG + Exonic
1082916116 11:58439407-58439429 AGATGGAAACTGCAGTAAGGTGG + Exonic
1083551904 11:63596409-63596431 CCATGGACTCGGCAGTGGGGAGG + Intronic
1084482915 11:69432427-69432449 AAATGGAAGCTGCAGTGATGAGG - Intergenic
1085440268 11:76555482-76555504 AGAGGAACTCAGCAGTGGGGTGG - Intergenic
1089743492 11:120600984-120601006 AGATGGAAGCTGTAGTGAGCCGG + Intronic
1089931324 11:122316142-122316164 AGATAGAATATGGGGTGGGGAGG + Intergenic
1090115322 11:123965778-123965800 ACATGGAATCTCCAGGGTGGAGG - Intergenic
1090329516 11:125920080-125920102 AGAAGGAAGGTACAGTGGGGAGG + Intronic
1091131101 11:133147969-133147991 AGATGGCAGCTGGGGTGGGGAGG - Intronic
1092230999 12:6775222-6775244 AGCTGGGTGCTGCAGTGGGGAGG - Intronic
1092896800 12:13019932-13019954 AGATGGAATCTGCATTTTGAAGG + Intergenic
1092956722 12:13557956-13557978 AGGTGGTAGTTGCAGTGGGGTGG + Exonic
1093497063 12:19770182-19770204 AGATGAAATCTACATGGGGGTGG + Intergenic
1093765082 12:22953131-22953153 AGATGCTGGCTGCAGTGGGGAGG - Intergenic
1094208591 12:27866627-27866649 AGATGGAATCAGCAGTTAAGTGG - Intergenic
1096464225 12:51839296-51839318 AGATGGAATCGGGAGAGAGGAGG - Intergenic
1097237936 12:57552383-57552405 AGATGGAATCTGAATTGGCAGGG - Intronic
1100501869 12:95182240-95182262 AGATGGAAGCTGGAGTGTAGTGG + Intronic
1100853354 12:98736624-98736646 AGATGAAATCAGCAGTGAAGTGG + Intronic
1101250634 12:102931340-102931362 AGAGGGAAATAGCAGTGGGGTGG + Intronic
1101348789 12:103908805-103908827 AGATGCAATGGACAGTGGGGAGG - Intergenic
1102989491 12:117304624-117304646 AGATGCAATTTGCAAGGGGGTGG + Intronic
1103587211 12:121964827-121964849 AGGTGGAAGTTGCAGTGAGGCGG + Intronic
1104790655 12:131480200-131480222 AGATGCTATCTGCAGGTGGGAGG + Intergenic
1106198022 13:27510539-27510561 AGATGGACACTGCAGTGTTGTGG + Intergenic
1109686548 13:65829355-65829377 AGATGCCAGCTGCAGCGGGGTGG + Intergenic
1110671945 13:78191010-78191032 AGTTGGTATCTGATGTGGGGAGG - Intergenic
1111470603 13:88676201-88676223 TGAAGGAAGGTGCAGTGGGGTGG + Intergenic
1112140823 13:96639953-96639975 AGATGCAATCAACAGTGGGCTGG - Intronic
1112265045 13:97915899-97915921 TGATGGAGGCTGCAGTGAGGTGG + Intergenic
1113129319 13:107017677-107017699 AGATGGAAGCAGCACTGGGAAGG - Intergenic
1113263615 13:108592650-108592672 AGAGGGAGTGTGGAGTGGGGTGG + Intergenic
1114616737 14:24072450-24072472 AAGTGGAGTCTGCAGTGGGCAGG - Intronic
1114698798 14:24655391-24655413 AGATATATTCTGCAGTGGGTGGG - Intergenic
1114825894 14:26079019-26079041 AGGTGGAATGGGGAGTGGGGAGG + Intergenic
1115210010 14:30957510-30957532 AAATGGAATTTGGAGTGGGGTGG - Intronic
1116196227 14:41729340-41729362 TGATGGAAGGTGAAGTGGGGAGG - Intronic
1116804452 14:49478911-49478933 AGTTGGAAGCTGCAGTGGCAGGG + Intergenic
1116865723 14:50030016-50030038 AAATGGAATCAGTGGTGGGGTGG - Intergenic
1117753884 14:58953994-58954016 AGATTGAATGTGGAGTGGGGAGG - Intergenic
1117833795 14:59780914-59780936 AGATGGAATCAGAATTTGGGGGG - Intronic
1117998035 14:61496551-61496573 AGATGGAATCTGGAGGGTAGGGG - Intronic
1118715172 14:68554575-68554597 GGAGGGAGTTTGCAGTGGGGCGG - Intronic
1119649050 14:76370813-76370835 AGATGGTAGCTGCAGTGAGCAGG - Intronic
1122913442 14:104844866-104844888 AGGAGGAATCTGCAGGGGAGGGG - Intergenic
1124656661 15:31514742-31514764 AGGTGGCATCTGGAGTGGGTGGG - Intronic
1125049775 15:35283364-35283386 AGATGGAGTTTGCAGTGAGCCGG - Intronic
1125124719 15:36206646-36206668 TTTTGGTATCTGCAGTGGGGGGG - Intergenic
1125680286 15:41526315-41526337 AGGTGGAGGCTGCAGTGGGCTGG - Intronic
1127383968 15:58452645-58452667 AGATGGAATCTGCAGTGGGGAGG + Intronic
1127459527 15:59185335-59185357 AGATGGAAGTTGCAGTGAGTTGG - Intronic
1128543010 15:68550098-68550120 AGGTGGAATCAGCTGAGGGGTGG + Intergenic
1129185922 15:73906439-73906461 GAATGGAATCTGGAGTGGAGAGG + Intergenic
1130197701 15:81796128-81796150 AGATGGAATGAGCATTGGTGAGG + Intergenic
1130341954 15:83007075-83007097 AAATAGAATCTGCAGGAGGGGGG - Intronic
1130421306 15:83749633-83749655 AGATGGTCTGAGCAGTGGGGAGG + Intronic
1130700127 15:86170198-86170220 AGATGAAATCTACAGTGTGTAGG + Intronic
1131144400 15:90001868-90001890 AGATGGCGTCTGGGGTGGGGGGG + Intronic
1132007064 15:98237023-98237045 AGCTGGAATCTGAACTGGGAAGG - Intergenic
1132662277 16:1066779-1066801 AAATGGAGTCTGCAGTGTGACGG + Intergenic
1133622279 16:7537776-7537798 AACTGAAATCTGCACTGGGGTGG - Intronic
1134157408 16:11854805-11854827 AGCAGGAATGTGCAGAGGGGAGG + Intergenic
1135192503 16:20366316-20366338 AGTAGGAATCAGGAGTGGGGAGG - Intronic
1135547850 16:23377729-23377751 AGAAGGAAACAGAAGTGGGGAGG - Intronic
1136159381 16:28408634-28408656 AGCAGGACTCTGCAGTGCGGGGG + Intergenic
1136203706 16:28706660-28706682 AGCAGGACTCTGCAGTGCGGGGG - Intronic
1136251601 16:29009040-29009062 AGATGGAATAGGGAGAGGGGAGG - Intergenic
1136387262 16:29936730-29936752 AGCTGGGAACTGCAGAGGGGAGG + Intergenic
1136628226 16:31474549-31474571 GGCTGGAAGCTGCAGCGGGGAGG - Exonic
1139488986 16:67276485-67276507 AGATGGAGGTTGCAGTGGTGGGG + Intergenic
1139934053 16:70554778-70554800 AGATGAAAGCTGCAGTGATGTGG - Intronic
1141473029 16:84252395-84252417 AGAGGGAAGTTGCAGTGTGGAGG + Intergenic
1141687977 16:85581194-85581216 AGAAGGGAGCTTCAGTGGGGAGG + Intergenic
1142402815 16:89869855-89869877 AGATGGAAACTGGACTTGGGTGG + Intronic
1147258307 17:39195085-39195107 AGGAGGAATGTGCAGGGGGGTGG - Intronic
1147642290 17:42010554-42010576 AGATGGGAACTAGAGTGGGGAGG + Intronic
1148124948 17:45231669-45231691 CGCTGGAGCCTGCAGTGGGGTGG + Intronic
1148128059 17:45246984-45247006 AGGTGGATTCTGCAGGGGTGTGG + Exonic
1148209798 17:45801207-45801229 AGAAGGGATGGGCAGTGGGGAGG - Intronic
1148556740 17:48583032-48583054 AGATGGAGTGTGCAATGGGGTGG - Intronic
1148606356 17:48932148-48932170 AGATGGAGGCTGCAGTGAGCCGG + Intronic
1153055539 18:942419-942441 AGTTGGAAGCTGCAGTGTGGTGG + Intergenic
1153895948 18:9560209-9560231 AGGTGGAAGCTGCAGTGAGCTGG + Intronic
1154069647 18:11141745-11141767 AAGTTGAATCTGAAGTGGGGTGG + Intronic
1156749071 18:40428500-40428522 AGTTGAAATCTTCAGTGGGGTGG + Intergenic
1157660203 18:49434566-49434588 AAAAGGACTCTGGAGTGGGGAGG + Intronic
1158626768 18:59078409-59078431 AGCAGGAATCTGCTGAGGGGAGG + Intergenic
1158848074 18:61465805-61465827 ATATGGAATCTGCTCTGGGAAGG + Intronic
1160148242 18:76381084-76381106 GGATGAACTCTGCGGTGGGGAGG + Intronic
1160843301 19:1155900-1155922 AGATGGAACCTGCAGCAGGAAGG - Intronic
1163772902 19:19201595-19201617 AGCTTGAATCGGGAGTGGGGTGG - Exonic
1164940801 19:32251222-32251244 GGGTGGCATCTGCAGTGTGGGGG + Intergenic
1164940829 19:32251333-32251355 GGGTGGCATCTGCAGTGTGGAGG + Intergenic
1166705588 19:44906313-44906335 AGATGGAACCGGCGGTGGGGAGG + Intronic
1167090193 19:47338765-47338787 AGATGGAGGCTGCAGTGAGCTGG + Intronic
1167376284 19:49114174-49114196 AGACCGAACCTGCAGTGGGAGGG + Intergenic
924979339 2:206973-206995 AGAGGGAAACTGGGGTGGGGGGG + Intergenic
925055412 2:853436-853458 AAAGGGAATGTGCAGTGGAGGGG + Intergenic
926479843 2:13378073-13378095 AGATATGCTCTGCAGTGGGGAGG - Intergenic
927241418 2:20922889-20922911 AGATAGAATCTGCAGTCAGGAGG - Intergenic
929603734 2:43221087-43221109 ATAAAGAATGTGCAGTGGGGAGG - Intergenic
929809837 2:45180377-45180399 AGGTGGAATCTGGGGTGAGGGGG + Intergenic
930053428 2:47234487-47234509 AGGTGGCATCTGCAGGGAGGAGG + Intergenic
931175378 2:59849097-59849119 AGAAGGAATCTGTAGGGAGGAGG + Intergenic
932113345 2:69021971-69021993 AGATGAAATATTCAGTGAGGTGG + Intronic
935786835 2:106557202-106557224 AGATGGATTTTGGAATGGGGTGG + Intergenic
937011381 2:118565661-118565683 AGAGTGAATCTGCGGAGGGGAGG - Intergenic
937219342 2:120332844-120332866 AGAAGGAACATGCAGTTGGGAGG - Intergenic
938606601 2:132899803-132899825 AGATGGAGGCTGCAGTGAGCTGG + Intronic
938842397 2:135175508-135175530 AGATGAAATCTTCAGTGATGAGG - Intronic
939382794 2:141457748-141457770 AGGTGGTAACTGCAGTGGAGAGG + Intronic
939399410 2:141671424-141671446 AGGTGGAGTCTGCAGAGGGTGGG + Intronic
939837679 2:147150406-147150428 AAATGGAGTCTGCAGTCTGGAGG + Intergenic
940152313 2:150615914-150615936 AGAGGGATTCTGCAGAGGTGAGG + Intergenic
940771878 2:157847809-157847831 AGATGGAGTTTGAACTGGGGAGG + Intronic
940922264 2:159321752-159321774 GGCTGGGAACTGCAGTGGGGAGG + Intronic
941151277 2:161918753-161918775 AGATGCCAGCTGCAGTAGGGAGG + Intronic
941390036 2:164900776-164900798 AAAAGGCCTCTGCAGTGGGGAGG - Intronic
943258551 2:185629114-185629136 AGGAGGAATGTGCACTGGGGTGG - Intergenic
946130109 2:217600125-217600147 AAAGGGAAGCTGCAGTGTGGAGG - Intronic
1168931952 20:1631009-1631031 AGATGACACCTGCACTGGGGTGG - Intronic
1169469565 20:5872057-5872079 AGATGGGATGTGAAGTGGGTTGG - Intergenic
1169522086 20:6385215-6385237 AAATGTAATGAGCAGTGGGGAGG - Intergenic
1170877914 20:20267851-20267873 GCATGCCATCTGCAGTGGGGAGG - Intronic
1172001318 20:31779925-31779947 AGATGAAATCTGAAGGGTGGAGG + Intronic
1172627807 20:36358230-36358252 AAATGCAAACTGCAGTGCGGTGG + Intronic
1172969455 20:38862805-38862827 TGATGGAATCTGGAGTGGGCAGG - Intronic
1173649812 20:44655994-44656016 AGAGGGAATCTGGAATGGGGAGG - Intergenic
1173836886 20:46131827-46131849 AGATGGAGGCTGCAGTGAGCTGG - Intergenic
1174005876 20:47410326-47410348 AGGTGGAAGCTGCAGTGAGCCGG + Intergenic
1175261488 20:57676984-57677006 AGATGGGAAGTGCAGTGGTGAGG - Intronic
1175442091 20:58999496-58999518 AGATGGAAGGTGCAGAGGGAAGG - Intronic
1175880986 20:62258966-62258988 GGATGGACTCTGCTGTGTGGAGG + Intronic
1177891392 21:26808169-26808191 AGAAGGAATCTGGATTGGGATGG + Intergenic
1178831469 21:36060370-36060392 AGATGGAGGCTGCAGTGGGCGGG + Intronic
1179297440 21:40076018-40076040 ACATGGAAAGTGCAGTGGCGTGG - Intronic
1179992498 21:44955487-44955509 AGACCAAGTCTGCAGTGGGGAGG - Intronic
1181438776 22:22925117-22925139 AGCTGAGATCTGCAGTTGGGTGG - Intergenic
1182029493 22:27146749-27146771 AAATGCCAGCTGCAGTGGGGTGG + Intergenic
1182512665 22:30830101-30830123 AGAATGAATCTGCAGTGGGCAGG - Intronic
1183335509 22:37243893-37243915 AGATGGCTTCTGGGGTGGGGTGG + Intronic
1183580542 22:38723484-38723506 AGATGGTAGCTGCTGTGGGAAGG - Intronic
1184506729 22:44908171-44908193 AGATGGCGTCTCCAGTGGCGAGG + Intronic
1184554289 22:45224934-45224956 AGAAGGCGTCTGCCGTGGGGTGG + Intronic
1185026553 22:48417441-48417463 TGATGGAATCTGCAGGGGAGGGG + Intergenic
1185113423 22:48917257-48917279 AGATAGAATATCCAGTGGTGAGG - Intergenic
950068061 3:10129355-10129377 AGGTGGAAGCTGCAGTGAGCTGG + Intergenic
950135373 3:10577170-10577192 AGCTGGAATCTGCAGTTAGCAGG + Intronic
952822403 3:37496530-37496552 AGAAGGATTCCGCAGTGGGTTGG - Intronic
952833877 3:37588322-37588344 AGATGGAAAGGGAAGTGGGGGGG - Intronic
953261721 3:41345908-41345930 AGCAGGAATTTGCAGGGGGGAGG + Intronic
953864637 3:46573638-46573660 AGCTGGAAGCTGGAGTAGGGAGG + Intronic
953930170 3:47002008-47002030 AGCTGGAGGCTGCACTGGGGCGG + Exonic
954042060 3:47895993-47896015 AGAAGCAATCTGGGGTGGGGGGG + Intronic
954251017 3:49367559-49367581 AGATGGAGTCTGCAGTACAGTGG + Intronic
955988427 3:64599539-64599561 AGATGGCATCTGCCATGAGGAGG - Intronic
957235561 3:77584297-77584319 AGAGGAAATCTGCAGGGGTGAGG - Intronic
957407585 3:79791281-79791303 AATTGGTATCAGCAGTGGGGGGG - Intergenic
957803244 3:85113953-85113975 AGAAGGAATCTATAGTGGAGGGG - Intronic
958019221 3:87978054-87978076 AGCTGGCAGCTGCAGAGGGGCGG + Intergenic
958912739 3:100012841-100012863 AGGTGGAAGCTGCAGTGAGCTGG - Intronic
960899972 3:122544494-122544516 AGATGGAATGTTCAGTGGCCTGG - Intronic
961781848 3:129325093-129325115 ACAGGGACTCTGCGGTGGGGCGG + Intergenic
964288128 3:155143507-155143529 ATATGGAAAATGCTGTGGGGAGG + Exonic
966268537 3:178076588-178076610 AAATGGAATCTTCAGGGAGGTGG + Intergenic
968046391 3:195626031-195626053 CGGTGGCATCTGCAGAGGGGAGG + Intergenic
968308262 3:197664060-197664082 CGGTGGCATCTGCAGAGGGGAGG - Intergenic
968474410 4:796325-796347 ACATGAAGTCTTCAGTGGGGTGG - Intronic
969006671 4:4025762-4025784 TGATGACATATGCAGTGGGGTGG + Intergenic
969542712 4:7803578-7803600 GCATGGACTCTGCAGTGGGGCGG + Intronic
969975862 4:11100691-11100713 AGATGGAAACTGTAGGGGAGTGG + Intergenic
970000797 4:11364244-11364266 AGAAGGAGTCTGCATAGGGGAGG + Intergenic
970463273 4:16297179-16297201 CAATGGGATCTGGAGTGGGGAGG - Intergenic
971058086 4:22936053-22936075 AGATGGATCCTGCACTGGGAAGG + Intergenic
971802026 4:31305120-31305142 ATATGGAATTTGAAGTGGGCTGG - Intergenic
974156587 4:58081618-58081640 AGATGGCATCTCCTCTGGGGAGG - Intergenic
977719513 4:100223521-100223543 AGAGGGAACCTGAAGTGGGTAGG - Intergenic
977751640 4:100616744-100616766 TGTTGGAATTGGCAGTGGGGGGG - Intronic
978517906 4:109588596-109588618 AGATGGAATCTTCAATTTGGTGG - Intronic
981989514 4:150900981-150901003 AGATGAAATGTGCAGTGGTGGGG - Intronic
982125485 4:152180456-152180478 AGAAGGGATCTGGAGTGAGGGGG + Intergenic
982512154 4:156296705-156296727 AGATAGAAACTCCAGTGGAGGGG - Intergenic
982570113 4:157038596-157038618 AGATGGAAGCTGCAGTGAGCTGG + Intergenic
983058303 4:163125572-163125594 AGTGGGAAACTGCAGTGGGAAGG + Intronic
983204359 4:164897958-164897980 AGATGGAGTTTGCAGTGAGCTGG - Intronic
986054896 5:4127115-4127137 AGAGGGCATCTGCAGGGTGGAGG + Intergenic
987027012 5:13937542-13937564 AGATGGAAGCAGCAGTGAGTAGG - Intronic
987903583 5:24047430-24047452 AGATTGAATATGGAGTGTGGGGG - Intronic
989291281 5:39769334-39769356 AGTGGGAAGCTGCAGTGGGGAGG + Intergenic
989636086 5:43535529-43535551 AGATGCAAACTGCAGTAGGTAGG - Exonic
990539325 5:56756830-56756852 AAGTGGAATTTCCAGTGGGGAGG + Intergenic
990601096 5:57359384-57359406 AGATTGAAGCTGCAGTGAGCTGG + Intergenic
992085163 5:73271631-73271653 AACAGGAATCTGCAGTGGGAAGG - Intergenic
992248640 5:74855263-74855285 AGATGGAGGCTGCAGTGAGCTGG - Intronic
992662929 5:78979508-78979530 AGCTGGACTGTGCACTGGGGTGG + Intronic
993629652 5:90270188-90270210 AGATGAAATGAGCAGTGGGAAGG - Intergenic
995331933 5:110956351-110956373 AGATGCCAGCTGCAGTGGGGTGG + Intergenic
995640600 5:114252525-114252547 AGATGGAGCTTGCAGTGGAGGGG + Intergenic
995793029 5:115914202-115914224 AGATGAGATCTGGAGTGGGGGGG + Intergenic
995835922 5:116399508-116399530 AGATGGAGTTTGCAGAGGCGAGG + Intronic
997652695 5:135534466-135534488 AGAGCGAGTCTGCAGTGGTGGGG + Exonic
999286233 5:150395926-150395948 AGATGGAGTCTGGAGCTGGGAGG - Intronic
999292112 5:150432593-150432615 AGATGGAGTCTGGAGTGCAGTGG - Intergenic
999819185 5:155207882-155207904 AGGTGGAAGCTGCAGTGAGCCGG + Intergenic
1000302851 5:159971865-159971887 ACAAGGAGCCTGCAGTGGGGAGG - Exonic
1001570571 5:172727960-172727982 AAATGGAAGCTGCAGAGGGCAGG - Intergenic
1001717782 5:173831024-173831046 TGATTGAATGGGCAGTGGGGAGG + Intergenic
1002897357 6:1387414-1387436 AAATAGAAGCTGGAGTGGGGAGG - Intergenic
1003245281 6:4377680-4377702 ACATGAAATCTGCTGTGTGGAGG - Intergenic
1005390259 6:25325828-25325850 ATAGGGAATTTGGAGTGGGGTGG + Intronic
1007849953 6:44793339-44793361 AGATGGGTTTTGGAGTGGGGAGG + Intergenic
1012956562 6:105576933-105576955 ACAGGGGATCTGAAGTGGGGAGG - Intergenic
1013223234 6:108098704-108098726 AGCTGGAGTCTGCAGTGCAGGGG - Intronic
1016340214 6:143054173-143054195 AGGTGGAAGCTGCAGTGAGTTGG - Intergenic
1016633950 6:146266117-146266139 AGATGGAAGTTGCAGTGAGCTGG + Intronic
1017777193 6:157689495-157689517 AGAAGGAAGGAGCAGTGGGGAGG - Intergenic
1017796221 6:157847170-157847192 AGGTGGAAGCTGCAGTGAGCTGG - Intronic
1018103913 6:160465377-160465399 GATTGGCATCTGCAGTGGGGCGG + Intergenic
1018131005 6:160732566-160732588 GATTGGCATCTGCAGTGGGGCGG - Intronic
1018417916 6:163617357-163617379 AGGTGGAGGCTGCAGTGGGCCGG + Intergenic
1018844772 6:167547925-167547947 AGATGGAATCTGAAGTCACGTGG - Intergenic
1020863207 7:13521228-13521250 AGAAGGAATCTGAAGAGTGGTGG - Intergenic
1021329803 7:19322370-19322392 AGATGGAATCTGCTGCGCTGGGG - Intergenic
1026566807 7:71496210-71496232 TGAAGGACCCTGCAGTGGGGAGG + Intronic
1029975992 7:104834298-104834320 AGATGGAGTCTGGAGTGCAGTGG - Intronic
1030024406 7:105308943-105308965 AGCAGGATTCTGCAGTGGTGTGG - Intronic
1032537851 7:132679169-132679191 AGGTGAAATCTGCATCGGGGTGG + Intronic
1034150960 7:148915042-148915064 AGATGGAGTCTGGAGTGCAGTGG + Intergenic
1034650261 7:152684704-152684726 AGATGCAATCTGCAGTGGAATGG + Intergenic
1036369445 8:8150149-8150171 TGATGACATATGCAGTGGGGTGG - Intergenic
1036569027 8:9963492-9963514 AGAGAGAATGTTCAGTGGGGCGG + Intergenic
1036881444 8:12515491-12515513 TGATGACATATGCAGTGGGGTGG + Intergenic
1037665877 8:20969782-20969804 ATATGGCAGCTGCTGTGGGGAGG - Intergenic
1039240855 8:35555204-35555226 AGATGAAATCTAAGGTGGGGAGG - Intronic
1040927835 8:52703301-52703323 AGATGGAATCTGCAGATAGTAGG - Intronic
1041131453 8:54706511-54706533 TGATGGAAGCTGCACTGGAGTGG + Intergenic
1041306086 8:56462554-56462576 AGTGAGAACCTGCAGTGGGGAGG + Intergenic
1041897078 8:62937679-62937701 GGACAGAATCTGTAGTGGGGGGG + Intronic
1043354933 8:79401102-79401124 AGATGCTCTCTGCAGTGGTGGGG + Intergenic
1043533520 8:81175726-81175748 AGATGTAATCTCCAGTGTTGGGG - Intergenic
1044865380 8:96565713-96565735 AGATGGACTTTGCAGAGGGAAGG - Intronic
1045687901 8:104730060-104730082 AGATGGAGGTTGGAGTGGGGAGG + Intronic
1045839166 8:106559828-106559850 AAATCGAATCTGCAGTGTGTTGG - Intronic
1046194793 8:110847420-110847442 AGCTGGAAATAGCAGTGGGGAGG + Intergenic
1047104813 8:121720457-121720479 AGATGCCAGCTGCAGCGGGGAGG - Intergenic
1047512509 8:125526450-125526472 AGTTGGTATCAGAAGTGGGGTGG - Intergenic
1050361403 9:4834654-4834676 AAATGATATGTGCAGTGGGGTGG + Intronic
1050589597 9:7148377-7148399 AGCTGCAAGCTGAAGTGGGGTGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1053272249 9:36758473-36758495 TGATGGTATTTGGAGTGGGGGGG + Intergenic
1056965510 9:91160716-91160738 AGAGGGGATGTGCAGTGCGGGGG - Intergenic
1057008241 9:91579794-91579816 AGTTGGAAGCTGCAGTGAGCTGG + Intronic
1057676525 9:97140403-97140425 ACATGGAAACAGTAGTGGGGTGG - Intergenic
1058557881 9:106189578-106189600 AGATGGGAAGGGCAGTGGGGTGG - Intergenic
1059412780 9:114143620-114143642 ATATGCAGCCTGCAGTGGGGTGG + Intergenic
1061887631 9:133600569-133600591 CGATGGGGTCTGCAGTGGGATGG + Intergenic
1062240345 9:135534325-135534347 AGATGGTACCTGCCCTGGGGAGG - Intergenic
1062672605 9:137720271-137720293 AAATGGAATCTGCAGATGAGAGG - Intronic
1185612855 X:1402665-1402687 GGAAGGAAGCTGCATTGGGGAGG - Intergenic
1185865333 X:3619252-3619274 AGGTGGAGACTGCAGTGGTGTGG + Intronic
1186817410 X:13251533-13251555 AGATGGCATCTGGACTGGGGAGG + Intergenic
1189826721 X:44926138-44926160 AGATGGAGGCTGCAGTGAGCTGG - Intronic
1190481735 X:50884223-50884245 AGATGGGATTTGTAGAGGGGAGG - Intergenic
1192860273 X:75060980-75061002 AGATGGAAATAGCAGTGTGGGGG + Intronic
1193211347 X:78810537-78810559 ACATGCCAGCTGCAGTGGGGTGG + Intergenic
1195499180 X:105574349-105574371 GGAGGGAATCTGCAGGGGAGAGG + Intronic
1198189353 X:134287510-134287532 AGATGCCAGCTGCAGTGGGGGGG + Intergenic
1198390334 X:136167694-136167716 AGCTGGAATGTGCAGAGGTGAGG + Intronic
1200286666 X:154829478-154829500 AGAGGGAATGTGAAGGGGGGTGG - Intronic
1200364402 X:155645906-155645928 AGAGTGAATCTGGAGAGGGGAGG - Intronic
1200798359 Y:7362240-7362262 AGGTGGAGACTGCAGTGGTGTGG - Intergenic
1200936555 Y:8743427-8743449 AGATGCAATCTGGTGAGGGGTGG - Intergenic
1201612926 Y:15863212-15863234 TGATGGAAACTGAGGTGGGGTGG - Intergenic