ID: 1127384517

View in Genome Browser
Species Human (GRCh38)
Location 15:58456579-58456601
Sequence CTCCCTCCTAGGAGGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127384511_1127384517 21 Left 1127384511 15:58456535-58456557 CCTGGAGGGAGGTGCTGGGGGGT 0: 1
1: 3
2: 246
3: 274
4: 1692
Right 1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1127384503_1127384517 30 Left 1127384503 15:58456526-58456548 CCAGAGGCCCCTGGAGGGAGGTG 0: 1
1: 0
2: 6
3: 52
4: 490
Right 1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1127384509_1127384517 22 Left 1127384509 15:58456534-58456556 CCCTGGAGGGAGGTGCTGGGGGG 0: 1
1: 0
2: 7
3: 67
4: 669
Right 1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1127384507_1127384517 23 Left 1127384507 15:58456533-58456555 CCCCTGGAGGGAGGTGCTGGGGG 0: 1
1: 0
2: 4
3: 72
4: 473
Right 1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127384517 Original CRISPR CTCCCTCCTAGGAGGACTGC AGG Intronic
900316498 1:2059840-2059862 CTCCCTCCTAGGGAGACGGCAGG - Intronic
900469631 1:2847319-2847341 CCCCCTCCCAGGGGGACTGGTGG + Intergenic
901642569 1:10700343-10700365 CTCCCTTCTAGGAGCAGGGCTGG + Intronic
902808545 1:18875492-18875514 CTCTCTCCTAGGAGATCTTCGGG - Exonic
903200144 1:21730317-21730339 CTCCCAAGTAGGTGGACTGCAGG - Intronic
903534344 1:24056722-24056744 CTCCCTCCTTGGACCACTGGCGG + Exonic
903981971 1:27195261-27195283 CTCCCTACCTGGAGGACTGCTGG + Intergenic
904032557 1:27542378-27542400 CTCCTTCCTAGGAGGAGCACAGG + Intronic
905632173 1:39524942-39524964 CTCCCGCCTGGGAGGCCTCCTGG - Intronic
907413425 1:54298053-54298075 CAGTCTCCTAGGAGGCCTGCAGG + Intronic
908013743 1:59810332-59810354 CTCTCTACTAGCATGACTGCAGG + Intergenic
911506869 1:98763853-98763875 CTCCCTCCTAGTAGCAAAGCTGG - Intergenic
918112413 1:181468660-181468682 CTCTCTCCTCTGAGTACTGCTGG - Intronic
920264611 1:204712414-204712436 GTCACTCTTAGCAGGACTGCTGG + Intergenic
920700766 1:208216791-208216813 CGCCCTGGTAGCAGGACTGCAGG + Exonic
920894017 1:210025249-210025271 CACCCACCTAAGAGAACTGCTGG + Intronic
922160754 1:223077933-223077955 TAGCCTCCAAGGAGGACTGCTGG - Intergenic
923456502 1:234169710-234169732 CTCCTTCCTAGCAGGACAGCTGG - Intronic
924245733 1:242082430-242082452 ATCACTCCTAGGAGGTCTGATGG - Intergenic
1065197419 10:23279975-23279997 CTCCTGAGTAGGAGGACTGCAGG + Intronic
1067015554 10:42754677-42754699 CTCCCTCCCCGGAGGGCGGCGGG - Intergenic
1067659539 10:48224144-48224166 CTCCCTCCCAGGGGTACTGGAGG - Intronic
1068977085 10:63021790-63021812 CCCCCTCCTTGCAGAACTGCTGG + Intergenic
1070348633 10:75570331-75570353 TTCCCTGCTAGGAGCTCTGCTGG + Intronic
1071485894 10:86102585-86102607 CTTCCTCTAAGGAGGAATGCAGG + Intronic
1075156164 10:119977697-119977719 CTGCCTCCTAAGAGGAATGATGG + Intergenic
1075929732 10:126285647-126285669 TTCCCTCCTAGGAGGAAAGAGGG - Intronic
1076510506 10:131011087-131011109 CTGCCTCCCAGGAGGCCTCCCGG - Intergenic
1076544560 10:131236662-131236684 CTCCCTCCTTGGAGCCCAGCTGG + Intronic
1077094589 11:793926-793948 CTCCCTCCCTGGAGGACAGATGG + Intronic
1079110826 11:17604260-17604282 TGCCCTGTTAGGAGGACTGCAGG + Intronic
1079300625 11:19275865-19275887 CTTCTTCCTGGGAGGCCTGCAGG + Intergenic
1083256996 11:61502754-61502776 CTTCCTCCTGGGAGGAATGCTGG - Intergenic
1083472356 11:62892527-62892549 CACACACCTAGGAGGACTGTGGG + Intergenic
1083722993 11:64612589-64612611 CTCCTTCCTCTGGGGACTGCTGG + Intronic
1084011073 11:66348626-66348648 CTCCGCCCTAGGAGAAGTGCTGG - Intronic
1084372198 11:68751393-68751415 GTCCCTCCGAGGAGGAATGACGG - Intronic
1084759477 11:71260176-71260198 CTCCCTCCAAGCAGACCTGCTGG - Intergenic
1084892373 11:72242995-72243017 TTCCCTCCTGGGAAGACTGCCGG - Intronic
1084934586 11:72580063-72580085 CTCTCTCCCAGGAGGCCTGGTGG - Intronic
1087137965 11:94739651-94739673 CTCCATCCTTGGAGGACTATTGG - Intronic
1091689291 12:2584721-2584743 CTCCCTCCTAGGAGGACTCTGGG + Intronic
1092845985 12:12585745-12585767 CTCCCTGCTAGGAAGATTCCTGG - Intergenic
1095366925 12:41418699-41418721 TCTCCTCCAAGGAGGACTGCAGG - Intronic
1098439661 12:70504461-70504483 CTCCCTGCAGGGAGGCCTGCAGG - Intergenic
1102903567 12:116657710-116657732 GCCCCTCCTAGGAGGAGTCCAGG - Intergenic
1103042011 12:117703494-117703516 TTCCCTGCTATGAAGACTGCAGG + Intronic
1104072910 12:125362017-125362039 CAGCCTCCTAGCATGACTGCAGG - Intronic
1104847534 12:131854189-131854211 CTCGCACCTATGAGGGCTGCCGG + Intergenic
1104882385 12:132081483-132081505 CTCCCAACGAAGAGGACTGCAGG + Intergenic
1104978290 12:132561772-132561794 CATCCTCCTGGGAGGACTTCTGG - Intronic
1106564196 13:30871125-30871147 CTCCCTTCTGAGAGGACAGCGGG + Intergenic
1107769240 13:43772432-43772454 CTCCCACCTAGATGGACTGTTGG + Intronic
1107857574 13:44631044-44631066 CTCCAACCTATGAGAACTGCTGG + Intergenic
1111964670 13:94848540-94848562 TTCCCTCCTTGGAGAACTACAGG - Intergenic
1114991597 14:28296000-28296022 CTTCCTCCTTGGAGAAATGCTGG + Intergenic
1116028080 14:39537906-39537928 TTTCCTCCTTGGAGAACTGCTGG - Intergenic
1117609677 14:57469338-57469360 CTGCTTCCTAGCAGGACAGCTGG - Intronic
1118719343 14:68583265-68583287 CCCCCTCCTGGCAGGTCTGCAGG - Intronic
1119409845 14:74423768-74423790 CTCCCTCCTAGGAAGACCAGAGG - Intronic
1119644338 14:76337677-76337699 CTCCTTCCTAGGACAACTGTGGG - Intronic
1121068561 14:90994343-90994365 TTCACTCCTAGAAGGACTACTGG + Intronic
1122262250 14:100530332-100530354 CTCCCTCCTCCCAGGCCTGCTGG + Intergenic
1122770696 14:104096383-104096405 GGCCCTCTTAGGAGGTCTGCGGG + Intronic
1122784468 14:104157481-104157503 CTGCCTCCAAGGAGTCCTGCTGG + Intronic
1124099498 15:26680149-26680171 CTTCCTCCTGGGAGGACCTCAGG - Intronic
1125556183 15:40587045-40587067 CTCCCTAGTAGGTGGACTACAGG - Intergenic
1125750017 15:42021618-42021640 CTCCCTCCTGGGAGGCCAGGTGG + Intronic
1126583022 15:50258436-50258458 CTCCCTGCTAGGAGACATGCTGG - Exonic
1127384517 15:58456579-58456601 CTCCCTCCTAGGAGGACTGCAGG + Intronic
1127534173 15:59874508-59874530 CTCCCTGCGATGAGGACAGCAGG + Intergenic
1127545684 15:59993090-59993112 CTCCCTCCAAGTTGGACTTCTGG + Intergenic
1128152473 15:65371916-65371938 CCCCTTCCTGGGAGGACTGAGGG - Intronic
1128886770 15:71295188-71295210 CACCCTCCCAGGATCACTGCAGG - Intronic
1129107081 15:73317943-73317965 CACCCTGCTAAGAGGACAGCAGG + Intergenic
1129229803 15:74190901-74190923 CTCCTTCCTTTGAGGACTACAGG - Exonic
1130447413 15:84016034-84016056 CTGCCTCTTAAGAGGAATGCTGG - Intronic
1130870022 15:87963168-87963190 CTACCTCTGATGAGGACTGCAGG - Intronic
1132613868 16:830940-830962 CTGCCTCCTCGTAGGACTGAAGG + Intergenic
1132897544 16:2236221-2236243 CTCCCTCCTAGGGGGCTGGCAGG + Exonic
1133199222 16:4192302-4192324 CTCCCATGTAGGAGCACTGCTGG + Exonic
1133779280 16:8924748-8924770 TACCCTCCCAGGAGGACTGATGG - Intronic
1138455921 16:57120685-57120707 GGCCCTCCTAGGAGGAAGGCAGG - Intronic
1139636200 16:68260024-68260046 ATCCCTCATAGGAAGGCTGCGGG - Exonic
1141440799 16:84028612-84028634 CCACCTGCTAGGAGGGCTGCGGG + Intronic
1141448153 16:84077100-84077122 CTCCCAAGTAGGTGGACTGCAGG - Intronic
1141555406 16:84833864-84833886 CTGCCTCCTGGGAAGGCTGCTGG - Intronic
1142745705 17:1956665-1956687 TTGCCTCCTGGGAGGGCTGCAGG + Intronic
1145291276 17:21548311-21548333 GTCCTTACTAGGAGGACTTCTGG + Intronic
1146261919 17:31427569-31427591 CTGCCTCCTAGGTGGACTTGAGG + Intronic
1147253056 17:39165203-39165225 CTCCTTCCTGGGAGGTCTGGTGG - Intronic
1147592216 17:41691243-41691265 CTCCCTTCTAGTAGTACAGCTGG - Exonic
1147869011 17:43574232-43574254 TTCCCTCCTAGGTGGTCAGCAGG + Intronic
1148156875 17:45429756-45429778 CTGCTTCCTAGGAGGCCGGCGGG + Intronic
1150272039 17:63872968-63872990 CCCCCACCAAGAAGGACTGCTGG + Intronic
1150275586 17:63895864-63895886 CCCCCACCAAGAAGGACTGCTGG + Intronic
1152532662 17:80928989-80929011 ATGCCTCCTAGCAGGATTGCTGG - Intronic
1153878347 18:9396933-9396955 CTCCCTCGTAGCTGGACTACAGG - Intronic
1157392307 18:47312966-47312988 CTCCCTGAAAGGAGGACTGCTGG + Intergenic
1160337282 18:78053822-78053844 CTCCCTGCTTGGAGCACTGGAGG - Intergenic
1160702155 19:512842-512864 CTCCCTCCTGGGTGGGTTGCTGG + Intronic
1160764043 19:799164-799186 CTCCCTCCCAGCAGGACCCCAGG - Intronic
1162069625 19:8145989-8146011 TGCCCTCCTAGGAAGGCTGCAGG + Intronic
1162770989 19:12949217-12949239 CGGGCTCCTAGGAGCACTGCGGG - Intronic
1163667175 19:18608673-18608695 CTCCCTCCTGGGAGGACTTCAGG + Intronic
1163938837 19:20474721-20474743 CACCCTCCTAGGAGGTTTGTTGG + Intergenic
1164988752 19:32669254-32669276 CTTCTCCCTAGGAGGACTGGCGG - Intronic
1165332567 19:35149129-35149151 TTCCCACCTATGAGGACTGTGGG + Intronic
1167619711 19:50553956-50553978 TTCCATCCCAGGAGGCCTGCTGG + Intronic
925668791 2:6290116-6290138 CTCCCTCCTGGGTGCTCTGCTGG + Intergenic
925913333 2:8587381-8587403 CTCCCTCCTCCCAGGCCTGCAGG + Intergenic
929567611 2:42999602-42999624 CTGCCTCCTGGGATGACTCCAGG - Intergenic
931108470 2:59083891-59083913 ATCCCTTCTATGGGGACTGCAGG + Intergenic
931505986 2:62926818-62926840 CTCAGTAGTAGGAGGACTGCTGG - Intronic
934739196 2:96706995-96707017 CTCCCACATGGAAGGACTGCAGG + Exonic
937122780 2:119452240-119452262 CTGCCACCCAGGAGCACTGCTGG + Intronic
941927011 2:170905960-170905982 CTCAGTCATAGGAGGACAGCTGG + Intergenic
942463261 2:176184262-176184284 CTCCATCCTAGGATGACTGAGGG + Intergenic
946325193 2:218981447-218981469 CGCCCTCCTCAGGGGACTGCGGG + Exonic
946516531 2:220417548-220417570 CTCCATTCCAGGAGGACTGCGGG + Intergenic
1168831631 20:848304-848326 CTCCCTCCACAGAGGCCTGCAGG - Intronic
1172025450 20:31945400-31945422 CTCCCTTCTGAGAGGAATGCTGG + Exonic
1172440325 20:34960874-34960896 CTCCCTCCCAGGATGACTGTGGG - Intergenic
1175216278 20:57393009-57393031 CTCCCTCCTGCGAGGACAGCTGG - Intronic
1175403001 20:58711167-58711189 CTGCTTTCTAGGAGGACTTCAGG + Intronic
1175600510 20:60268853-60268875 CTCCCTCCTAGTAGGCTTGATGG - Intergenic
1176057341 20:63155678-63155700 CTTCCTCCTCTGAGGCCTGCAGG - Intergenic
1176268450 20:64222958-64222980 CTCAGTCCTTGGAGGACAGCCGG - Intronic
1179258568 21:39738809-39738831 CTCCCTCATAGGAGGGATGAGGG + Intergenic
1179633893 21:42695262-42695284 GTCCCTCCAAGGAGGAATGCTGG - Intronic
1179666653 21:42917415-42917437 CACCCTCCTAGAAGGTTTGCTGG + Intergenic
1180847336 22:18991078-18991100 CTCCCTCCCAGGGACACTGCAGG - Intergenic
1181175617 22:21033129-21033151 CTCCCCCACAGGAGGGCTGCAGG - Intergenic
1184017312 22:41795779-41795801 GGCCCTCCAAGGAGGCCTGCAGG - Exonic
1184939128 22:47748111-47748133 CTCCATCCCAGGAGGACAGAAGG - Intergenic
950233717 3:11299485-11299507 CTCCCTCATAGGTGGACCACAGG + Intronic
950440086 3:13005426-13005448 CTGCTGCCTTGGAGGACTGCTGG - Intronic
954683063 3:52356246-52356268 CTCCTTCCTGGAAGGACTTCTGG - Intronic
958539303 3:95449731-95449753 CTCCTTCCTAGGATGACTCCTGG + Intergenic
959689885 3:109187470-109187492 CAGCCTCCTAGCAGGACTCCAGG + Intergenic
966176068 3:177138889-177138911 CTCCCTAGAAGGAGTACTGCTGG + Intronic
966324722 3:178741375-178741397 CTTCCTTCTAGGAGGAATGGAGG - Intronic
968148686 3:196320440-196320462 CTGCCTCCTACGAGCTCTGCTGG + Intronic
968966291 4:3770619-3770641 CTGCCTCCTGGGAGGTCTTCAGG + Intergenic
969572333 4:8016569-8016591 CTGCCTCCTGGGAGGGTTGCAGG + Intronic
969624896 4:8297457-8297479 CTCCCTGCTAGAAGGAAAGCGGG - Intronic
975392664 4:73837070-73837092 CTTCCACCTTGGAGCACTGCGGG - Exonic
978319788 4:107481218-107481240 CTCCCTCTAAGGCAGACTGCTGG + Intergenic
980937788 4:139242643-139242665 CTCCCTGCCAGGAGAGCTGCTGG - Intergenic
981288447 4:143046672-143046694 CTCCTTCCAAGGAAGCCTGCTGG - Intergenic
982023057 4:151223549-151223571 TTCCCTACTAAGAGGAATGCTGG - Intronic
984243810 4:177250270-177250292 CGCCCTCCTGGGAGCGCTGCTGG + Intergenic
984547534 4:181125431-181125453 CTCCGTTCCAGGAGAACTGCAGG + Intergenic
997605189 5:135170202-135170224 CCCCCTCGAAGGAGAACTGCAGG - Intronic
999789767 5:154928452-154928474 CTCCATCCTAGGAGGACTTGAGG + Intronic
1001248431 5:170124439-170124461 GTCCCTCCTATGAGGCCTTCCGG + Intergenic
1001884812 5:175279910-175279932 CTCCTTCCTAGGAGGATGGGCGG - Intergenic
1002057391 5:176606295-176606317 CCCCCTCCTGGGAGCACAGCTGG - Intronic
1003843802 6:10151102-10151124 CTCTCTCCTTGGAGACCTGCTGG - Intronic
1005528331 6:26675031-26675053 CTCATTCTTAGGAAGACTGCTGG + Intergenic
1005542464 6:26826608-26826630 CTCATTCTTAGGAAGACTGCTGG - Intergenic
1007652935 6:43434331-43434353 CACCTTCCTAGGAGGAGTGGTGG - Intronic
1007844613 6:44742883-44742905 CACCTCCCTAGGAGGGCTGCTGG + Intergenic
1009013273 6:57868726-57868748 CTCATTCTTAGGAAGACTGCTGG - Intergenic
1013126834 6:107192301-107192323 CTCCCTCCCATGAGGAGTGTTGG - Intronic
1019193684 6:170268736-170268758 CTTCCTCCCGGGAGGGCTGCAGG - Intergenic
1022722250 7:32951811-32951833 TCCCCTCCTAGGAGGAGTTCAGG - Intergenic
1022749982 7:33214206-33214228 CTCCCTCCTTGCATGAGTGCTGG + Intronic
1023097056 7:36672046-36672068 CTGCCTCCTAACAGGACTCCAGG - Intronic
1025075495 7:55939094-55939116 CTCCATCCTAGGAGGACTCTGGG + Exonic
1025987528 7:66466893-66466915 CTCCCTCCTGGAAGCAGTGCTGG - Intergenic
1026003860 7:66584810-66584832 CTCCCTCCTGGAAGCAGTGCTGG - Intergenic
1026027468 7:66758527-66758549 CTCCCTCCTGGAAGCAGTGCTGG + Intronic
1026285403 7:68958307-68958329 CTCCCTAGTAGCAGGACTACAGG - Intergenic
1028137491 7:87237405-87237427 CTCCCGAGTAGCAGGACTGCAGG - Intergenic
1031127144 7:117787889-117787911 CTCCCTCCTTGGAGAACTACTGG - Intronic
1032740415 7:134733038-134733060 CTCACTCCTATTGGGACTGCAGG + Intergenic
1034649116 7:152675817-152675839 CTCCCACCTCGGAGGACTCCAGG + Intronic
1035732641 8:1863646-1863668 CTCCCACCTCGGAGGGCTCCTGG - Intronic
1039844593 8:41316801-41316823 CTCCCTCCTGGGAGCCCTGAAGG - Intergenic
1040077059 8:43247010-43247032 CTCCGTCAGAGGAGGACGGCGGG + Intergenic
1043962833 8:86437130-86437152 CTGCCTCCAAGGAGGCATGCTGG + Intronic
1044302700 8:90604751-90604773 TACCCTCCTTGGAGAACTGCAGG - Intergenic
1047489800 8:125365133-125365155 CTCTCTTCTAGGAGGGCTACTGG + Intronic
1049069074 8:140343275-140343297 CACTCTCCAAGGATGACTGCTGG + Intronic
1049666459 8:143845742-143845764 CTCCCTCCTGTGAGGCATGCAGG + Intergenic
1050290316 9:4147663-4147685 CTCCCTTCAAGGGGAACTGCTGG + Intronic
1050353696 9:4763464-4763486 CGACCTCCTAGGAGGAAGGCGGG + Intergenic
1059481775 9:114596449-114596471 CTGGCTCTGAGGAGGACTGCAGG - Intronic
1060201325 9:121653166-121653188 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201330 9:121653196-121653218 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201335 9:121653226-121653248 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060201340 9:121653256-121653278 CTCCCTCCAAGGAGTACTAAAGG - Intronic
1060403713 9:123362538-123362560 CTGCCTCAAAGGGGGACTGCAGG + Intronic
1061323750 9:129849402-129849424 GTTCCTCCCAGGAGGAATGCTGG + Intronic
1061383655 9:130275846-130275868 GTCCCTCCTTGGAGGCCTGGAGG + Intergenic
1061383990 9:130277289-130277311 GTCCCTCCGAGCAGGCCTGCTGG - Intergenic
1062091953 9:134682987-134683009 CACGCTCCTACGAGGCCTGCTGG - Intronic
1185953620 X:4464640-4464662 CTCCCTCCTTGGATGACAGCTGG - Intergenic
1193437809 X:81499923-81499945 CTCACTCTTTGGAGGACTGTAGG + Intergenic
1195210714 X:102651053-102651075 CGCCCCCCTATAAGGACTGCTGG - Intergenic
1197749496 X:129954862-129954884 CTCCCTCCAGGGAGGACTGGGGG - Intergenic
1199737035 X:150694019-150694041 CTCCCTCCCAAGAGGATTGGTGG - Intronic
1200048095 X:153413198-153413220 CTCCCACCGAGTGGGACTGCTGG + Intergenic
1200067694 X:153512081-153512103 ACCCCTCCTTGGAGGGCTGCAGG + Intergenic