ID: 1127389305

View in Genome Browser
Species Human (GRCh38)
Location 15:58492271-58492293
Sequence TTCCATGGCCATAGAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127389305 Original CRISPR TTCCATGGCCATAGAGAGCA TGG (reversed) Intronic
900480774 1:2898098-2898120 TTCCATGGCCAGAAACAGTACGG + Intergenic
902898516 1:19496558-19496580 TTCCATGGCAACACAGAACAGGG - Intergenic
904834999 1:33329995-33330017 TTCCATGGCCCTCGACACCACGG - Intronic
905108664 1:35578649-35578671 CTCCAGGGCCAAAGACAGCAAGG - Intronic
905183314 1:36179385-36179407 ATCCATGGCCACGGAGAGCGAGG + Intronic
908034911 1:60041624-60041646 CTCCATGGCAAGAGAGAACAGGG - Intronic
910163957 1:84303233-84303255 TTCCATGTCAACAGATAGCATGG - Exonic
911481000 1:98440115-98440137 TTCTATGGTCACAGAGAGTATGG + Intergenic
914343598 1:146779873-146779895 TTCCAGTGCCACAGGGAGCAGGG - Intergenic
914987160 1:152471027-152471049 TCCCATGGCCATGGAAAGGAAGG + Intergenic
915812338 1:158926941-158926963 TCACATGGCCACAGAGATCAAGG - Intergenic
915911929 1:159920682-159920704 TCCCAGGGCTATAAAGAGCAGGG - Intronic
916839331 1:168583871-168583893 TTCCTTGGCTGTAGAGAGCCAGG + Intergenic
917222217 1:172744031-172744053 TTCCATGGCCTCAGGGAACATGG - Intergenic
918685996 1:187416376-187416398 TCCCATGACCACAGAGAACAAGG - Intergenic
918766120 1:188486191-188486213 TTCCATGTCCAAAGACAGCAAGG + Intergenic
919937658 1:202265254-202265276 TCCCATGGTGACAGAGAGCATGG - Intronic
920804380 1:209219487-209219509 TCCTATGGCCATAGACTGCAAGG - Intergenic
921712551 1:218387432-218387454 TTCCAGGAACATAGACAGCATGG - Intronic
921788358 1:219260770-219260792 TTCCATGGAAATACAGAGAAAGG - Intergenic
922181915 1:223242490-223242512 TTCCAGGGACATTGGGAGCATGG - Intronic
922780338 1:228247319-228247341 TTCCATGTCCATAAAAAGGAGGG - Intronic
922966872 1:229697802-229697824 TTGCATGCCCAGAGAGGGCATGG - Intergenic
923532409 1:234821902-234821924 CCCCATGGACCTAGAGAGCAAGG - Intergenic
1062971795 10:1654113-1654135 TGCAATGGCCACAGAGAACAGGG - Intronic
1063893848 10:10658261-10658283 TCTCAAGGCCATAAAGAGCAGGG - Intergenic
1065008821 10:21403598-21403620 TCCCATGGCCACAGAGAACAAGG + Intergenic
1065791610 10:29265669-29265691 TTGCATGGCCTCAGAGAGAAAGG + Intergenic
1066201741 10:33148342-33148364 TTCCATGGCCAAATAAAACAAGG - Intergenic
1066420421 10:35260008-35260030 TACCAGGGCCAGAGAAAGCACGG + Intronic
1068505903 10:57898712-57898734 TCTCATGGCCATGGAGAACAGGG - Intergenic
1069061254 10:63896901-63896923 TTTCATGGCCCAAGTGAGCAGGG - Intergenic
1071133317 10:82421665-82421687 TTTCGTGGCCATAGTGAGAATGG + Intronic
1072233881 10:93436893-93436915 TTCCATGAAAATATAGAGCAAGG - Intronic
1073667234 10:105547190-105547212 TTACATGGCCCTAGCCAGCATGG + Intergenic
1073947921 10:108773544-108773566 TGGCATAGCCAGAGAGAGCATGG - Intergenic
1074101192 10:110356069-110356091 TTCCGTTGCCCAAGAGAGCAGGG + Intergenic
1074482759 10:113840616-113840638 TTTCATGGCCAAAGGGAGGAGGG - Intronic
1075117499 10:119639091-119639113 TTCCATGGGCAAAGACAGAAAGG - Intergenic
1078579040 11:12524791-12524813 TTCCTTGAACACAGAGAGCATGG - Intronic
1080311993 11:30905451-30905473 TGCCATGGCCAGAGAGAGCCTGG + Intronic
1082692690 11:56325145-56325167 TTCCAGGCTCATAGAGAGAAGGG + Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085523425 11:77151176-77151198 CTGCATGGTCCTAGAGAGCAAGG + Intronic
1085730342 11:78992493-78992515 TTCCATGGCTTAAAAGAGCACGG + Intronic
1087183036 11:95158258-95158280 GTATATGGGCATAGAGAGCAAGG + Intergenic
1091649398 12:2298711-2298733 TTCTGCGGCCATAGAGGGCACGG - Intronic
1093170252 12:15852315-15852337 ACCCATGCCCACAGAGAGCATGG + Intronic
1093545922 12:20347819-20347841 TTCCATGCTCATAGATTGCAAGG + Intergenic
1093594637 12:20945991-20946013 CTCCTTGGCCAAGGAGAGCAAGG + Intergenic
1097932659 12:65206619-65206641 TGCCATGGCCTGAGAGAGAAGGG + Intronic
1098156582 12:67605747-67605769 TTCCATGATCACAGAGAGCTTGG + Intergenic
1098611710 12:72466945-72466967 CACCATGACGATAGAGAGCAAGG + Intronic
1099431911 12:82596633-82596655 TTCTATGGCCATAGAAACCTGGG + Intergenic
1099801406 12:87461431-87461453 TGCCAGGCCCAGAGAGAGCAAGG + Intergenic
1100684863 12:96976529-96976551 TTCCATGGAAATAGAGAGGTTGG + Intergenic
1102442999 12:112977968-112977990 TTCCCTGGCCACTGAGAACAGGG + Intergenic
1103057391 12:117832666-117832688 TTCCAGAGCCCTAGAGAGCAGGG + Intronic
1103618953 12:122174167-122174189 GGCCATGGCGAGAGAGAGCAAGG + Exonic
1103631485 12:122265266-122265288 TTCCAAGGCCATATAGACCTTGG + Intronic
1106054324 13:26223733-26223755 TTCCATGGGAAAAGAGGGCAAGG - Intergenic
1107659665 13:42625892-42625914 TTCCATGTCCATTGGGATCAGGG - Intergenic
1110907245 13:80907123-80907145 TTCCATGGCAAAAAAGAGGAAGG + Intergenic
1115855160 14:37622655-37622677 CTGCATGGCCAAAGAGAGGAAGG + Intronic
1118380275 14:65212401-65212423 TTCCATGGCCAAAGAGTGGTGGG + Intergenic
1118681507 14:68246214-68246236 TCCCATGGCCAAACAGAGCCAGG - Intronic
1118951223 14:70438226-70438248 ATCAATGGCCATAGGAAGCAAGG - Intergenic
1121232924 14:92371714-92371736 TCTCATGGCCATGGAGATCAAGG - Intronic
1121299647 14:92860394-92860416 ATCCATATCCATAGAGAGCTTGG + Intergenic
1121327155 14:93027862-93027884 TTCCTTGGGCACTGAGAGCAGGG - Intronic
1122105292 14:99448567-99448589 TCCCATGACCATAGAATGCAAGG + Intronic
1123006982 14:105328480-105328502 GTGAATGGCCATAGAGAACAGGG + Intronic
1123179030 14:106450379-106450401 TTCTATGTCCATTGATAGCATGG + Intergenic
1125791089 15:42366292-42366314 GTCCATGTCGATAGACAGCACGG - Intronic
1127377855 15:58401671-58401693 TCCCATGGCCACTGTGAGCAGGG - Intronic
1127389305 15:58492271-58492293 TTCCATGGCCATAGAGAGCATGG - Intronic
1128342926 15:66835207-66835229 TGCCATGGCGATAAAGATCAGGG + Intergenic
1129371432 15:75098376-75098398 ACCCAGGGCCACAGAGAGCATGG + Intronic
1129810963 15:78509411-78509433 TTCCATAGCCATGTAAAGCAAGG - Intronic
1130359782 15:83172243-83172265 TTACATGGCCAAAGACAGAAGGG - Intronic
1130714413 15:86317361-86317383 TTCCTTGGTAATAAAGAGCAAGG + Intronic
1131008972 15:89001688-89001710 TCTCATGGCCACAGAGATCAAGG - Intergenic
1132425065 15:101709266-101709288 TTCCATAGCCAGTGAGGGCAGGG - Intronic
1133838971 16:9391788-9391810 TTCCGTTGCCATAGAGAGCCAGG + Intergenic
1134804954 16:17116285-17116307 TTCCATCCCCATGGAGAACAGGG - Intronic
1135020055 16:18955788-18955810 TCTCATGGCCATAGAGATCAAGG + Intergenic
1138660620 16:58515112-58515134 TTCCATGGCCATCGGCAACAAGG + Intergenic
1139990393 16:70935461-70935483 TTCCAGTGCCACAGGGAGCAGGG + Intronic
1141048157 16:80735888-80735910 ATCCAAGGCTAGAGAGAGCAGGG + Intronic
1141485991 16:84340731-84340753 TTCCACAGCCACAGGGAGCAGGG + Intergenic
1143866761 17:9929200-9929222 TTCCATGTCCTTAGAGACCCCGG - Intronic
1144906922 17:18643995-18644017 ATCTAGGGCCATAGAGACCAGGG + Intronic
1145239058 17:21228980-21229002 GCCCAGGGCCAGAGAGAGCAGGG + Intergenic
1149534009 17:57417996-57418018 CTCCAAGTACATAGAGAGCAGGG + Intronic
1150367207 17:64599740-64599762 TTCCAAGGACATGGGGAGCAGGG - Intronic
1150482401 17:65520605-65520627 TTCCATGAGCATAGAGGGAAAGG + Intergenic
1150557497 17:66267736-66267758 TGACATGGCCATAGACAGCTGGG - Intergenic
1151051192 17:70980045-70980067 TTCCATGGAAGTAGAGATCAGGG - Intergenic
1152490678 17:80631148-80631170 TTCTATGCCCATGGTGAGCAAGG + Intronic
1156467050 18:37354277-37354299 TTCCAGGGCCATGCAGAGTAAGG + Intronic
1156900192 18:42291594-42291616 TTCTAAGGACATAGAGAGCAAGG - Intergenic
1157499740 18:48181267-48181289 TTCCTTAGCCTTAGAGAGCAAGG - Intronic
1157570316 18:48708051-48708073 TTATATGGCCATAAAGAGGAAGG - Intronic
1158093877 18:53747957-53747979 TTCCATGGCAATGGAAAACATGG + Intergenic
1159379236 18:67634870-67634892 TTCCATGGGAATAGAAGGCAGGG - Intergenic
1159784993 18:72703057-72703079 TCACATGGCAAGAGAGAGCAAGG + Intergenic
1160992597 19:1865853-1865875 TTACAGGGTCATAGAGAGTAAGG - Intergenic
1163252896 19:16137041-16137063 TCTCATGGCCATGGAGAACAAGG - Intronic
1165062570 19:33212092-33212114 GTCCATAGCCAGAGAGAACAGGG + Intronic
1168275763 19:55277490-55277512 CTCCATTGCCATAAGGAGCAAGG - Intronic
925189356 2:1870359-1870381 TTCCATAGCCACACAGAACAGGG - Intronic
925735722 2:6961969-6961991 TTTCATGGCCAGGGAGAACAAGG + Intronic
927046387 2:19283090-19283112 GTCCCTGGCAATAGAGAGGATGG - Intergenic
927286540 2:21362863-21362885 TCTCATGGCCATGGAGATCAAGG + Intergenic
931697310 2:64880888-64880910 TTCCTTGGCCAAAGAGTGCAGGG - Intergenic
933187264 2:79291865-79291887 TGCCATGGCAATAGAAACCATGG - Intronic
933368896 2:81390065-81390087 TCTCATGGCCATGGAGAACAAGG - Intergenic
934986105 2:98886062-98886084 TGCCATGGAACTAGAGAGCAGGG - Intronic
935574818 2:104698309-104698331 TTCCATGACTAGAGAAAGCAGGG + Intergenic
936660659 2:114539641-114539663 TTCCATGCACGTAGAGAGCATGG + Intronic
936956503 2:118027971-118027993 TCTCTTGGCCATGGAGAGCAAGG + Intergenic
938072022 2:128313709-128313731 TTCCCTGGCCCTAGGGACCAAGG + Intronic
938572494 2:132573039-132573061 GCCCATGGCCATTGGGAGCAAGG - Intronic
940772753 2:157856648-157856670 TTCCATGCACATACAGAGAAGGG + Intronic
940772940 2:157858214-157858236 TCCTATCGCCATAGAGAGGAAGG - Intronic
945569136 2:211442121-211442143 TTGCTTGGCCATAGAGTTCAAGG - Intronic
947633795 2:231670102-231670124 TACCATTGCCATACAAAGCAAGG - Intergenic
947710733 2:232314084-232314106 TTCCATGGCAATGGAAATCAGGG - Intronic
947900093 2:233714041-233714063 TTCAATGGCCACTGAGAGGAAGG + Intronic
1169475543 20:5928179-5928201 TTCCAGGGCGATCGAGAGCATGG + Intergenic
1172189097 20:33050902-33050924 AACCATAGCCATAGAGAGTATGG + Intergenic
1172605231 20:36209474-36209496 TTATCTGGCCATAGAGAGCAGGG + Exonic
1173712999 20:45176641-45176663 TCCCATGGTGAAAGAGAGCAGGG + Intergenic
1174772111 20:53310024-53310046 TTCCATGGTCAGAGAGAGTTGGG - Intronic
1175495411 20:59410953-59410975 TTCCAAGGCCATGTAGAGAATGG + Intergenic
1175602746 20:60288075-60288097 TTCAAGGGACATAGAGTGCAGGG - Intergenic
1177841258 21:26236342-26236364 TTCCATGGTCATAGAGCCCAGGG - Intergenic
1178093279 21:29187113-29187135 TTCCATGTGCAGGGAGAGCATGG + Intergenic
1180984333 22:19895551-19895573 CTCCATGGTCATAGAGCACATGG - Exonic
1182091809 22:27601051-27601073 TGCCCTGGCCATGGACAGCAGGG + Intergenic
1184267787 22:43358992-43359014 TACCGTGGCCCTGGAGAGCAGGG - Intergenic
1184295142 22:43518558-43518580 TTCCAAGGCCAGAGGAAGCAAGG - Intergenic
1184880064 22:47299128-47299150 TTGCGTGGCCCTGGAGAGCAGGG + Intergenic
1185123854 22:48993057-48993079 CTCCATGGGCAGAAAGAGCAGGG - Intergenic
952604256 3:35125167-35125189 TTCCATGGGGATGGAGAGGAAGG - Intergenic
953463023 3:43096607-43096629 TTCCAGGGCCACACAGACCAGGG + Intronic
954532351 3:51332167-51332189 TCTCATGACCTTAGAGAGCAAGG + Intronic
954635805 3:52070232-52070254 TGTGATGGCCCTAGAGAGCATGG + Intergenic
954955853 3:54517811-54517833 TTCCAAGGGCATGCAGAGCAAGG - Intronic
954981235 3:54747399-54747421 ATCCACAGCCATAGAGAGTAAGG - Intronic
956253986 3:67264264-67264286 TCTCATGGCCATGGAGAACAAGG - Intergenic
956600466 3:71015604-71015626 CACCATGTCCATAGAGAGGATGG + Exonic
961451405 3:127003926-127003948 CTCCATGGCCTTACAGAGCTGGG - Intronic
965388973 3:168081381-168081403 TTCCATGGACATAGTAGGCAGGG + Intronic
969375492 4:6760859-6760881 GTCTATGGCCGTAGAGAGAAGGG - Intergenic
970561889 4:17290033-17290055 TTCCTTGGCCATACAGGCCACGG + Intergenic
970685644 4:18563899-18563921 TTCCATGTTCATGGATAGCAAGG + Intergenic
970711090 4:18863410-18863432 CTCCATAGTCATAGAGAGCTAGG - Intergenic
971479863 4:27104764-27104786 TTTCATGTGCTTAGAGAGCAAGG + Intergenic
972649292 4:41000984-41001006 TTCTTTGTCCACAGAGAGCAAGG + Intronic
976334644 4:83871312-83871334 TTCCTTGGCCATAGTGACCTTGG + Intergenic
976466116 4:85370477-85370499 TTCCTTGGCTACCGAGAGCAGGG + Intergenic
977730806 4:100349475-100349497 TGGCATGGCCAGAGACAGCAGGG + Intergenic
978187296 4:105871757-105871779 CTTCATGGACACAGAGAGCAGGG - Intronic
979252634 4:118581269-118581291 TTCCAAGGTCATAAAAAGCAAGG - Intergenic
979850907 4:125570254-125570276 TTCCATGCTCATGGATAGCAAGG - Intergenic
983926045 4:173403436-173403458 TTCCCTGGGCATAGAGAGTAAGG + Intronic
990343103 5:54844466-54844488 TTCCAAGGCCATACACACCAAGG + Intergenic
990535228 5:56715227-56715249 TTCCAATGACAGAGAGAGCATGG + Intergenic
991188912 5:63845538-63845560 TTCCATGGCGATAGAAGGCATGG - Intergenic
991231169 5:64334044-64334066 GTCCAGGGCCACATAGAGCAGGG + Intronic
995028860 5:107456776-107456798 TTCTATGGCCATATTGAACAAGG - Intronic
995412608 5:111875796-111875818 TCTCATGGCCACAGAGATCAAGG + Intronic
995472142 5:112513922-112513944 TTTCATGGCCACAGAGATCAAGG + Intergenic
996583908 5:125063510-125063532 TTTCATGGCCACGGAGATCAAGG + Intergenic
997079721 5:130724059-130724081 TCTCATGGCCACAGAGATCAAGG - Intergenic
997325295 5:133015613-133015635 TTACATGGCTATTGACAGCAGGG - Intronic
999033042 5:148315688-148315710 CTCCATGGACATAGAGAGAAAGG + Exonic
999350404 5:150864827-150864849 TGCAATGGCCATAAAGACCATGG + Intronic
1001667063 5:173442007-173442029 TGCCATGGCCTCAGGGAGCATGG - Intergenic
1002998572 6:2309868-2309890 CTCCATGACCATAGAGAGCCAGG - Intergenic
1003234848 6:4286410-4286432 TTCCAGGGGCAGAGAGAACAAGG + Intergenic
1003413186 6:5884107-5884129 TTCCATGGACAAAGAGAACTTGG + Intergenic
1004288528 6:14345609-14345631 TCCCATGGCCATAGAGCGCCTGG + Intergenic
1006213892 6:32421829-32421851 TCTCGTGGCCATAGAGATCAAGG + Intergenic
1007750755 6:44069730-44069752 TTCCATGACCAGAGTGAGAAGGG - Intergenic
1011901125 6:92299925-92299947 TTCATTGGGCATAGAGATCAGGG + Intergenic
1012217806 6:96609814-96609836 TGCCATGGCCATAGTGAGCTAGG - Intronic
1013071761 6:106735947-106735969 TTCCATGGTTAAAGAGAGGAAGG - Intergenic
1015816029 6:137211673-137211695 TCCCATGGCCATTCATAGCAGGG + Intronic
1018008002 6:159641286-159641308 TCTCATGGCCATGGAGATCAAGG - Intergenic
1019273653 7:164610-164632 TTCCATGGCCATCAGGAGCAGGG + Intergenic
1019281384 7:202176-202198 TCCCATGTGCATAGAGAGGACGG + Intronic
1019281452 7:202468-202490 TCCCATGTGCATAGAGAGAATGG + Intronic
1019294311 7:265964-265986 TCCCATGGCCCTAGAGGGCCAGG - Intergenic
1020481875 7:8671300-8671322 TTCAATGGCCAAAGACAGCTGGG - Intronic
1021590362 7:22254708-22254730 TTCCATGGACTTGGAGAGGAAGG + Intronic
1022564307 7:31382196-31382218 TTGAATGCCCATACAGAGCAGGG + Intergenic
1022976822 7:35566355-35566377 TGCCATGGGCAAAGAGAACAGGG + Intergenic
1023018160 7:35986155-35986177 TTCCATGGCCACAGATGGCCCGG + Intergenic
1023260555 7:38354185-38354207 TTCCAAGGCCTCAGAGAGGAAGG - Intergenic
1023261529 7:38363330-38363352 TTCCAAGGCCCCAGAGAGGAAGG - Intergenic
1023262027 7:38368057-38368079 TTCCAAGGCCCCAGAGAGGAAGG - Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1026245215 7:68613556-68613578 TTACATAGCCATAGCGTGCAGGG - Intergenic
1026577393 7:71583602-71583624 TTCCCTGGCATTAGATAGCAGGG + Intronic
1027469871 7:78560070-78560092 TTCCATGCCCACACAAAGCAGGG + Intronic
1030013115 7:105190690-105190712 TTCCAAGGGCATAGAGATCTGGG - Intronic
1030533173 7:110735410-110735432 TTTCAGGGCCACAGAGATCAAGG - Intronic
1035024726 7:155818082-155818104 TTCCGTGGCCCAAGGGAGCATGG - Intergenic
1035244287 7:157552089-157552111 TGCAGTGGCCATAGAGTGCATGG - Intronic
1035654054 8:1292265-1292287 TTCCTTGGCCAGAAAGAGCCAGG - Intergenic
1037518989 8:19661657-19661679 TCCCATTGTCATAAAGAGCATGG - Intronic
1038257708 8:25965961-25965983 TTCCTTGTTCATAGAGTGCAGGG - Intronic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1041177391 8:55210654-55210676 TCTCATGGCCACAGAGATCAAGG + Intronic
1042748009 8:72128255-72128277 TTGCATGGCCATGGAGAACAAGG - Intergenic
1043587733 8:81788858-81788880 TCACATGGCAAGAGAGAGCAAGG + Intergenic
1043850899 8:85215636-85215658 TGGCATGCCCAGAGAGAGCAGGG + Intronic
1044857160 8:96488278-96488300 TTCCAGGGCCTTGGAGAGGATGG + Intergenic
1048316887 8:133369443-133369465 ACCCATGGACACAGAGAGCAGGG - Intergenic
1049243945 8:141551605-141551627 TTCCCTGGCCATCCTGAGCAGGG + Intergenic
1051752203 9:20354356-20354378 TGCCCTGGCCCTACAGAGCAAGG + Intronic
1054762629 9:69016610-69016632 CTCCATGGCCTTGGGGAGCAAGG + Intergenic
1054887416 9:70213547-70213569 TTCCATGGAAAGAGAGATCAAGG - Intronic
1060604064 9:124898692-124898714 TTCCCTGGGCACAGGGAGCATGG + Intronic
1060665085 9:125428007-125428029 TTCCATGGCCACAGAGGTCTGGG - Intergenic
1186640084 X:11446239-11446261 TTCCATGTCCAGAGTGAGAAAGG + Intronic
1189841227 X:45080907-45080929 TTCCATAGCCAAAGAAAGCTTGG + Intronic
1190653378 X:52589766-52589788 TAGCATGCCCATAGAGGGCATGG + Intergenic
1190848786 X:54217791-54217813 TTCAATGGCCATACACTGCAGGG + Intronic
1190955595 X:55189884-55189906 TACCATGCCCACAGAGAGCATGG - Intronic
1192708763 X:73557712-73557734 TCTCATGGCCACAGAGATCAAGG + Intergenic
1193246580 X:79237152-79237174 TTCCAAGGCTGCAGAGAGCAGGG + Intergenic
1194764474 X:97833509-97833531 TTCCATGGGCATAGAAAAAAGGG + Intergenic
1194906167 X:99578247-99578269 TTCCATGACAATAGAAGGCAGGG - Intergenic
1194930328 X:99880423-99880445 TGGCATGACCACAGAGAGCAAGG + Intergenic
1197107631 X:122734579-122734601 TTCCATGATCATAGATAGTAAGG + Intergenic
1198227984 X:134664079-134664101 TTCCACTGCCAGAGAAAGCAAGG - Intronic
1198477210 X:137006989-137007011 TTCCATGCTCATAGATAGGAAGG + Intergenic
1199075417 X:143520253-143520275 TTCCATGGCCACAAAGAGCAAGG + Intergenic
1199732046 X:150644254-150644276 TACCAGGGCCATAGAGGGAAAGG + Intronic
1201987015 Y:19979763-19979785 TTCCTTGGGCATAGAGAGTTGGG + Intergenic