ID: 1127391104

View in Genome Browser
Species Human (GRCh38)
Location 15:58505831-58505853
Sequence GAGTATCCTGCTTTCATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127391099_1127391104 5 Left 1127391099 15:58505803-58505825 CCAAAAACCATCACCTCTATCAT 0: 1
1: 0
2: 0
3: 31
4: 291
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391095_1127391104 25 Left 1127391095 15:58505783-58505805 CCCGAGCCAACATTCCAAGGCCA 0: 1
1: 0
2: 0
3: 4
4: 168
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391101_1127391104 -8 Left 1127391101 15:58505816-58505838 CCTCTATCATGAGTTGAGTATCC 0: 1
1: 0
2: 1
3: 3
4: 57
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391092_1127391104 29 Left 1127391092 15:58505779-58505801 CCCACCCGAGCCAACATTCCAAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391096_1127391104 24 Left 1127391096 15:58505784-58505806 CCGAGCCAACATTCCAAGGCCAA 0: 1
1: 0
2: 1
3: 19
4: 168
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391098_1127391104 11 Left 1127391098 15:58505797-58505819 CCAAGGCCAAAAACCATCACCTC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391093_1127391104 28 Left 1127391093 15:58505780-58505802 CCACCCGAGCCAACATTCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391100_1127391104 -2 Left 1127391100 15:58505810-58505832 CCATCACCTCTATCATGAGTTGA 0: 1
1: 0
2: 1
3: 27
4: 171
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86
1127391097_1127391104 19 Left 1127391097 15:58505789-58505811 CCAACATTCCAAGGCCAAAAACC 0: 1
1: 0
2: 0
3: 8
4: 189
Right 1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG 0: 1
1: 0
2: 0
3: 16
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127391104 Original CRISPR GAGTATCCTGCTTTCATTAG GGG Intronic
908022810 1:59915792-59915814 GAATATCCAGCTTTCTTTAGTGG + Intronic
916196313 1:162226588-162226610 GAGTAACCTGATTTAATTTGGGG + Intronic
917151378 1:171948770-171948792 CAGGATTCTGTTTTCATTAGAGG + Intronic
919497466 1:198291853-198291875 GAGTATAGTGCTTTGATTATTGG + Intronic
923779296 1:237008072-237008094 TAGTTTCCTGCCTACATTAGAGG - Intergenic
1065910838 10:30304095-30304117 CAGTGCCCAGCTTTCATTAGCGG + Intergenic
1067276596 10:44840401-44840423 CAGTATCCTGAGTTCATGAGAGG - Intergenic
1068386770 10:56339437-56339459 CAATATCCTGCTTTCAGTAGTGG - Intergenic
1068802377 10:61156746-61156768 GAGTATTCTTCTTTGATTACAGG - Intergenic
1071349098 10:84721419-84721441 GGGGATCATGCCTTCATTAGTGG + Intergenic
1079424962 11:20331470-20331492 GAGTATCCTATTTTCCTTAATGG - Intergenic
1081843648 11:46222635-46222657 GAACATCCTGCTTTCACTACAGG + Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1082265997 11:50119068-50119090 GAGGATGCTGCCTTCATTGGAGG + Intergenic
1082290091 11:50359504-50359526 GAGGATGCTGCCTTCATTGGAGG - Intergenic
1085773630 11:79346638-79346660 CAGTCACCTGCTTTCATTATAGG + Intronic
1086678593 11:89640580-89640602 GGGAATCCTGCAATCATTAGAGG - Intergenic
1087531922 11:99393836-99393858 GAGCATCATGATTTGATTAGTGG + Intronic
1092028203 12:5260934-5260956 GAACATTCTGCTTTCATTTGGGG + Intergenic
1093296114 12:17393885-17393907 GAGTCTCATGCTTTCTTTAGTGG - Intergenic
1093379719 12:18477915-18477937 GATTATCCAGCTTTCACCAGAGG + Intronic
1101538972 12:105646871-105646893 GAGGGTTCTGCCTTCATTAGTGG + Intergenic
1105018851 12:132803219-132803241 GAGTATCCTGCCCTCCTCAGCGG + Intronic
1111074662 13:83217879-83217901 GAGGGACCTGCTCTCATTAGTGG + Intergenic
1111460758 13:88539162-88539184 GAGTTCTCTGCTTTCATAAGTGG + Intergenic
1112853694 13:103737565-103737587 GAGTATACTGCTTTAAAAAGTGG - Intergenic
1115901620 14:38157499-38157521 TATTTTCCTGCTTTCATTAGAGG + Intergenic
1116023852 14:39492511-39492533 GAGTATTCTGCCTTCATGAATGG - Intergenic
1121202417 14:92129464-92129486 GAATATCCACCTTTCATAAGAGG - Intronic
1122442737 14:101743804-101743826 TAGTTTTCAGCTTTCATTAGTGG - Intergenic
1123876730 15:24630852-24630874 GAGTGTTCTGCTTTCCTAAGTGG - Intergenic
1127391104 15:58505831-58505853 GAGTATCCTGCTTTCATTAGGGG + Intronic
1131181788 15:90245086-90245108 TAGTTTCCAGTTTTCATTAGAGG + Exonic
1139162286 16:64525237-64525259 GAATCTCCTTCTTTCATTTGGGG + Intergenic
1139758601 16:69165913-69165935 GAATAACCTGGTTTCATTAAAGG + Intronic
1145756826 17:27398320-27398342 TAGTATCTTGCTTTCATTTCGGG + Intergenic
1149900365 17:60471358-60471380 TAGTTGCCTGCTTTCACTAGTGG - Intronic
1151016222 17:70556551-70556573 GAGTAACATTCTATCATTAGTGG - Intergenic
1164181214 19:22820372-22820394 CTGTGCCCTGCTTTCATTAGAGG + Intergenic
936909168 2:117572559-117572581 GAGTAACCTGCTGTCACTACAGG - Intergenic
937649244 2:124301578-124301600 GTGTGTCCTGCTTTCTTTTGTGG - Intronic
943877386 2:193088500-193088522 CAGTATCCTACTTTCAATAATGG + Intergenic
945075732 2:206037386-206037408 GATTCTCCTGTTTTTATTAGAGG - Intronic
1170891366 20:20378801-20378823 GAGAATTCTGCTCTGATTAGAGG + Intergenic
1175051527 20:56159944-56159966 GAGTACCCTGATTTCCTTTGCGG + Intergenic
1176342032 21:5708018-5708040 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1176474286 21:7140170-7140192 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1176502795 21:7616438-7616460 GAGTCTCCTGCTTACATTTGTGG + Intergenic
1176536353 21:8106087-8106109 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1179093994 21:38295216-38295238 GAGCATTCTGCTTTTAGTAGTGG + Intronic
1203241297 22_KI270733v1_random:22499-22521 GAGTCTCCTTCTTACATTTGTGG - Intergenic
950352858 3:12374268-12374290 TAATATCATGCATTCATTAGAGG - Intronic
951812374 3:26714924-26714946 GAGTCTCATGGTTTCATTGGTGG + Intergenic
952764911 3:36945274-36945296 GAGAATTCGGCTTTCCTTAGTGG + Intergenic
953486649 3:43304702-43304724 GAGTATTCTGCTTGCATTTGTGG + Intronic
954407035 3:50350925-50350947 GAGTATCCCGCTTTCTTTGGAGG + Exonic
954913000 3:54123792-54123814 GAGTATCCTGCTTTTCTTTGTGG - Intronic
956907993 3:73786822-73786844 GAGGATGCTGCCTTCATTGGAGG + Intergenic
963467147 3:145697832-145697854 GAGTATTCTGCTTTCTTTTTTGG - Intergenic
967353941 3:188546888-188546910 CAGTGTCCTGCATTCAGTAGGGG - Intronic
970652623 4:18195446-18195468 AAGAATCCTGGTTTCTTTAGTGG + Intergenic
971259710 4:25044964-25044986 AAAAATCCTGCTTTCATTATAGG + Intergenic
972077585 4:35106203-35106225 GAGTATCCTGTTTTCTTAAAGGG - Intergenic
974582017 4:63815109-63815131 GAGCAACCTGCTTTCACTACAGG - Intergenic
981071045 4:140539134-140539156 CAGAATACTCCTTTCATTAGGGG + Intronic
983964597 4:173793943-173793965 GAGATTTCTGCTTTCATTATGGG + Intergenic
992519789 5:77538786-77538808 AATTATCCTGATTTCATTACGGG - Intronic
992699261 5:79324237-79324259 GAAGATCCTGATTTTATTAGAGG - Exonic
993124454 5:83815979-83816001 GAGCCTGCTGCTTTCCTTAGTGG - Intergenic
994211822 5:97095472-97095494 GAGCTTCCTGCTTTCTTCAGTGG - Intronic
994971757 5:106748394-106748416 GAATTTCCAGCTTCCATTAGGGG + Intergenic
995914954 5:117233824-117233846 GAGTATACTGTTTTCCTCAGTGG + Intergenic
1001650676 5:173313801-173313823 GATTCTCCTGCTTTCCTTATCGG + Intergenic
1001719942 5:173848561-173848583 GAGTTTCCTTCTTTCTTTAGTGG - Intergenic
1004507076 6:16255424-16255446 GAGTTTCCTGCTGGCAGTAGGGG - Intronic
1005848610 6:29801799-29801821 GAGTTTCCTTCTTCCATTGGTGG + Intergenic
1008363789 6:50651670-50651692 AAGTATCCTGCTATCATTCTGGG - Intergenic
1008683034 6:53894492-53894514 CATTTTCCTTCTTTCATTAGTGG + Intronic
1011370229 6:86629348-86629370 CAGCATCCTGCTTTCGTTTGTGG + Intergenic
1020342406 7:7126257-7126279 GACTCTCCTGCTTTCATCACAGG - Intergenic
1021210062 7:17838898-17838920 GTGTATTTTGCTTTCATTAGGGG + Intronic
1021301188 7:18975012-18975034 GATTCTCCTGCTTTGATTTGGGG + Intronic
1021862295 7:24918127-24918149 GAGTATCCAGGTGTCATTACTGG - Intronic
1024448519 7:49511392-49511414 TAATATCCTGCTTTCGATAGTGG + Intergenic
1026608707 7:71838305-71838327 GATTTTCCTGCTTTAATTACTGG - Intronic
1026653913 7:72239874-72239896 GACTATCCTGCTTTCAGGAGGGG - Intronic
1030239072 7:107300080-107300102 GCGTATGCTCCTTTCAATAGAGG + Intronic
1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG + Intergenic
1035144183 7:156796829-156796851 GAGTATCTGGCATTTATTAGGGG - Intronic
1038755754 8:30339471-30339493 GACCAACCTGTTTTCATTAGGGG + Intergenic
1043205222 8:77429808-77429830 GAATATCCTTCTTTCAAAAGTGG + Intergenic
1053419583 9:37968981-37969003 GAGGTTCGTGCTTTCATTGGAGG - Intronic
1058548927 9:106092349-106092371 GAGGACTCTGCCTTCATTAGTGG - Intergenic
1061620292 9:131807389-131807411 GAGTACCTTGAATTCATTAGCGG + Intergenic
1203457621 Un_GL000220v1:5572-5594 GAGTCTCCTGCTTACATTTGTGG - Intergenic
1186649438 X:11542635-11542657 GAGCATACTGCTTAAATTAGGGG - Intronic
1189839347 X:45056695-45056717 GAGGAACCTACTTTCATTAGAGG + Intronic
1190621193 X:52288358-52288380 GAGTTTCCAGCTTTCAGTGGAGG - Intergenic
1191067733 X:56367845-56367867 GAGCAGTCTGCTTTCTTTAGAGG + Intergenic
1191080509 X:56505382-56505404 GAGCATTCTGCTTTCCTCAGAGG - Intergenic
1195958872 X:110364451-110364473 GAGCAGCCTGCTTTAGTTAGTGG - Intronic
1195995450 X:110727019-110727041 TAAAATCCTGCTTTCATTGGAGG + Intronic
1197655213 X:129109297-129109319 GAGCTTCCTTCTTTCTTTAGTGG - Intergenic