ID: 1127393219

View in Genome Browser
Species Human (GRCh38)
Location 15:58523194-58523216
Sequence ATTCTCTGCACCTTGGCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127393215_1127393219 -5 Left 1127393215 15:58523176-58523198 CCAGCTTCCTTCCACAGAATTCT 0: 1
1: 0
2: 5
3: 35
4: 318
Right 1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG 0: 1
1: 0
2: 0
3: 13
4: 231
1127393212_1127393219 23 Left 1127393212 15:58523148-58523170 CCTCGCTGCCCAGCTTCTGAGCT 0: 1
1: 0
2: 2
3: 41
4: 499
Right 1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG 0: 1
1: 0
2: 0
3: 13
4: 231
1127393211_1127393219 24 Left 1127393211 15:58523147-58523169 CCCTCGCTGCCCAGCTTCTGAGC 0: 1
1: 0
2: 0
3: 20
4: 218
Right 1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG 0: 1
1: 0
2: 0
3: 13
4: 231
1127393214_1127393219 14 Left 1127393214 15:58523157-58523179 CCAGCTTCTGAGCTGCAAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 210
Right 1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG 0: 1
1: 0
2: 0
3: 13
4: 231
1127393213_1127393219 15 Left 1127393213 15:58523156-58523178 CCCAGCTTCTGAGCTGCAAGCCA 0: 1
1: 0
2: 2
3: 16
4: 255
Right 1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG 0: 1
1: 0
2: 0
3: 13
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127393219 Original CRISPR ATTCTCTGCACCTTGGCTTC CGG Intronic
901018987 1:6246427-6246449 ATTTTCTTCCCCTGGGCTTCTGG + Intergenic
902622019 1:17656204-17656226 ATTCTCTGCCCCTGGTCTCCAGG + Intronic
902675358 1:18005012-18005034 TTTCTCTGTAGCTTGGATTCAGG - Intergenic
902684136 1:18064864-18064886 AGTCTCTCCACCCTGGCTGCAGG + Intergenic
903352456 1:22725939-22725961 ATGCTCTGCTGCTAGGCTTCTGG + Intronic
904269652 1:29341546-29341568 ATACTCTCCACCCTGGCATCTGG + Intergenic
909107452 1:71430361-71430383 ATTCTCTGCTCTTTTGCTTGGGG + Intronic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
911519465 1:98911113-98911135 ATTCTCAGCACCTGGCCTTGTGG + Intronic
912518762 1:110231466-110231488 CTGCTCTGCTCCCTGGCTTCTGG + Intronic
912545902 1:110451303-110451325 ATTCTCTGTGCCTTGGGTTTTGG + Intronic
912955185 1:114150643-114150665 AACCTCTGCAGCTTGGCTTATGG + Intronic
913538325 1:119795526-119795548 ATGCTGTGGAGCTTGGCTTCTGG - Intronic
913542297 1:119833198-119833220 CTTGTCTCCACCTTGGCTTTTGG - Intergenic
915079774 1:153344278-153344300 ACTCTCCTCACCCTGGCTTCTGG - Intronic
915497735 1:156293489-156293511 ATTCTCGGCCCCCCGGCTTCTGG + Exonic
915616145 1:157040355-157040377 TCTCTTCGCACCTTGGCTTCTGG - Intronic
916364679 1:164012111-164012133 AATCTCTGCTCCCTGGGTTCAGG + Intergenic
917727229 1:177839402-177839424 AGGCCCTGCACCTTGCCTTCTGG + Intergenic
919409737 1:197228082-197228104 ATTCTTTCCTCCTAGGCTTCTGG + Intergenic
920526872 1:206673680-206673702 ATTTTCAGCACCATGGCCTCTGG + Intronic
920902932 1:210129696-210129718 ATTTTCTGCACATTGCCTTTAGG + Intronic
923150822 1:231231820-231231842 ATCCCCTGCACCTTGGCTGTGGG + Intronic
1064157431 10:12915766-12915788 TTTCTGTGAACCTAGGCTTCAGG - Intronic
1064643563 10:17437810-17437832 AATCTCTGCCCCCTGGGTTCAGG + Intronic
1066668947 10:37816789-37816811 ACTCTCTCCACCTTAGCCTCTGG - Intronic
1067126590 10:43522095-43522117 TTTCTCTGGACATTGGCTTTTGG + Intergenic
1068599650 10:58942864-58942886 AGTTTCTGCAACCTGGCTTCTGG + Intergenic
1078390095 11:10929930-10929952 AATCTCTGCCTCTTGGGTTCAGG + Intergenic
1078915301 11:15773204-15773226 ATTCTCTACAATTTGGCTCCAGG - Intergenic
1079243024 11:18733899-18733921 ACTCACTGCATCTTAGCTTCTGG + Intronic
1079416185 11:20238516-20238538 ATGCTGTGGGCCTTGGCTTCAGG - Intergenic
1080780144 11:35421609-35421631 AATCTCTGCACACAGGCTTCAGG + Intergenic
1081136382 11:39444788-39444810 AACTTCTGCACCTTGGCTTGGGG - Intergenic
1082013061 11:47463697-47463719 AATCTTTCCACCTTTGCTTCTGG + Intergenic
1083689932 11:64401350-64401372 CTTCTCGGCACCAGGGCTTCTGG + Intergenic
1085971405 11:81595626-81595648 AACCTCTGCCCCTTGGGTTCAGG - Intergenic
1086290935 11:85308398-85308420 ATTCTTTGCCTTTTGGCTTCTGG + Intronic
1087305142 11:96480495-96480517 ATTCTCTGCCCCCTGTGTTCTGG + Intronic
1089886582 11:121830712-121830734 CTTCTTGGCACCTTTGCTTCTGG - Intergenic
1091032417 11:132202663-132202685 ATTCCATGCCTCTTGGCTTCGGG - Intronic
1091315693 11:134612432-134612454 AATATCCTCACCTTGGCTTCAGG - Intergenic
1094786932 12:33859458-33859480 ATTCTTTCCTCCTAGGCTTCTGG + Intergenic
1095277644 12:40307861-40307883 AACCTCTGCCTCTTGGCTTCAGG + Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096748599 12:53744592-53744614 ATTCTCTCCACTTGGGCTCCAGG + Intergenic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1096817117 12:54208723-54208745 ATTCTCTGCCCCTTGTCTCCAGG + Intergenic
1099752314 12:86791662-86791684 TTACTCTGCATCTTTGCTTCTGG + Intronic
1100275394 12:93067341-93067363 CTTCTCTGCTCCTTGACTTTGGG - Intergenic
1101252001 12:102945912-102945934 ATTCCATGGGCCTTGGCTTCAGG - Intronic
1101334086 12:103781163-103781185 ATCATGTGCACCTTGGATTCTGG - Intronic
1102415168 12:112755471-112755493 GTTCTTTGCACCTTGACTTTGGG + Intronic
1102610461 12:114107234-114107256 ATACTCTGAACTTTGCCTTCAGG - Intergenic
1104932771 12:132348537-132348559 TTTCTCTGGACCTTGGCCACCGG - Intergenic
1105946647 13:25196113-25196135 GTTCTCTACACCTGGGCTCCAGG + Intergenic
1108123068 13:47210637-47210659 ACTCTCTGCACCTTAGCTGGGGG + Intergenic
1108495257 13:51018566-51018588 TTTCCCTTCTCCTTGGCTTCTGG + Intergenic
1110000285 13:70189321-70189343 ATACTCTCCACCATTGCTTCTGG - Intergenic
1113491607 13:110696850-110696872 GTTCTCTGCTCCCTGGATTCGGG + Intronic
1114571167 14:23669880-23669902 ATGCTCTGTACCTTTGCTTTTGG - Intergenic
1118755237 14:68838371-68838393 ATTCTTTCCTCCTAGGCTTCTGG - Intergenic
1119645832 14:76347718-76347740 ATGCTCTGGACCTTGGGGTCAGG - Intronic
1121946367 14:98126591-98126613 ATTCTATGCACCTTTTCTTCTGG - Intergenic
1124964662 15:34424031-34424053 TTTCTCTGCTGCTTGGCCTCAGG - Intronic
1124981279 15:34570257-34570279 TTTCTCTGCTGCTTGGCCTCAGG - Intronic
1125249301 15:37681316-37681338 TTTCTCTGACCCTTGGCTTTAGG + Intergenic
1125450384 15:39801312-39801334 ATTCCCTGCAGTTTGGCTTTGGG - Exonic
1127040086 15:54965445-54965467 ATTGTCTTGACATTGGCTTCTGG - Intergenic
1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG + Intronic
1129406329 15:75321211-75321233 ATTCTCTCCTGCTTGGCTTTGGG - Intergenic
1130577463 15:85105281-85105303 ACTCTCTGCACATGGGCCTCTGG - Intronic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1131696702 15:94884229-94884251 ATTCTCTGCACATTGGACACAGG + Intergenic
1137934220 16:52618286-52618308 ATTCTCTGGCCTTTGGATTCTGG + Intergenic
1138215228 16:55199086-55199108 ATTCTGTCCTCCTTGGCTTCTGG - Intergenic
1138770130 16:59653014-59653036 ATTCTGTTCTCCTAGGCTTCCGG + Intergenic
1141221026 16:82069492-82069514 ATACTCTCCTCCTTGGCTTTGGG + Intronic
1142509340 17:384781-384803 ATCCTCTGCAGCCTGGCTGCTGG - Intronic
1142551958 17:746352-746374 ATTTTCTTCACCGTGACTTCCGG + Exonic
1144592605 17:16537100-16537122 ATTCTCTGAACCTGGACTTCTGG + Intergenic
1147422679 17:40330495-40330517 GTTCTCTGCATCTTGACCTCAGG + Intronic
1148699425 17:49578815-49578837 ATTTTCTTCACCTTGGCTGAGGG - Exonic
1149074731 17:52581698-52581720 ATTTTCTGCAGCTTGTCTTATGG + Intergenic
1149576540 17:57717279-57717301 ATTATTTGCTCCTTAGCTTCCGG - Intergenic
1150167557 17:62958425-62958447 ATACTCTTATCCTTGGCTTCCGG + Intergenic
1151904863 17:77041114-77041136 CTTCCCTGCCCCTTGACTTCAGG + Intergenic
1153909589 18:9695348-9695370 TCTCTCTGCACTTTGGCTCCAGG + Intergenic
1154165318 18:12010349-12010371 ACTCTCTACACCTTGGGCTCCGG - Intronic
1155507278 18:26546777-26546799 CTTCTGTGCCCATTGGCTTCTGG + Intronic
1155894880 18:31312372-31312394 ATTGTCTGCACTTTGCCTTTCGG - Intergenic
1159526980 18:69604995-69605017 AGTATCTGCACCATGGCCTCTGG + Intronic
1160601390 18:80015098-80015120 ATTTTTTCCTCCTTGGCTTCTGG + Intronic
1162057026 19:8070938-8070960 AATCTCTGCCTCTTGGGTTCAGG - Intronic
1163056844 19:14726279-14726301 ATTCTTTTCTCCTAGGCTTCTGG + Intronic
1163473584 19:17512066-17512088 ACTGTCTGCACCTCGGCTACGGG + Intronic
1164209147 19:23082781-23082803 AATCTCTGCCTCTTGGGTTCAGG + Intronic
1165248276 19:34510477-34510499 ATTTTTTGCTCCTAGGCTTCTGG + Exonic
1166676635 19:44745329-44745351 TTTCTCTGGGCCTTGGCCTCTGG - Intergenic
1168334718 19:55591342-55591364 ATTTTCTGATCCTTGGCTCCAGG - Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
931061295 2:58532569-58532591 AATCTCCACACCTTGGCCTCCGG + Intergenic
931956676 2:67434629-67434651 TTTCTCTGCATCTTGGCACCTGG - Intergenic
932102870 2:68916539-68916561 ACTCTCAGAAACTTGGCTTCTGG + Intergenic
934087413 2:88521715-88521737 TTTCTCTACACAGTGGCTTCAGG + Intergenic
935216058 2:100976169-100976191 CTTCTCTGCTCCTTGGTGTCGGG + Intronic
936587463 2:113770798-113770820 AATCTGTGCCCCTGGGCTTCAGG - Intergenic
937394385 2:121521753-121521775 ATTCTCCGCACACTGGCTTTAGG + Intronic
937409317 2:121659272-121659294 ATTCTTAGAACCTTGGCATCAGG + Intergenic
939444722 2:142293565-142293587 ATTCTCTTCTCGTTGGATTCGGG + Intergenic
939965997 2:148610856-148610878 CTTCTCTGCACCCTGGATTGGGG - Intergenic
940278243 2:151962051-151962073 AAGCTCTGCTCTTTGGCTTCTGG + Intronic
941585775 2:167356678-167356700 ATTTGCTTAACCTTGGCTTCAGG + Intergenic
943972494 2:194428546-194428568 CTTCTCTGCTCCCTGCCTTCTGG - Intergenic
945528763 2:210924318-210924340 AATCTTTCCACCTTGGCCTCCGG + Intergenic
945538777 2:211056044-211056066 ACTCTCTGCAGCTTGCCTTAGGG + Intergenic
946514969 2:220402126-220402148 ATTCTATCCTCCTAGGCTTCTGG - Intergenic
948076725 2:235170761-235170783 ATTCTCTGCAACTTTCCTCCTGG - Intergenic
948523392 2:238556406-238556428 CTTCTCTGCTCTTTGGCTTCTGG + Intergenic
1169414409 20:5403525-5403547 ATTCTTCTCTCCTTGGCTTCTGG + Intergenic
1172262235 20:33577772-33577794 CTTCTCTGAGCCTTAGCTTCTGG + Intronic
1173039775 20:39451439-39451461 ATTCTCTACACATTAGCTTGAGG + Intergenic
1173469281 20:43310103-43310125 TTTCCCTGACCCTTGGCTTCAGG + Intergenic
1173753415 20:45494304-45494326 TTTCTCTGCCCCTTAACTTCGGG - Intergenic
1173906377 20:46632542-46632564 CTTCTCTGCTTCTTGGCATCAGG - Intronic
1174564685 20:51456493-51456515 CTTTTCTGCAGCCTGGCTTCTGG - Intronic
1177009724 21:15717279-15717301 ATTCTCTGAACCCTGTGTTCAGG - Intergenic
1177998454 21:28131420-28131442 ATTCTCTCCTCCTAGGCCTCAGG + Intergenic
1178140417 21:29676618-29676640 ATTCACTGCAACTGGGGTTCTGG - Intronic
1178224529 21:30699920-30699942 ATTCTTTTCCCCTAGGCTTCTGG + Intergenic
1181473883 22:23156973-23156995 TTCCTCTGCACCTTGGCTGAAGG - Intronic
1181889770 22:26052257-26052279 ATTCCCTCCAACTTGGCTGCAGG + Intergenic
1182886319 22:33777201-33777223 GTTCTCTGTACCTTTTCTTCTGG - Intronic
1182918065 22:34053754-34053776 ATTTTCTCCACCTTTCCTTCTGG + Intergenic
1182930654 22:34171007-34171029 TTTCCTTGCTCCTTGGCTTCTGG + Intergenic
1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG + Intronic
1184727292 22:46354538-46354560 ACTCTCAGCACCCTGGCTGCCGG + Intronic
1185266925 22:49909129-49909151 CTTCTCTGCAGCGTGGCTGCAGG - Intronic
949590326 3:5487552-5487574 ACTCTCTGCACATTGGGTTCAGG - Intergenic
952190924 3:31022862-31022884 ATGCTCTGGATTTTGGCTTCAGG - Intergenic
958829998 3:99074857-99074879 ATTATCTCCACCTGGGCTTCTGG + Intergenic
960148860 3:114231545-114231567 ACTCGCTGCACCTTGGGTTCTGG - Intergenic
963589352 3:147236844-147236866 ATTCTCTGCTCTTTTGCTGCTGG - Intergenic
963721707 3:148868904-148868926 TATCTCTGCAGCTTGACTTCTGG + Exonic
967513443 3:190339255-190339277 ATACTCTGCTTCTAGGCTTCTGG + Intronic
967602466 3:191405780-191405802 ATTCTTTGCTCCTAGGCCTCTGG + Intergenic
967728881 3:192888304-192888326 GGCCTCTGCACTTTGGCTTCTGG - Intronic
970327041 4:14936584-14936606 ATTGTCTTCCCCTTGCCTTCAGG - Intergenic
970481771 4:16483348-16483370 GTTATTTGCCCCTTGGCTTCTGG - Intergenic
970790744 4:19854801-19854823 ATTCTCTCATCCTAGGCTTCTGG + Intergenic
971224027 4:24734935-24734957 ATTATCTGTACCTTGACATCCGG + Intergenic
971625477 4:28914976-28914998 AAGCTCTGCTCCTCGGCTTCTGG - Intergenic
973614204 4:52662964-52662986 ATTCTCTCCTCCTAAGCTTCTGG - Intergenic
974194067 4:58548097-58548119 CTTATCTTCATCTTGGCTTCTGG + Intergenic
974322917 4:60375361-60375383 AACCTCTGCATCTTGGGTTCAGG - Intergenic
975134297 4:70859509-70859531 ATACTCTGTACCTTGGGCTCTGG - Intergenic
975184716 4:71387977-71387999 ATCCTCTTTACCTTGGCTTAGGG + Intronic
975217246 4:71769933-71769955 ATGCTCTGCTACTTGGCTCCTGG + Intronic
975907208 4:79227546-79227568 ATCCTCTTCTCCTTGGTTTCTGG - Intronic
977504735 4:97887821-97887843 ATTCTGTTCTCCTAGGCTTCTGG - Intronic
979076860 4:116282093-116282115 ATTCTCTGCCATGTGGCTTCAGG + Intergenic
979355671 4:119700647-119700669 AGTCTCTTCACTTTGGCTTGTGG - Intergenic
980994035 4:139763460-139763482 GTTCCCTGCACCAGGGCTTCTGG + Intronic
981561307 4:146051190-146051212 ACTCTGTGCACCCTGTCTTCTGG - Intergenic
982155399 4:152515318-152515340 CTTCCCTGCACCCTCGCTTCAGG - Intronic
982806158 4:159766442-159766464 ATTGGCTGCAGCTTGGCTGCTGG + Intergenic
984193696 4:176633833-176633855 CTTCTCTGCACATGGGCATCGGG + Intergenic
984524803 4:180845525-180845547 ATTCTCTTCACAGTGTCTTCTGG + Intergenic
984910496 4:184669842-184669864 ATTCTCTGCACCTCTGGCTCTGG - Intronic
987492716 5:18600889-18600911 ATTGTCTCCACTTTGCCTTCAGG - Intergenic
988533214 5:32043041-32043063 CTTCCCTGCCCTTTGGCTTCTGG + Intronic
988818917 5:34861698-34861720 ATTCTGTGAAACTAGGCTTCAGG + Intronic
989230442 5:39080312-39080334 ATTCTCTCCACTTTGGCATATGG - Intergenic
989308134 5:39981096-39981118 ATTCTTTTCTCCTAGGCTTCTGG - Intergenic
991869612 5:71097515-71097537 ATTCAGTCCTCCTTGGCTTCAGG - Intergenic
995141489 5:108740387-108740409 AGTTTCTTAACCTTGGCTTCAGG - Intergenic
996125509 5:119721613-119721635 GCTCTCTGGACCTTTGCTTCTGG + Intergenic
996233030 5:121088969-121088991 ATTCCCTGCACCTGGGGGTCTGG + Intergenic
998355473 5:141531822-141531844 ATTCTCATCACCTTAGTTTCAGG + Intronic
999298027 5:150472730-150472752 AGTCTCTGCAGGTGGGCTTCAGG + Intergenic
1000356606 5:160402405-160402427 ATTCTCTCTTCCTTGGCCTCTGG - Exonic
1001066353 5:168537875-168537897 ATGCTCTGCATCTTCGTTTCTGG - Intergenic
1001451094 5:171824975-171824997 ACTCTCTTCACCTTGACTTTGGG + Intergenic
1007240177 6:40419243-40419265 ATTCCCTGCACCTTGCCTTTGGG + Intronic
1007430507 6:41773907-41773929 ATCCTTTCCACCTTGGCTTTTGG - Intronic
1009031957 6:58069991-58070013 ATTCTCTTCACTGAGGCTTCCGG + Intergenic
1009207784 6:60824443-60824465 ATTCTCTTCACTGAGGCTTCCGG + Intergenic
1009481888 6:64169574-64169596 ACTCTCTCCATCTGGGCTTCAGG - Intronic
1009786160 6:68342454-68342476 ACTCTCTGCCACTTGGCTACTGG + Intergenic
1011693712 6:89893109-89893131 AATCTCTGCCCCCTGGGTTCAGG + Intergenic
1012549515 6:100454352-100454374 ACTCTCCTCCCCTTGGCTTCTGG + Intronic
1013255863 6:108384974-108384996 ATTCTCTCCTCTTTGTCTTCTGG - Intronic
1014490346 6:122054689-122054711 ATTCTATGTCACTTGGCTTCTGG + Intergenic
1014707847 6:124769988-124770010 ATTATCTTCAACTTGGTTTCAGG + Intronic
1014750662 6:125252286-125252308 TTTCTCTGCACCATTTCTTCCGG + Intronic
1016843369 6:148546033-148546055 TATCTCTGCACCAGGGCTTCAGG - Exonic
1019400733 7:851706-851728 ATTCTCTGCACCGGGCATTCAGG - Intronic
1020534748 7:9382532-9382554 ATACTCAGCACCTTTGCATCTGG - Intergenic
1020959816 7:14788248-14788270 ATTCTGTACACCTGAGCTTCAGG - Intronic
1021058577 7:16081199-16081221 ATTCTCTGCACATCAGATTCTGG + Intergenic
1022196871 7:28076988-28077010 ATGCTCTGCAGCTGGGTTTCGGG - Intronic
1022588888 7:31642415-31642437 ATCCTCTGCCCCTTGGGTGCAGG - Intronic
1022824518 7:33995393-33995415 ATTGTCTTCTCCTTGCCTTCAGG - Intronic
1023391357 7:39714615-39714637 ATTCTTTCCTCCTTGGCCTCTGG - Intergenic
1025886564 7:65600059-65600081 ATTCCCTGCTACTTGGATTCTGG + Intergenic
1027644542 7:80780800-80780822 AATCTCTGCACCCTGGGCTCAGG - Intronic
1027940571 7:84673782-84673804 ATTCTCAGAATCTTGGCTCCAGG - Intergenic
1028489780 7:91398509-91398531 ATTCTCAGCAGCTTTGCCTCAGG - Intergenic
1031332136 7:120479017-120479039 ATTTTCTGCACCTTTGCTGTAGG + Intronic
1031425168 7:121596277-121596299 TCTTTATGCACCTTGGCTTCTGG - Intergenic
1031855857 7:126921878-126921900 ATTCCCTGCTACTTGGATTCTGG - Intronic
1032343544 7:131098673-131098695 ATTCTCAGCACCTGGGAGTCTGG + Intergenic
1033542297 7:142368101-142368123 ATTCACTCCTCCTAGGCTTCAGG + Intergenic
1033909883 7:146249504-146249526 CTTCTCTGTGCCTTGGCTTTGGG + Intronic
1033929908 7:146508415-146508437 CATCTTTGCACCTTGGCCTCAGG - Intronic
1035307054 7:157940129-157940151 GTTCTCTGCACATTTCCTTCTGG + Intronic
1037543140 8:19891103-19891125 AGTCTCTGCTCTATGGCTTCTGG + Intergenic
1037667060 8:20978882-20978904 CATCTCTGCACCCTGGCTCCCGG - Intergenic
1037706720 8:21321610-21321632 ATTATCTGCTCATTGCCTTCTGG - Intergenic
1038942638 8:32322557-32322579 ATATCCTGCACATTGGCTTCAGG + Intronic
1039166793 8:34690308-34690330 AATGTCTACACCTTCGCTTCTGG + Intergenic
1039700195 8:39954224-39954246 ATTCTATGCACTTTTGCTTTTGG + Intronic
1040538290 8:48328947-48328969 CTTCTTTGCAGCTGGGCTTCTGG - Intergenic
1041553079 8:59121422-59121444 ATTATCTGCATCTTGACTCCTGG + Intergenic
1045146015 8:99345816-99345838 ATTTTCAGCCCCTTGCCTTCCGG - Intronic
1051740356 9:20245572-20245594 ATTCTCCTCACCATGGCTTGGGG - Intergenic
1052193386 9:25683653-25683675 ATTCTTTCCTCCTAGGCTTCTGG - Intergenic
1052437333 9:28445086-28445108 AGGCTCTGGACCCTGGCTTCTGG - Intronic
1055545717 9:77371207-77371229 TTTATCTGCTCTTTGGCTTCAGG + Intronic
1056616633 9:88173270-88173292 ATTCTGAGCACCGTTGCTTCTGG - Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058504721 9:105656122-105656144 ACTCTCCGCGCCCTGGCTTCCGG - Intergenic
1059739786 9:117138508-117138530 AAGCTCTGCACCTTGGCTTGCGG - Intronic
1059942481 9:119371097-119371119 TTTCTCTTTCCCTTGGCTTCTGG + Intergenic
1062220093 9:135410415-135410437 AGTCTCCTCACCTTGGCTTGCGG - Intergenic
1187686156 X:21817787-21817809 TTTCTCTGCCCCTTGACTTTGGG + Intergenic
1188778974 X:34256443-34256465 ATTCTGTGGTCCTTGCCTTCTGG - Intergenic
1189536136 X:41937096-41937118 ATTCTATGCCCTCTGGCTTCTGG + Intergenic
1189567987 X:42263484-42263506 CTTCTCTGTCCCTTGGCTTTTGG - Intergenic
1190143137 X:47865550-47865572 ATTCTCTGCTCCTTACCTTCAGG - Intronic
1190741018 X:53288863-53288885 CCTCTCTGGACCTTGGCTTAAGG + Intronic
1191221123 X:57989556-57989578 AATCTCTGCCCCTTGGGTACAGG + Intergenic
1192351564 X:70360632-70360654 ATTATCTGAACTTTGGCTGCAGG + Intronic
1196066681 X:111471663-111471685 ATTCTTTCCTCCTAGGCTTCTGG + Intergenic
1197362274 X:125519582-125519604 ATGCTCAGCACCTTGGCACCTGG + Intergenic