ID: 1127403118

View in Genome Browser
Species Human (GRCh38)
Location 15:58612300-58612322
Sequence ACAGCTCCTCAACTTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127403118_1127403125 19 Left 1127403118 15:58612300-58612322 CCTTGGCCAAGTTGAGGAGCTGT 0: 1
1: 1
2: 3
3: 25
4: 170
Right 1127403125 15:58612342-58612364 ACACAGTAACTCACATCCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 173
1127403118_1127403124 18 Left 1127403118 15:58612300-58612322 CCTTGGCCAAGTTGAGGAGCTGT 0: 1
1: 1
2: 3
3: 25
4: 170
Right 1127403124 15:58612341-58612363 AACACAGTAACTCACATCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127403118 Original CRISPR ACAGCTCCTCAACTTGGCCA AGG (reversed) Intronic
900312758 1:2042301-2042323 ACAGCCCCCCACCTTGGCCCTGG + Intergenic
900405729 1:2492166-2492188 ACAGCACCCTCACTTGGCCAGGG - Intronic
901238960 1:7681952-7681974 AAATCTTCTCAACTTGGCCTTGG - Intronic
912274443 1:108241531-108241553 TCAGTTCCTCACTTTGGCCATGG + Intronic
912286824 1:108378327-108378349 TCAGTTCCTCACTTTGGCCATGG - Intronic
912293776 1:108452810-108452832 TCAGTTCCTCACTTTGGCCATGG - Intronic
913066031 1:115255845-115255867 GCAACTCCTCAACTCTGCCATGG - Intergenic
914805204 1:150986405-150986427 AGTCCTCCTCACCTTGGCCAGGG - Exonic
916194008 1:162206473-162206495 ACAGCTACTCAACTCTGCCAAGG - Intronic
917499259 1:175571163-175571185 ATAGCTTCTCAACTGGGCCAAGG - Intronic
917940648 1:179917624-179917646 ACAGCTTCTCATCTTGACCTTGG - Exonic
920433411 1:205933248-205933270 AGAGCTCATCAACTTGTCCTGGG + Intronic
920834984 1:209502434-209502456 ACAGCTGCACAGCTTGGCCAGGG + Intergenic
924000373 1:239543877-239543899 ACAACTACTCAACTCTGCCATGG + Intronic
1063869864 10:10405512-10405534 ACAGCTCCCCAACTTTGGCATGG - Intergenic
1064327463 10:14364417-14364439 ACAGCTGATCAGCTAGGCCATGG - Intronic
1064327631 10:14365577-14365599 ACAGCTGATCAGCTAGGCCATGG - Intronic
1065050708 10:21788362-21788384 ACAGCTTCTCAGCTCAGCCAAGG - Intronic
1065815237 10:29477381-29477403 ACAGCTGCTCAAGGTGCCCAGGG - Intronic
1068295298 10:55063062-55063084 ACAGCTATTCAAATTGTCCAAGG + Intronic
1070482165 10:76893302-76893324 ACTGTTCCTCTACTTGGCAAAGG - Intronic
1073438229 10:103535407-103535429 ACAGTTGCTCAGCTTGGCCAGGG + Intronic
1076410625 10:130246454-130246476 ATAGCTCCTCAGCTTGCACATGG - Intergenic
1079144308 11:17837170-17837192 TCAGCTCCTAAACTTGGGGATGG - Intronic
1079156170 11:17949765-17949787 ACAGCTGCTCAACAGAGCCAAGG + Intronic
1079201782 11:18383069-18383091 AGAGCTCCTCAACTGCCCCAGGG + Intergenic
1079242876 11:18733102-18733124 ACATCTCCTCATCTTGGCAGCGG + Intronic
1080271594 11:30456236-30456258 ACAGCTCCTCAAATAGTCAAAGG - Intronic
1081762168 11:45584196-45584218 ACAGCTCCTCACCCTGCCCCAGG - Intergenic
1085013998 11:73160432-73160454 AAGGCTCCTCAACTGGGCTAGGG - Intergenic
1086327892 11:85723247-85723269 TCAGGTCATCAACTTAGCCAAGG + Intronic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1089762524 11:120738768-120738790 ACATCCTCTCAACTTTGCCAAGG - Intronic
1089856151 11:121546687-121546709 ACAACTCCTCACTTTGCCCATGG + Intronic
1090030601 11:123202972-123202994 CCATCTCCTCAGCCTGGCCATGG - Intergenic
1090476549 11:127027106-127027128 ACACCTCCTATACTTGGCTAGGG - Intergenic
1091650024 12:2302927-2302949 AGAGCCCCTCACCATGGCCAAGG - Intronic
1091689419 12:2585486-2585508 ACAGCTCCTCACCTTGGTGGCGG - Exonic
1093227818 12:16506691-16506713 ACAACTATTCAACTTTGCCATGG - Intronic
1093681494 12:22008340-22008362 ACAGCTCCTCAGCATGGCTCTGG - Intergenic
1093767368 12:22980458-22980480 ACTGCTTCTGAGCTTGGCCATGG - Intergenic
1096622183 12:52871837-52871859 CCAGCCCCTGAGCTTGGCCAGGG + Intergenic
1099414319 12:82368760-82368782 ACAGCCCTTCAACATGACCATGG - Intronic
1100475924 12:94935263-94935285 ACAACTACTCAACTCTGCCAGGG + Intronic
1102852845 12:116266487-116266509 ATAGCTCCTCTTCTAGGCCAAGG - Intronic
1103294018 12:119870753-119870775 GCAACCACTCAACTTGGCCATGG - Intronic
1110784633 13:79509608-79509630 ACAACTCCTCCCCTTGGCCAAGG - Intronic
1111254032 13:85642059-85642081 ACATCTCCTCAACCTCTCCATGG + Intergenic
1111368937 13:87290328-87290350 ACAGCTCAACAATTTGGGCAGGG - Intergenic
1112129080 13:96501460-96501482 ACAGCTACATAACTTGCCCAAGG - Intronic
1112312161 13:98328340-98328362 ACAGACCCTCCTCTTGGCCAAGG - Intronic
1115717984 14:36126942-36126964 ACTGCTCCACAATTTTGCCAAGG - Intergenic
1116336079 14:43658304-43658326 AAATCTCTTCAATTTGGCCAAGG + Intergenic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1119660500 14:76447939-76447961 AAAGCTCCAGAACATGGCCAAGG + Intronic
1120435043 14:84470813-84470835 CCAGCCCCTCCACTTGGTCAAGG - Intergenic
1122091647 14:99344803-99344825 ACAGCTACTCAGCTCTGCCATGG + Intergenic
1122976013 14:105171061-105171083 GCAGCTGCTCAGCCTGGCCAGGG + Intergenic
1124343230 15:28903394-28903416 CCAGCTACTCAGCTAGGCCATGG - Intronic
1126273453 15:46848572-46848594 ACAGCTGCTCAGCTCAGCCAGGG + Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127403118 15:58612300-58612322 ACAGCTCCTCAACTTGGCCAAGG - Intronic
1128539360 15:68515632-68515654 AGAGCTGCTCATCTTGGCTATGG - Intergenic
1130261148 15:82355314-82355336 ACAGCTCCTCACCTTCGCCGCGG - Intergenic
1130280087 15:82513704-82513726 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130471462 15:84229890-84229912 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130478956 15:84344461-84344483 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1130492814 15:84443670-84443692 ACAGCTCCTCACCTTCGCCGCGG - Intergenic
1130593756 15:85234517-85234539 ACAGCTCCTCACCTTCGCCGCGG + Intergenic
1132265463 15:100466625-100466647 ACAGCCCCTCTAGTTGGCCTTGG - Intronic
1132757833 16:1494518-1494540 ACAGCTCCTCCAGGCGGCCATGG - Exonic
1132993740 16:2811902-2811924 ACAGCTGCTCAGCTCAGCCAGGG + Intergenic
1135427275 16:22349376-22349398 TCAGCTCCTCCACTTGGCTCTGG + Exonic
1137010758 16:35317398-35317420 ACAGGTCCTAAAGTTGACCAGGG - Intergenic
1137061504 16:35794914-35794936 CCAGCTCCCCAACTTTACCATGG + Intergenic
1139327606 16:66164314-66164336 ACAGCTCCTCAAATGGGGCAGGG + Intergenic
1140953777 16:79843962-79843984 ACAGTTCAGCAACTTGTCCAGGG + Intergenic
1141097721 16:81174797-81174819 GCAGCTCCTCCAGCTGGCCAAGG - Intergenic
1141604013 16:85142812-85142834 ACTGCTGCCCAACCTGGCCAGGG + Intergenic
1143159018 17:4856972-4856994 ACTGATCCTCATCTTTGCCAAGG - Intronic
1144871741 17:18376337-18376359 GAAGCTCCTGAACTCGGCCATGG - Intergenic
1146275755 17:31514583-31514605 AGAGCTCAGCAACTTGGCAATGG - Intronic
1146741693 17:35290237-35290259 ACATCTCCTCAACTTGATAAAGG + Intergenic
1147671488 17:42179392-42179414 AGAGGTCATCAACTTGCCCAAGG - Intronic
1148294620 17:46490198-46490220 ACAGCTGCTCAGCTCGGCCCTGG + Intergenic
1148918951 17:51012145-51012167 TCTGCTCCTCAAATTTGCCAGGG + Intronic
1149232749 17:54554458-54554480 ACAGCTGCTCACCTTGGCTAAGG + Intergenic
1152240352 17:79157631-79157653 ACAGCTCCTCTCCTTGTCCCAGG + Intronic
1154434923 18:14335759-14335781 ACAGGTCCTCAGCTCTGCCACGG + Intergenic
1156133196 18:34003801-34003823 ACAGATCCTCCCCCTGGCCAAGG + Intronic
1157524785 18:48372658-48372680 CAAACTCCTCAACATGGCCATGG + Intronic
1159677715 18:71306311-71306333 ACAGCCCCTCTTCTTGGCCAAGG - Intergenic
1160560553 18:79753249-79753271 CCAGCTCATCAAGTGGGCCACGG - Intronic
1161479891 19:4505231-4505253 CCAGCTCCTCACCATGGCCTTGG + Intronic
1162634524 19:11956908-11956930 TCAGCTGCTCAAATTGACCATGG + Intronic
1165230799 19:34385407-34385429 ACAGCTCCTCAACCTCACCCAGG - Intronic
1165662906 19:37597795-37597817 GCAACTACTCAACTTGGCTATGG + Intronic
1165937538 19:39398345-39398367 ACTGCTCCTCTCCTAGGCCAAGG - Exonic
1166658641 19:44630413-44630435 AAAGCTCATTAACTTGCCCAAGG + Intronic
1166827613 19:45619173-45619195 ACAGCTCTTCCACATGGCCCTGG + Exonic
926235781 2:11042495-11042517 CCAGTTCCTCAAGATGGCCAAGG + Intergenic
927249977 2:20988804-20988826 ACAGCTCCCTAACCTGTCCAAGG + Intergenic
928223852 2:29430469-29430491 ACAACTACTCAGCTTTGCCATGG + Intronic
928397753 2:30955942-30955964 ACAGCTCATCAAGTTGCCCAAGG - Exonic
928688356 2:33773507-33773529 ACAGCTCTATAACTTGACCAGGG - Intergenic
929517089 2:42613432-42613454 ACAGCTCCATGCCTTGGCCAGGG - Intronic
930253322 2:49060605-49060627 GCAGCTGTTCAGCTTGGCCAGGG - Intronic
930372260 2:50516685-50516707 AGTGCTCCTCAATTTAGCCAAGG + Intronic
933712991 2:85341382-85341404 ACACCACCTCAAATTTGCCACGG + Intergenic
937463828 2:122112022-122112044 ACATCCCCTCAACTTGGCCTTGG - Intergenic
938291986 2:130155368-130155390 ACAGCTTGTCACCTTGGCTAAGG - Intronic
938464565 2:131517599-131517621 ACAGCTTGTCACCTTGGCTAGGG + Intergenic
940514764 2:154668623-154668645 AAAGCTCCTCACCATGCCCATGG - Intergenic
940668654 2:156640092-156640114 ACAGCTGCTCCACTGGGCCTAGG - Intergenic
943424949 2:187719652-187719674 ACAGCACCAAAGCTTGGCCAGGG - Intergenic
943475814 2:188353891-188353913 ACAGCTGCTCTGCTTGGCCAAGG - Intronic
946510084 2:220346622-220346644 ACAACTACTCAACTTGACAATGG + Intergenic
947828787 2:233124631-233124653 ACAGCTTCTCAGCATGGCCCTGG - Intronic
948447738 2:238046188-238046210 ACAGCTCCTCCACCTCACCATGG - Intronic
948840463 2:240646267-240646289 ACAGTCCCTCACCTGGGCCAGGG + Intergenic
1169925154 20:10775764-10775786 ACAGCTCCTGACATTGGTCAGGG + Intergenic
1170981020 20:21213097-21213119 CCAGCTCCTCAGGTAGGCCATGG + Intronic
1171458713 20:25286600-25286622 GCAGCTCCTCTGCTGGGCCAAGG + Intronic
1172910451 20:38405302-38405324 GCAGCTACACAACCTGGCCATGG + Intergenic
1174722678 20:52830345-52830367 ACAACTACTCAACTCTGCCACGG + Intergenic
1176195507 20:63834970-63834992 GCAGCTCCCCAACCTCGCCAGGG + Intergenic
1180840742 22:18957769-18957791 ACAGCTCCTCACCTTGGACAGGG - Intergenic
1181060744 22:20281005-20281027 ACGGCTCCTCACCTTGGACAGGG + Intronic
1183701369 22:39453116-39453138 ACAGCCCCCCGTCTTGGCCAAGG - Intergenic
1183879625 22:40816449-40816471 ACAGCTACCCAACATTGCCATGG - Intronic
1184607670 22:45583380-45583402 ACAGCTGCTCACCTTAGACATGG + Intronic
1184869385 22:47225685-47225707 GCAGCTCCTCCTCATGGCCAGGG + Intergenic
950909801 3:16576863-16576885 ACAGCTGCTCAGCTTGGCCAGGG - Intergenic
951217042 3:20035104-20035126 ACAACTACTCAACTCTGCCAGGG - Intergenic
952932278 3:38369515-38369537 ACTCCTCCTCCACTGGGCCAAGG - Intronic
955512584 3:59696334-59696356 GCAGCTCATGAACTTGGCCATGG - Intergenic
956729473 3:72183535-72183557 ACAACTCCTCAAAGTGGCCTAGG + Intergenic
958067880 3:88567939-88567961 ACAACTCCTCAGCTTGACCTTGG + Intergenic
958731495 3:97965017-97965039 ACAGTCTCTCAACCTGGCCAGGG + Intronic
959082282 3:101814933-101814955 ACAGCTAAACAACTTGACCAAGG - Intronic
960746378 3:120894409-120894431 AAAGTTCCTCAGCTTGGCAAAGG + Intergenic
961448485 3:126992011-126992033 CCAGCCCCTCTACTGGGCCAAGG + Intronic
962344088 3:134607280-134607302 AGAGCTCAGCAACTTGGCAAAGG + Intronic
963459251 3:145586839-145586861 ACAGCACCTGAGCTTGCCCAAGG - Intergenic
965641346 3:170831742-170831764 ACAGTTCCTCCTCTTAGCCAAGG - Intronic
968528443 4:1076878-1076900 ACAGCTACTCAACTCTGTCATGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969714674 4:8862777-8862799 ACAGCTCCAGAACGTGGCGAGGG + Intronic
970461714 4:16281024-16281046 ACACCACCTCCCCTTGGCCAAGG + Intergenic
973701192 4:53538960-53538982 AGATCTCCTGGACTTGGCCATGG - Intronic
974069089 4:57108391-57108413 GCAGCTCCTGATCTTAGCCAAGG - Intronic
975671750 4:76787301-76787323 ACAGCTGCTCAGCTTGGCCAAGG - Intergenic
979357765 4:119725686-119725708 GCAGCTATTCAACTTGGCCTTGG - Intergenic
981136128 4:141213426-141213448 AGGGCTCCTCAACGAGGCCAAGG - Intergenic
982695792 4:158598640-158598662 ACAGCTCCACAAGATGGCCAAGG + Intronic
983587914 4:169375641-169375663 ACAGCTACTCAACTTGGCCAAGG - Intergenic
987751832 5:22049426-22049448 AAAGCTGCTGAACTTGGGCAAGG - Intronic
988098037 5:26642946-26642968 CCAGCTACTCAACTAGGCTAAGG - Intergenic
988612457 5:32739800-32739822 ACACCTACTCAACTAGCCCAAGG - Intronic
994842453 5:104942929-104942951 AAATCTCCTCAACTTGTTCAGGG - Intergenic
995900052 5:117054986-117055008 ACTGGTCCTCCACTTGGCCATGG - Intergenic
996756584 5:126942310-126942332 ACAACTACTCAACTCTGCCATGG + Intronic
997377137 5:133405369-133405391 ACAGCTGCTGTACTGGGCCAGGG - Intronic
1002302953 5:178267939-178267961 ACAGCCCGGCAACTTGGCCAAGG + Intronic
1004985193 6:21073933-21073955 ACAGCTTCACAAGTTGGCCTAGG - Intronic
1008064512 6:47033082-47033104 ACAGCTCCTCATCTGTGGCAAGG - Intronic
1008129447 6:47703852-47703874 ACAGCTCCTGAACGTGTTCAGGG - Intronic
1019383937 7:742994-743016 TCAGCGCCTCAACTAGGCCAGGG - Intronic
1019387232 7:764173-764195 GCAGCTCTTCCACTTGGCCCGGG + Intronic
1020586825 7:10079323-10079345 GCAGCTCCTCTCCGTGGCCAGGG - Intergenic
1022277523 7:28870246-28870268 ACAGTAACACAACTTGGCCAGGG - Intergenic
1022863315 7:34390547-34390569 AGTGCTCTTCAATTTGGCCAAGG - Intergenic
1023887263 7:44368096-44368118 ACAACTGCTCAGCTTAGCCAGGG - Intergenic
1024608001 7:51038667-51038689 ATAGTTTATCAACTTGGCCAAGG - Intronic
1024619699 7:51146952-51146974 TCAGCTCCCCACCTTGGGCATGG + Intronic
1032117243 7:129127389-129127411 ACAGCATCTCCTCTTGGCCAGGG + Intergenic
1032249483 7:130242472-130242494 ACACCTTCACAACATGGCCATGG + Intergenic
1032773917 7:135090476-135090498 ACAGCTGCTCAGCTCAGCCAGGG + Intronic
1035834391 8:2732948-2732970 ACATCTCCTCATCTAGACCATGG - Intergenic
1041002447 8:53465808-53465830 TCAGATTCTCAACATGGCCATGG - Intergenic
1042509854 8:69599477-69599499 GGAGTTCCTCAACTTTGCCAAGG + Intronic
1044758345 8:95490413-95490435 AGAGTTCCTCATCTTGGCAAGGG + Intergenic
1045853959 8:106741137-106741159 TAAGCTCATCAACTTGCCCAAGG + Intronic
1050374571 9:4957772-4957794 ACAGTTGCTCAGATTGGCCAGGG - Intergenic
1050514103 9:6424800-6424822 AGAGCTCCTCAAAATGGTCACGG - Intronic
1055323572 9:75105365-75105387 GCAGCTACTCAACTCTGCCATGG + Intronic
1056766035 9:89445282-89445304 ACAGCTCCAGAGCATGGCCAGGG + Intronic
1057170653 9:92961120-92961142 AGAGCTCCTCTCCCTGGCCATGG + Intronic
1059662285 9:116413933-116413955 CCAGCTCCTGAAATTGGGCATGG - Intergenic
1059961435 9:119568951-119568973 ACAGCTAAACAACTTGCCCAAGG + Intergenic
1060929983 9:127483244-127483266 ACTGCTCCCCAACTTTTCCAAGG + Intronic
1061423367 9:130484116-130484138 ACTGCTTCTCACCTTGGCCCTGG + Intronic
1062411892 9:136429907-136429929 ACAGCCCCTCATCCTGGCCCTGG - Intronic
1062473144 9:136714942-136714964 CCAGCTCCTCAACGAGGACAAGG - Intronic
1186618316 X:11213061-11213083 CCAGCTCCTCATCCTGGCAAAGG + Intronic
1186618518 X:11214577-11214599 CCAGCTCCTCATCCTGGCAAAGG - Intronic
1187702387 X:21975358-21975380 AGAGCTCTTCACCTTAGCCAAGG + Intronic
1188036823 X:25327760-25327782 ACAGCTACTCAACCCTGCCACGG - Intergenic
1188162583 X:26821351-26821373 GCACCTGCTCAGCTTGGCCAAGG + Intergenic
1189327284 X:40120531-40120553 ACAGCTTCTCACCTACGCCATGG + Intronic