ID: 1127405976

View in Genome Browser
Species Human (GRCh38)
Location 15:58646887-58646909
Sequence GTACCACAGACAGCTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127405976 Original CRISPR GTACCACAGACAGCTAGAGT TGG (reversed) Intronic
900375951 1:2354865-2354887 GAACCACAGACATTTGGAGTTGG - Intronic
901239310 1:7683765-7683787 GCCCCACAGACAGCGAGAGACGG - Intronic
905380956 1:37561321-37561343 GTAGCACAGTCAGCAAGACTGGG - Intronic
908606453 1:65802353-65802375 GTACCACAGGCAGGTAGAGGTGG + Intronic
909826079 1:80128259-80128281 GTTCCACAAACCTCTAGAGTAGG + Intergenic
912055799 1:105596841-105596863 GTGCCACAGATAGCTAGGGCAGG - Intergenic
912579338 1:110705977-110705999 GAACCAGAGACATCTAGACTTGG - Intergenic
916467150 1:165083895-165083917 GTTCCACAGACCTCTAGAGCAGG - Intergenic
916829176 1:168473850-168473872 GTTCCACAGATATCTAGAGCAGG - Intergenic
916833997 1:168523199-168523221 TTACCACAGACAGCAAGAGAGGG + Intergenic
918221104 1:182437226-182437248 GTACCACTGACACCTAGGATGGG - Intergenic
918784482 1:188748234-188748256 GTTCCACAGATCTCTAGAGTAGG - Intergenic
921254066 1:213323575-213323597 GAACCATAGACAGTTGGAGTGGG + Intergenic
921927806 1:220726959-220726981 GGAAAACAGACACCTAGAGTGGG - Intergenic
924136959 1:240977790-240977812 GTACCAAAAACAGCTGCAGTGGG + Intronic
1064219070 10:13424423-13424445 GTAGCACAGAAAACTAAAGTTGG + Intergenic
1068215649 10:53978793-53978815 GTTCCACAGATATCTAGAGCAGG + Intronic
1068454557 10:57238087-57238109 GTTCCACAGATCTCTAGAGTAGG - Intergenic
1078609291 11:12806223-12806245 TTACAACATACAGCTGGAGTGGG - Intronic
1086936181 11:92747740-92747762 GTTCCACAGACATCTAGGGCAGG + Intronic
1087290078 11:96311511-96311533 GTGCTACAGATAGCTAGAGATGG + Intronic
1090005913 11:123002218-123002240 GTACCACAGCCAGCCACAGGAGG + Intergenic
1090597019 11:128330579-128330601 TTACAACATCCAGCTAGAGTGGG + Intergenic
1093192651 12:16092483-16092505 GTTCCACAGATCTCTAGAGTAGG + Intergenic
1095394761 12:41749271-41749293 GTACCAGAGACTGGGAGAGTGGG - Intergenic
1098689845 12:73473106-73473128 GCACATCACACAGCTAGAGTAGG + Intergenic
1107254182 13:38403714-38403736 GTTCCACAGAGACGTAGAGTGGG - Intergenic
1110929292 13:81194963-81194985 GTTCCACAGACATCTAGTGCAGG + Intergenic
1111489318 13:88950328-88950350 GTGCAACAGAAAGCTAGAGATGG - Intergenic
1118327681 14:64792616-64792638 CTGCCACAGAAAGCTAGAGCTGG + Intronic
1118709030 14:68504594-68504616 GAAGCTCAGACAGCTAGAGATGG + Intronic
1119070014 14:71573155-71573177 GTACCACAGGCATATAAAGTGGG - Intronic
1121130112 14:91438339-91438361 GTTCCACAGATACCTAGAGCAGG - Intergenic
1126416830 15:48426503-48426525 GTACCACAGAGAGAAAGACTGGG + Intronic
1126932389 15:53669128-53669150 GTACTACAGACAGCTGTACTGGG - Intronic
1127405976 15:58646887-58646909 GTACCACAGACAGCTAGAGTTGG - Intronic
1132862861 16:2080049-2080071 GTGCCACAGGCAGCCAGAGACGG - Intronic
1133387792 16:5384500-5384522 TTACCAGAGAGAGCAAGAGTAGG + Intergenic
1137018811 16:35402072-35402094 CTACCACACACAGATAGACTGGG - Intergenic
1143594913 17:7908325-7908347 GTCCAACAGACAGGTAGAGATGG - Intronic
1144039690 17:11399163-11399185 TTACAACAGAAAGATAGAGTAGG + Intronic
1158875593 18:61731903-61731925 GTACCACAGACGGCATGATTTGG + Intergenic
1159319716 18:66831029-66831051 GTTCCACAGATCCCTAGAGTAGG + Intergenic
1159431933 18:68363123-68363145 GTAGCACAGGCAGGTCGAGTGGG + Intergenic
1164444125 19:28302599-28302621 GTAAAAAACACAGCTAGAGTTGG - Intergenic
1166748044 19:45151284-45151306 GCACCTCAGCCAGCTGGAGTGGG - Exonic
928036321 2:27827387-27827409 GTCCCACAGAGAGTTAGAGAGGG + Intronic
935651882 2:105389280-105389302 GTACCGCAGCCATCTCGAGTTGG + Intronic
935872917 2:107470158-107470180 CTACCACAAATAGCTAGAATGGG + Intergenic
938133377 2:128735586-128735608 CTTCCACAGACAGCATGAGTGGG + Intergenic
940426017 2:153532788-153532810 GTTCCACAGATCCCTAGAGTGGG + Intergenic
943231995 2:185265410-185265432 GTTCCACAGATTGCTAGAGCAGG + Intergenic
947176247 2:227370394-227370416 GTCCCACAAACATTTAGAGTTGG - Intronic
1169436093 20:5592436-5592458 GTGCAAAAGACAGCTAAAGTGGG + Intronic
1170420754 20:16190510-16190532 GTACTACAGAGAGACAGAGTGGG + Intergenic
1174679066 20:52386856-52386878 TTACCACAAACAACTAGATTAGG + Intergenic
1178433623 21:32537718-32537740 GGACCAGAGCCAGCTGGAGTAGG + Intergenic
1179827477 21:43974768-43974790 GGACCACAGCCAGCCAGTGTGGG + Intronic
1182253913 22:29024214-29024236 GAACCACAGAAAGGTGGAGTTGG - Intronic
1184708949 22:46236513-46236535 TTCCCACAGACAGCTGGACTGGG - Exonic
951322304 3:21260134-21260156 GTACGACAGACAGGGAGACTTGG + Intergenic
953624961 3:44563038-44563060 GTTCCACAGATATCTAGAGCAGG + Intronic
954007330 3:47602136-47602158 CTACCACACCCAGCTACAGTTGG - Intronic
956216637 3:66856291-66856313 GAATCACAGAATGCTAGAGTTGG + Intergenic
957506765 3:81131409-81131431 GTTCCACAGATATCTAGAGCAGG - Intergenic
959606118 3:108243392-108243414 GTACCATAGACAAATACAGTTGG - Intergenic
960611976 3:119562913-119562935 GTGCCACAGCCTGCTAAAGTTGG + Intergenic
961992340 3:131205383-131205405 GAACCACAAACAGGTAGAGCTGG + Intronic
962685780 3:137846256-137846278 GTGCCACAGACAGAGAGAGATGG - Intergenic
966296400 3:178428669-178428691 GTACCACAATCAGCTAGATTTGG + Intronic
967635082 3:191791434-191791456 GTTCCACAGACCTCTAGGGTAGG + Intergenic
967889680 3:194356381-194356403 GTCCCCCAGAAAGCTGGAGTGGG - Intronic
968715221 4:2153090-2153112 GGAACACAAATAGCTAGAGTGGG + Intronic
970137103 4:12937000-12937022 GCACCACAGACAGCAATAGGAGG - Intergenic
970650472 4:18171921-18171943 GTTCCACTCACAGCTAGAGAGGG - Intergenic
971224337 4:24737287-24737309 GTTCCACAGACCTCTAGAGCAGG - Intergenic
976842340 4:89446154-89446176 GTTCCACAGATATCTAGAGCAGG + Intergenic
978330848 4:107611363-107611385 GTTCCACAGATCTCTAGAGTAGG - Intronic
979087136 4:116427743-116427765 GTTCCACAGATCGCTAGAGCAGG - Intergenic
980815036 4:137934953-137934975 GAACAACAGAGAGCTAGACTTGG - Intergenic
981368475 4:143930342-143930364 GTTCCACAGATTGCTAGAGCAGG + Intergenic
982459865 4:155655754-155655776 ATAACACAGAGAGGTAGAGTTGG - Intergenic
986281820 5:6329657-6329679 GTTCCACAGATCCCTAGAGTAGG - Intergenic
986660221 5:10052660-10052682 GTTCCACAGATCCCTAGAGTAGG + Intergenic
992459890 5:76951224-76951246 GAACCACACACAGCAAGAGCTGG - Intergenic
994878968 5:105461528-105461550 GTTCCACAGATCTCTAGAGTAGG + Intergenic
994925563 5:106113772-106113794 GTTCCACAGATCCCTAGAGTTGG - Intergenic
997016293 5:129938633-129938655 GTTCCACAGCTATCTAGAGTAGG + Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
1001421495 5:171590725-171590747 ACACCACAGACAGCTAGGGTGGG - Intergenic
1001941484 5:175742739-175742761 AAACCACAGACATCTAGAGTTGG - Intergenic
1004576737 6:16903375-16903397 GAACCACAGATAACTAGAGGTGG - Intergenic
1012745816 6:103087326-103087348 TTCCCACAGACAGAAAGAGTAGG + Intergenic
1014981570 6:127951860-127951882 GTGCCAGAGAAAGCTGGAGTTGG - Intergenic
1015765442 6:136711308-136711330 GGAACACACACAGCTAGTGTCGG - Intronic
1022456782 7:30564721-30564743 GTCACACAGATAGTTAGAGTAGG + Intergenic
1024282781 7:47733217-47733239 GAAGCACAGAAATCTAGAGTGGG + Intronic
1024601747 7:50988266-50988288 GTACCACAGCAACATAGAGTTGG - Intergenic
1028093843 7:86736142-86736164 GTACCAGAGAGAGCTGGTGTAGG + Intronic
1031194136 7:118590810-118590832 GTTCCACAGACCTCTAGGGTAGG - Intergenic
1037609867 8:20466966-20466988 GTACCACAGACATCAAGGGGTGG - Intergenic
1038157509 8:25004033-25004055 GGACAACAGACAGCCAGAGATGG + Intergenic
1038441803 8:27575842-27575864 GGACCACAGACAGCATGGGTGGG - Intergenic
1039529513 8:38248123-38248145 GTACAACAGAAAATTAGAGTTGG - Intronic
1041503116 8:58560604-58560626 GTACCACAGACAGATAGCACAGG + Intronic
1042383651 8:68149128-68149150 GTACCACAGACAACTTTAGGAGG - Intronic
1045870885 8:106925703-106925725 GCACCACAAACAGCTAAAATTGG - Intergenic
1046232241 8:111373207-111373229 GTTCCACAGATCTCTAGAGTAGG - Intergenic
1047822750 8:128539533-128539555 GTGCATCAGACAGCTAGAATTGG - Intergenic
1053619578 9:39801821-39801843 GTTCCACAGATCCCTAGAGTAGG - Intergenic
1053877749 9:42561137-42561159 GTTCCACAGATCCCTAGAGTAGG - Intergenic
1053894908 9:42733229-42733251 GTTCCACAGATCCCTAGAGTAGG + Intergenic
1054233945 9:62540557-62540579 GTTCCACAGATCCCTAGAGTAGG + Intergenic
1054264580 9:62905622-62905644 GTTCCACAGATCCCTAGAGTAGG + Intergenic
1061517599 9:131098532-131098554 GAGCCACAGACAGCTGGAGATGG + Intronic
1187316992 X:18205802-18205824 GTACCCCAGACCTCTGGAGTCGG + Intronic
1187955596 X:24514927-24514949 ATCCCACACACAGCTAGATTGGG + Intronic
1188259796 X:28008835-28008857 GTTCCACAGATCTCTAGAGTGGG + Intergenic
1189411241 X:40773788-40773810 ATACCACAGAGAGCTGGATTAGG - Intergenic
1190496775 X:51034051-51034073 GTACTAAAGCCAGATAGAGTGGG - Intergenic
1190509194 X:51159886-51159908 GTACTAAAGCCAGATAGAGTGGG + Intergenic
1194393769 X:93354341-93354363 GTACCACATACTGTTAAAGTTGG - Intergenic
1197587176 X:128363308-128363330 GTTCCACAGATATCTAGAGCAGG + Intergenic
1198081211 X:133241348-133241370 GTGCCACAGAGAACAAGAGTGGG - Intergenic
1199686892 X:150272973-150272995 GTTCCACAGACATCTAGGGCAGG - Intergenic
1199881563 X:151977470-151977492 GTACAACTGACAGATGGAGTTGG + Intergenic