ID: 1127410213 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:58697751-58697773 |
Sequence | GGTCCAGGTGGGCTGATTCT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 361 | |||
Summary | {0: 8, 1: 10, 2: 27, 3: 76, 4: 240} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1127410213_1127410219 | 12 | Left | 1127410213 | 15:58697751-58697773 | CCAAGAATCAGCCCACCTGGACC | 0: 8 1: 10 2: 27 3: 76 4: 240 |
||
Right | 1127410219 | 15:58697786-58697808 | TGCCAGCATATGTTGCCCTAAGG | 0: 1 1: 0 2: 7 3: 17 4: 96 |
||||
1127410213_1127410221 | 19 | Left | 1127410213 | 15:58697751-58697773 | CCAAGAATCAGCCCACCTGGACC | 0: 8 1: 10 2: 27 3: 76 4: 240 |
||
Right | 1127410221 | 15:58697793-58697815 | ATATGTTGCCCTAAGGCCCAAGG | 0: 1 1: 0 2: 4 3: 25 4: 234 |
||||
1127410213_1127410222 | 24 | Left | 1127410213 | 15:58697751-58697773 | CCAAGAATCAGCCCACCTGGACC | 0: 8 1: 10 2: 27 3: 76 4: 240 |
||
Right | 1127410222 | 15:58697798-58697820 | TTGCCCTAAGGCCCAAGGACAGG | 0: 2 1: 0 2: 3 3: 27 4: 137 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1127410213 | Original CRISPR | GGTCCAGGTGGGCTGATTCT TGG (reversed) | Intronic | ||