ID: 1127410214

View in Genome Browser
Species Human (GRCh38)
Location 15:58697762-58697784
Sequence TGGTGTTAGCAGGTCCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 4, 1: 5, 2: 28, 3: 47, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127410214_1127410219 1 Left 1127410214 15:58697762-58697784 CCCACCTGGACCTGCTAACACCA 0: 4
1: 5
2: 28
3: 47
4: 200
Right 1127410219 15:58697786-58697808 TGCCAGCATATGTTGCCCTAAGG 0: 1
1: 0
2: 7
3: 17
4: 96
1127410214_1127410221 8 Left 1127410214 15:58697762-58697784 CCCACCTGGACCTGCTAACACCA 0: 4
1: 5
2: 28
3: 47
4: 200
Right 1127410221 15:58697793-58697815 ATATGTTGCCCTAAGGCCCAAGG 0: 1
1: 0
2: 4
3: 25
4: 234
1127410214_1127410225 22 Left 1127410214 15:58697762-58697784 CCCACCTGGACCTGCTAACACCA 0: 4
1: 5
2: 28
3: 47
4: 200
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410214_1127410222 13 Left 1127410214 15:58697762-58697784 CCCACCTGGACCTGCTAACACCA 0: 4
1: 5
2: 28
3: 47
4: 200
Right 1127410222 15:58697798-58697820 TTGCCCTAAGGCCCAAGGACAGG 0: 2
1: 0
2: 3
3: 27
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127410214 Original CRISPR TGGTGTTAGCAGGTCCAGGT GGG (reversed) Intronic