ID: 1127410215

View in Genome Browser
Species Human (GRCh38)
Location 15:58697763-58697785
Sequence CTGGTGTTAGCAGGTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 3, 1: 3, 2: 17, 3: 35, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127410215_1127410219 0 Left 1127410215 15:58697763-58697785 CCACCTGGACCTGCTAACACCAG 0: 3
1: 3
2: 17
3: 35
4: 174
Right 1127410219 15:58697786-58697808 TGCCAGCATATGTTGCCCTAAGG 0: 1
1: 0
2: 7
3: 17
4: 96
1127410215_1127410221 7 Left 1127410215 15:58697763-58697785 CCACCTGGACCTGCTAACACCAG 0: 3
1: 3
2: 17
3: 35
4: 174
Right 1127410221 15:58697793-58697815 ATATGTTGCCCTAAGGCCCAAGG 0: 1
1: 0
2: 4
3: 25
4: 234
1127410215_1127410222 12 Left 1127410215 15:58697763-58697785 CCACCTGGACCTGCTAACACCAG 0: 3
1: 3
2: 17
3: 35
4: 174
Right 1127410222 15:58697798-58697820 TTGCCCTAAGGCCCAAGGACAGG 0: 2
1: 0
2: 3
3: 27
4: 137
1127410215_1127410225 21 Left 1127410215 15:58697763-58697785 CCACCTGGACCTGCTAACACCAG 0: 3
1: 3
2: 17
3: 35
4: 174
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127410215 Original CRISPR CTGGTGTTAGCAGGTCCAGG TGG (reversed) Intronic