ID: 1127410216

View in Genome Browser
Species Human (GRCh38)
Location 15:58697766-58697788
Sequence GCACTGGTGTTAGCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 7, 1: 11, 2: 20, 3: 56, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127410216_1127410219 -3 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410219 15:58697786-58697808 TGCCAGCATATGTTGCCCTAAGG 0: 1
1: 0
2: 7
3: 17
4: 96
1127410216_1127410221 4 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410221 15:58697793-58697815 ATATGTTGCCCTAAGGCCCAAGG 0: 1
1: 0
2: 4
3: 25
4: 234
1127410216_1127410225 18 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410216_1127410222 9 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410222 15:58697798-58697820 TTGCCCTAAGGCCCAAGGACAGG 0: 2
1: 0
2: 3
3: 27
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127410216 Original CRISPR GCACTGGTGTTAGCAGGTCC AGG (reversed) Intronic