ID: 1127410216

View in Genome Browser
Species Human (GRCh38)
Location 15:58697766-58697788
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 7, 1: 11, 2: 20, 3: 56, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127410216_1127410219 -3 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410219 15:58697786-58697808 TGCCAGCATATGTTGCCCTAAGG 0: 1
1: 0
2: 7
3: 17
4: 96
1127410216_1127410222 9 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410222 15:58697798-58697820 TTGCCCTAAGGCCCAAGGACAGG 0: 2
1: 0
2: 3
3: 27
4: 137
1127410216_1127410221 4 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410221 15:58697793-58697815 ATATGTTGCCCTAAGGCCCAAGG 0: 1
1: 0
2: 4
3: 25
4: 234
1127410216_1127410225 18 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127410216 Original CRISPR GCACTGGTGTTAGCAGGTCC AGG (reversed) Intronic
900582013 1:3414098-3414120 GCTCTGCTGTGAGCAGGTCCAGG + Intronic
900586688 1:3435995-3436017 GCAGTTGTGTTTGCAGATCCTGG - Exonic
901087409 1:6619824-6619846 GCAGTGCTGTTAGCAGGGCTGGG - Exonic
901225058 1:7608505-7608527 GCACTGGTGTTATGCAGTCCTGG - Intronic
902629301 1:17695293-17695315 GAGCTGGTGTTGGCAGGACCAGG + Intronic
906750333 1:48252869-48252891 GCAATGGTGGTAGAAGGTCAAGG - Intergenic
908141429 1:61189154-61189176 GCAGTGGTCTTGGCAGGTCGTGG + Intronic
908907270 1:69029864-69029886 GCACTGGTGTTACCAAGTCTAGG - Intergenic
911924983 1:103817889-103817911 GCACTAGTGTTAGTGGGTGCAGG - Intergenic
915669776 1:157478831-157478853 GGACTGATGTTAGAAGGGCCTGG + Intergenic
915784833 1:158598032-158598054 ACACCTGTGTTAGCAGGTACTGG - Intergenic
916293170 1:163188455-163188477 GCCCTGGTTTCAGCAGTTCCTGG - Intronic
917001558 1:170367072-170367094 CCACTGGTATTAGCAGGTCCAGG + Intergenic
917390307 1:174529582-174529604 GCACTGATGTTGGCACGTCTAGG + Intronic
917991050 1:180379016-180379038 GCATTGGTATTAGCAGGTCCAGG - Intronic
918104628 1:181405896-181405918 GCTTGGGTGTTAGCAGGACCAGG + Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
919886976 1:201941866-201941888 TCCCTGGTGTTAGCAGGGGCTGG - Intronic
920426343 1:205879617-205879639 GCATTAGTGTTAGTGGGTCCAGG + Intergenic
920444224 1:206003332-206003354 GCAGTGGTCTCAGCAGGGCCAGG + Intronic
921112958 1:212056203-212056225 GCACTGGTGTTAATGGATCCAGG - Intronic
921196329 1:212760796-212760818 ATACTAGTGTTATCAGGTCCAGG - Intronic
921471554 1:215556623-215556645 ACACTGGTTTTAGCAGATCTAGG + Intergenic
924488590 1:244513019-244513041 GCACTAGTAGTAGCAGGTCTGGG + Intronic
924658887 1:245998069-245998091 TCACAGGTGTTGGCAGGCCCTGG - Intronic
1062853081 10:760152-760174 GCACTGGTGGTAGCAGGTCCTGG - Intergenic
1064011917 10:11742484-11742506 GCGCTGCTGTGAGCAGGGCCGGG - Exonic
1065041757 10:21704990-21705012 GTACTGGTGTTAGTGGGTCCAGG + Intronic
1066244462 10:33569072-33569094 CCACTGTTGTTAGAAGCTCCTGG - Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1068756096 10:60655286-60655308 TCACTGGAGATAGCAGCTCCAGG + Intronic
1071666641 10:87564638-87564660 GCACCAGTGTCAGCAAGTCCAGG - Intergenic
1071823180 10:89298224-89298246 GCACTGGTGTTAGTGGGACCAGG - Intronic
1071928816 10:90441605-90441627 GCACTGATGTTAGTTGGTTCAGG - Intergenic
1073706655 10:105990711-105990733 GCACTGGTGTTTGCAGGCTGCGG - Intergenic
1075415455 10:122259143-122259165 GCACTGAGGATAGCAGGGCCGGG + Intergenic
1076180234 10:128401548-128401570 CCCCTGGTGTTAGCAGCTCAGGG - Intergenic
1076809758 10:132880362-132880384 GCACTGCTGTGAGCAGGGGCTGG + Intronic
1076934608 10:133559096-133559118 GCTCTGCTGATAGCAGGGCCAGG + Intronic
1077450901 11:2644989-2645011 GTACCAGTGTTAGCAAGTCCAGG + Intronic
1078691918 11:13590333-13590355 GCAGTGATGATAGCAGGTCCTGG - Intergenic
1078708580 11:13768464-13768486 GGAGTGGGGTTAGAAGGTCCAGG + Intergenic
1078977597 11:16495783-16495805 GCACTGGTGTTAGTGGATCTAGG - Intronic
1079182459 11:18205292-18205314 GCACTAGTGTTAGAGGGTCTTGG - Intronic
1081882073 11:46462172-46462194 TAACTTGTGATAGCAGGTCCAGG - Intronic
1083518382 11:63282813-63282835 GCAGTGGTGTTAGCAGTTATGGG + Intronic
1085283230 11:75344334-75344356 GCCCTTTTGCTAGCAGGTCCAGG - Intronic
1085542815 11:77288353-77288375 GCACTGGTGTTAGCAGGTCGAGG - Intronic
1087227526 11:95618618-95618640 GCACTGGTGTTACTGGATCCAGG - Intergenic
1089090334 11:115869463-115869485 GCACGGATGTTAGCAGGTTCAGG + Intergenic
1089341541 11:117761302-117761324 GCCCTGGTCTGAGCATGTCCAGG - Intronic
1089592008 11:119547639-119547661 GCAGTGGGGTGAGCAGCTCCAGG - Intergenic
1093366141 12:18302146-18302168 GCACTGGATTTAGCAGGCTCAGG + Intronic
1096537791 12:52286477-52286499 TCACAGGTGTCAGCAGCTCCCGG - Exonic
1096542343 12:52314802-52314824 CCACAGGTGTCAGCAGCTCCCGG - Exonic
1096580481 12:52581613-52581635 GAACCGGTGAAAGCAGGTCCTGG + Intergenic
1098284575 12:68894462-68894484 GCATTTGTGTTAGCAGGTAGTGG - Intronic
1098634023 12:72758278-72758300 GCACCAGTGTTAGCATGTCCAGG - Intergenic
1098735001 12:74090575-74090597 GCAGTGAAGTCAGCAGGTCCTGG - Intergenic
1099112971 12:78586432-78586454 GCACTGGTGGTAGTAGTTCTGGG + Intergenic
1099519376 12:83641942-83641964 GCACTGGTGTTAGTGGGTCCAGG + Intergenic
1100317972 12:93463111-93463133 GCACTGGTAATAGTAGTTCCTGG + Intergenic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1100809517 12:98324828-98324850 ATACTGGTGTTAGCAGGTCCAGG + Intergenic
1102912329 12:116726487-116726509 GAACTGGTACTAGCAGGACCGGG + Intronic
1110054786 13:70953819-70953841 GCCCTGGTGTTACAAGGTCTGGG + Intergenic
1110136491 13:72073688-72073710 GCACTAGTTTTATCAGGTCAGGG - Intergenic
1110706132 13:78603110-78603132 GGGCTGGTGTGTGCAGGTCCCGG - Intronic
1111127503 13:83930495-83930517 GGAGTGGAGTTGGCAGGTCCAGG + Intergenic
1111176713 13:84605707-84605729 GCACCAGGGTTAGCAGGTCCAGG + Intergenic
1111572284 13:90104336-90104358 GCACTGGTATAAGTTGGTCCAGG + Intergenic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1112546827 13:100379374-100379396 ACACTGATGTTAGTGGGTCCAGG + Intronic
1112821722 13:103345705-103345727 GCACCAGCGTTAGCAGGTCCAGG + Intergenic
1113536950 13:111075891-111075913 GCACTATTGTTAGCAGGTCCAGG + Intergenic
1114156951 14:20115219-20115241 GCACAAGTGTTTTCAGGTCCTGG + Intergenic
1115695760 14:35897479-35897501 GCACTGGTGTTAGTGGGACCAGG + Intronic
1116055216 14:39855407-39855429 GCACTGCTGTGAGCAGGTCATGG - Intergenic
1117512844 14:56471012-56471034 GCACTGGCAGTGGCAGGTCCAGG + Intergenic
1117744882 14:58859892-58859914 GCACTGGTGTTATTGTGTCCAGG + Intergenic
1119072853 14:71605810-71605832 GCACTTGTGCCAGCAGGTCCTGG + Intronic
1123793921 15:23752947-23752969 GCACTGGTATTAATAGGACCAGG + Intergenic
1126215328 15:46147093-46147115 GCAGTGGAGTGAGCAGTTCCAGG - Intergenic
1126661570 15:51038422-51038444 GCACTGGCGTTAGCAGGTCCAGG + Intergenic
1126715976 15:51518035-51518057 GAAATGGTGTTAACAGGGCCAGG + Intronic
1127152897 15:56096406-56096428 GCACTGGTGTTCGCTGGTTTGGG + Exonic
1127196753 15:56594747-56594769 GCAGTGGAGCTATCAGGTCCTGG - Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1127932590 15:63606826-63606848 GCACTCATGGTTGCAGGTCCTGG - Intergenic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1129566021 15:76624773-76624795 ATACCGGCGTTAGCAGGTCCAGG + Intronic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1132263934 15:100449464-100449486 GCACTAGTGTTAGCAGCTCCAGG - Intronic
1134252892 16:12587169-12587191 CCACTGGTGTTAGGTGGTCCCGG + Intergenic
1135113325 16:19707493-19707515 GCAGTGGTGTTGGCTGGACCTGG - Intronic
1135413303 16:22250907-22250929 GCCCTGGTGTTGGGAGGTCAAGG + Intronic
1136631304 16:31490622-31490644 GCAGTGGGGTGAGAAGGTCCTGG + Exonic
1137628925 16:49928401-49928423 GCACTGTGGTTACCAGGTTCTGG - Intergenic
1138738718 16:59281446-59281468 TCACCAGTGTTATCAGGTCCAGG - Intergenic
1138993187 16:62417372-62417394 GCACCAGAGGTAGCAGGTCCAGG + Intergenic
1140630706 16:76848685-76848707 GCACTGGAGGTAGAAGTTCCTGG + Intergenic
1141071106 16:80955147-80955169 GCACAGGTGCTAGCAGGCACAGG - Intergenic
1142861564 17:2765282-2765304 GAAGTGGTGTTGGCAGGACCTGG - Intergenic
1143783037 17:9239458-9239480 GCCCTGTTGTTAGCAGGTGGGGG + Intronic
1143999719 17:11041695-11041717 GGAGTGGGGTTGGCAGGTCCAGG - Intergenic
1148458347 17:47822924-47822946 GCACTGGGGGAAGCTGGTCCTGG + Intergenic
1150216592 17:63474945-63474967 GCCCTGGTGTCAGCTGCTCCAGG + Intergenic
1152886309 17:82852585-82852607 ACACTGGTCATAGCAGATCCGGG + Intronic
1153863060 18:9233855-9233877 GCACTGGTGTCAGCAGGACCAGG + Intronic
1156027302 18:32669760-32669782 GCACTGGTATTAGTGGGTCTAGG + Intergenic
1156653290 18:39252549-39252571 GCACTGGTGTTAGCAAGTCCAGG - Intergenic
1157820918 18:50767720-50767742 ACATTGGTGTTAGCAGGTCCAGG - Intergenic
1158389747 18:57035276-57035298 GGACTGGATTTAGCAGGTGCTGG + Exonic
1159111873 18:64069337-64069359 GCACTGGTGTTAGTGGGTTCAGG + Intergenic
1161506793 19:4648490-4648512 CCCCAGGTGTCAGCAGGTCCCGG + Intronic
1162277385 19:9666901-9666923 GCAGTGAAGTTATCAGGTCCTGG - Intronic
1165391260 19:35540258-35540280 GCTCTGGCATTAGCAGGTACAGG + Intronic
1166109171 19:40612187-40612209 GCACTGGTGAGACCAGGCCCTGG + Exonic
1166400485 19:42475585-42475607 GGAGTGGAGTTGGCAGGTCCAGG + Intergenic
1166568833 19:43780755-43780777 GCACTGGTGCTGGCAGGAACTGG - Exonic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
1167394605 19:49219953-49219975 GCACTGATAATAGCAGGTCCTGG - Intergenic
1167453063 19:49583618-49583640 TCCCTGGTGTGAGCAGCTCCAGG - Exonic
928757804 2:34547102-34547124 GCACTAGTCTTAGCAGGTTTAGG + Intergenic
929419805 2:41779074-41779096 GCACTGGTATGAGCATTTCCAGG + Intergenic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
931551420 2:63450545-63450567 GCACTGGTGTTAGCAGTACCAGG - Intronic
932587871 2:73043493-73043515 GCACTGGTGTAAGCCAGGCCTGG + Intronic
935133423 2:100278393-100278415 GCCCTGGGGTTAGTGGGTCCAGG - Exonic
935333490 2:101994583-101994605 GCACTGGTGTCAGCATCACCTGG - Intronic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
936818162 2:116485115-116485137 GCACTGGTGTTAGTGGATCCAGG - Intergenic
937718310 2:125060785-125060807 GCAGTGGTGTAGGCAGGCCCAGG + Intergenic
939808035 2:146798361-146798383 ACACTGGTGTTAGCAGAGTCAGG + Intergenic
942376476 2:175343269-175343291 GTACTGGTGTTAGTGGGTCCAGG + Intergenic
943714404 2:191134394-191134416 GCACCAGTGTTAGCAAGTCCAGG - Intronic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
945789967 2:214293094-214293116 GCTCTGGTGTTAGCACATTCAGG + Intronic
945866446 2:215181968-215181990 GCAATGGTGTTAGTGGGTTCTGG + Intergenic
945971152 2:216233580-216233602 GCACCAGTGTGAGCAGGTTCAGG + Intergenic
946070599 2:217031223-217031245 GTACTGGGGTTCCCAGGTCCAGG + Intergenic
946694064 2:222334004-222334026 GCACTGGTGTTAGTGGGTTCAGG - Intergenic
947401689 2:229736823-229736845 GCACTAGTGTTAGTGGGTTCAGG - Intergenic
947772446 2:232681511-232681533 GCTCAGGTGTCAGCAGCTCCAGG + Intronic
1169412503 20:5383408-5383430 GCACTGGTGTTAGCATGTCCAGG - Intergenic
1169534631 20:6525179-6525201 GCACTGATGTCAGCAGGCCCAGG + Intergenic
1169632250 20:7646978-7647000 GCAGTGGTGTGGGCAGCTCCAGG + Intergenic
1170093439 20:12617730-12617752 GCACCAGTGTTAGCAAGTCCAGG - Intergenic
1175238668 20:57529959-57529981 GCACTGGTGTGAGCCTCTCCTGG - Intergenic
1176347381 21:5762057-5762079 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176354195 21:5882641-5882663 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176497446 21:7562398-7562420 GCAGCAGTGTTAACAGGTCCAGG + Intergenic
1176541702 21:8160127-8160149 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176560653 21:8343172-8343194 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1179945525 21:44671400-44671422 GCACTGGTGTTACCATGTCCAGG - Intronic
1180001321 21:44996774-44996796 GCCCTGGTGTTTGCACGGCCTGG + Intergenic
1180104921 21:45612286-45612308 GCACTGGGGAGAGCAGCTCCTGG + Intergenic
1180220560 21:46355645-46355667 GCCATGGTGTCGGCAGGTCCCGG + Intronic
1180378105 22:12113527-12113549 GCAGTGGTGTGGGCAGCTCCAGG + Intergenic
1181557180 22:23677899-23677921 GCCCTGGTGGTAGGAGGTCTGGG - Intergenic
1182183440 22:28375907-28375929 GCACTGGTGTAAGTAAGTCCTGG - Intronic
1183614974 22:38938497-38938519 GTACTGGTGTTTACAGATCCTGG + Intergenic
1183698054 22:39434299-39434321 GCCCTGGTGGAAGCAGGTACCGG + Intronic
1185048219 22:48539861-48539883 GCACTGGTGGCGGCAGGTTCTGG - Intronic
1185060122 22:48602305-48602327 GCACACCAGTTAGCAGGTCCTGG + Intronic
1185408981 22:50672982-50673004 GCTCTGGGGTGAGCAGGTGCTGG + Intergenic
1203246641 22_KI270733v1_random:76546-76568 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
951185795 3:19711527-19711549 GCACTGGTGTTAGCATCCCTGGG - Intergenic
951381880 3:21994979-21995001 GCAGTGATGTTAGTGGGTCCAGG + Intronic
952390598 3:32876291-32876313 CCACTGGTGTCAGCAGGGCACGG + Intronic
952608429 3:35178754-35178776 GCATTGGTAGTGGCAGGTCCTGG + Intergenic
952685996 3:36149024-36149046 TCACTGGTGTGAGTAGGGCCAGG - Intergenic
952982132 3:38745323-38745345 ACACTGGTGTTAACAGGAGCAGG - Intronic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
959038123 3:101388194-101388216 GTGCTGGTGGTGGCAGGTCCTGG - Intronic
960353711 3:116624957-116624979 GCACTGGAGCTATCAGGTCCCGG + Intronic
960551291 3:118978493-118978515 GTACCAGTGTTAGCGGGTCCAGG - Intronic
961562439 3:127740040-127740062 GCCCTGGCCTCAGCAGGTCCAGG + Intronic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
963829755 3:149993603-149993625 GCATTGTTTTTAGCAGGTACAGG - Intronic
965074631 3:163960246-163960268 ACACTGGTGTCAGCAGGTCCAGG - Intergenic
966499691 3:180625917-180625939 TCACTGGTGTTAGTGGATCCTGG + Intronic
968635391 4:1675824-1675846 GCACTGGTGTGGCCAGATCCTGG - Intronic
969458101 4:7312514-7312536 TCTCTGGTGTTAGCAAGGCCTGG + Intronic
970757501 4:19443752-19443774 GCACTGGTGTTAGTGAGTCCAGG - Intergenic
973328950 4:48893081-48893103 GCACTGGTGGTGGAAGGGCCAGG + Intronic
977051193 4:92129802-92129824 GCACTGGTGTTCCTAGGTCTAGG - Intergenic
977719425 4:100222930-100222952 ACACTCGTGTTAGCAGGTTCAGG + Intergenic
978422415 4:108546814-108546836 GCACTGGTGTTATTGGGTCCAGG - Intergenic
978613730 4:110572204-110572226 GCACTGGTGTCAGTGGGCCCTGG - Intergenic
979781083 4:124651728-124651750 GCAGTGGTGTAAGCGCGTCCGGG - Intergenic
981142934 4:141291624-141291646 GCATTGGTATTAGCAGGTCTGGG + Intergenic
981443256 4:144806862-144806884 GCATTGGTGTTAGGAAGTCCAGG - Intergenic
982170449 4:152656300-152656322 GCACTGGTGTTAGTGTGTCCAGG - Intronic
983593718 4:169442149-169442171 GCACTGGTGATAGTGGGTCCAGG - Intronic
983949826 4:173627165-173627187 GCACTGATGTTAGCAGGTCCAGG + Intergenic
1202759722 4_GL000008v2_random:98992-99014 GCAGTGGTGTGGGCAGCTCCAGG + Intergenic
985751549 5:1681555-1681577 ACACTAGTGTTAGTGGGTCCAGG + Intergenic
986337263 5:6764932-6764954 GGACTGGTGTTACCAGGGGCTGG + Intergenic
988683029 5:33502243-33502265 GCACTGGCGGTTGCAGCTCCGGG - Intergenic
989133874 5:38134157-38134179 GCTCTGGTGTTGGCAGTCCCTGG + Intergenic
989231085 5:39086819-39086841 GCACCAGAGTCAGCAGGTCCAGG - Intergenic
989421031 5:41240325-41240347 CCACTGGTGGTAGCAGGTTTAGG + Intronic
989498080 5:42132273-42132295 GCACCCATGATAGCAGGTCCAGG - Intergenic
989515463 5:42337679-42337701 GCACAGGTGTTAATGGGTCCAGG - Intergenic
990400280 5:55430293-55430315 GCACTGATGTTAGAGGGTCCAGG - Intronic
990420639 5:55629352-55629374 GCATGGGTGTTAGCCGGTCATGG - Intronic
990876331 5:60490561-60490583 GGACTTGTATTAGCAGGTTCTGG + Intronic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
993634836 5:90331374-90331396 GCTCTGGTGTCAGTGGGTCCTGG + Intergenic
995304778 5:110631947-110631969 GCTCTGGTATTAGCAGGACCAGG - Intronic
995991813 5:118248169-118248191 GCTCTAGTGTTAGTGGGTCCAGG - Intergenic
997184244 5:131865973-131865995 GCATTGGTGTTAGTGGATCCAGG + Intronic
997461118 5:134053212-134053234 AAAGTGGTGTTAGCAGGGCCTGG - Intergenic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
998744213 5:145238334-145238356 GCATTGATGTCAGCAAGTCCTGG - Intergenic
999409444 5:151337959-151337981 GCACTGGTGTCAGAAGGCCTGGG + Intronic
1000028664 5:157382490-157382512 GCACTGGAGTTAGCTAGACCTGG - Intronic
1002868864 6:1147752-1147774 GCACCGTGGTGAGCAGGTCCTGG - Intergenic
1003606877 6:7570351-7570373 GCAGTGGTGTGAGCGTGTCCAGG + Intronic
1004162601 6:13228166-13228188 GCTCTGGTGTTGACTGGTCCTGG + Intronic
1005158508 6:22835183-22835205 GCTCTAGTGTTAGAGGGTCCTGG - Intergenic
1005183545 6:23136763-23136785 GCACTGGTGGTAGCAGGTTTGGG + Intergenic
1007815469 6:44522186-44522208 GCACTGATGTTAGAAGAACCAGG + Intergenic
1011160113 6:84380707-84380729 GTACTGGTATTAGCAGGTCCAGG + Intergenic
1011160301 6:84381992-84382014 GTACTGGTATTAGCAGGTCCAGG - Intergenic
1015144061 6:129966174-129966196 GCAGTGATGTCATCAGGTCCTGG + Intergenic
1015561798 6:134524196-134524218 TCACTGGAGTCAGCATGTCCAGG - Intergenic
1016116477 6:140291304-140291326 GCAGTGGTGTTAGCAGGTACAGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1017182199 6:151564445-151564467 GCACTGGTCTTAGCAGGTCTAGG + Intronic
1017384040 6:153861882-153861904 GCACTGGTGTTAGTGAGTCCAGG - Intergenic
1017613098 6:156213087-156213109 GCATTGGTGTTAGCATGTCAAGG + Intergenic
1020212273 7:6165878-6165900 GCAGTGGTCTGTGCAGGTCCAGG - Intronic
1021957494 7:25840595-25840617 GCTCTGTTGTCAGCAGGTCTGGG - Intergenic
1022870288 7:34471391-34471413 GCACTGATGTTTGTGGGTCCAGG + Intergenic
1023232698 7:38051164-38051186 GCACCAGTGTTGGCAGGTCTAGG + Intergenic
1024154074 7:46602559-46602581 GTACTGGTGGTAGCAGGAGCAGG + Intergenic
1025002728 7:55331006-55331028 GCAATGGTGTTACCAGAGCCTGG + Intergenic
1026979936 7:74520264-74520286 GCACTGGGGGAAGTAGGTCCTGG + Intronic
1028344434 7:89761709-89761731 GCACTAGTGTTTGAGGGTCCTGG - Intergenic
1030097184 7:105910765-105910787 CCACTGGTGTTGGCTGGTCACGG - Intronic
1030345848 7:108432084-108432106 CCACTTGTGTTAGCAGTTGCTGG + Intronic
1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG + Intergenic
1031235285 7:119168300-119168322 GAACAGGTCTTAGCAGGGCCAGG + Intergenic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1033341516 7:140495809-140495831 ACAGTGGCGTCAGCAGGTCCTGG - Intergenic
1033412629 7:141132784-141132806 GCACTGGTGGTAGCAAGTTCAGG - Intronic
1035523891 8:296803-296825 GCACTGACGTTAGCAGGCACAGG + Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1038021027 8:23551935-23551957 GCACTGGTGTTGGGAACTCCAGG - Intronic
1041691562 8:60693074-60693096 GCGCTGGTGGTGTCAGGTCCTGG + Intronic
1041782868 8:61596470-61596492 GCACTGATGGTAGTGGGTCCAGG - Intronic
1042649402 8:71023547-71023569 GCACTGGTGTTAGTGGGCCCAGG + Intergenic
1044379398 8:91516331-91516353 CAACTGGTGGTAGCAGGTGCAGG - Intergenic
1049164822 8:141119255-141119277 GCACTGGAGGAAGAAGGTCCCGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050242942 9:3658014-3658036 TCACCAGTGTCAGCAGGTCCAGG + Intergenic
1050380105 9:5019975-5019997 GTAATGGTGTTAGTGGGTCCAGG + Intronic
1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG + Intergenic
1051107981 9:13603128-13603150 GCACTGGTATTAGTGGGCCCAGG + Intergenic
1051954351 9:22672551-22672573 GCACTGGAATTAGCAAGTCCTGG - Intergenic
1052771664 9:32695942-32695964 GCAGTGGTGTTGGGAGATCCAGG - Intergenic
1053030883 9:34777153-34777175 GTACTGGTTTTAGGGGGTCCAGG + Intergenic
1053440321 9:38110866-38110888 GCACTGGTGTTGGCTGGGACGGG - Intergenic
1055300649 9:74878326-74878348 ACACTGGTGTTAGTAGGGCCAGG - Intronic
1055563154 9:77542470-77542492 GCTCTGGTGTTAGTGGGTCTAGG + Intronic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1057637725 9:96786420-96786442 GCACTGGAGGTAGCAGATGCGGG - Intergenic
1058877299 9:109255615-109255637 CCAAAGGTGTTTGCAGGTCCTGG + Exonic
1059351967 9:113671933-113671955 GCACTGGTGTTCCGGGGTCCCGG - Intergenic
1062200036 9:135297776-135297798 CCAATGGTGTCAGCAGATCCAGG - Intergenic
1203462975 Un_GL000220v1:59608-59630 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1203540498 Un_KI270743v1:83887-83909 GCAGTGGTGTGGGCAGCTCCAGG + Intergenic
1187628260 X:21141354-21141376 GCACTGATGGTAGCAGGTCCAGG + Intergenic
1188722928 X:33544640-33544662 GCCCTGGTATTAGCAGGTTCAGG - Intergenic
1190517811 X:51243180-51243202 GCAGTGGTGTCAGTGGGTCCAGG + Intergenic
1190925027 X:54895040-54895062 GCCCTGGTGTTAGCAGGTCCAGG - Intergenic
1191211908 X:57893068-57893090 GCTCTGGTGTTAGTAAGTCCTGG - Intergenic
1191922472 X:66271174-66271196 TCACTGGTGATACCAGGTACTGG + Intergenic
1192784503 X:74323341-74323363 GCACTGGTTTTGACAGATCCTGG + Intergenic
1192804130 X:74494978-74495000 GCACTGGTTTTGACAGATCCTGG - Intronic
1193296070 X:79831811-79831833 GCACTGGTGTTAGTGGGTCTGGG - Intergenic
1194434043 X:93848620-93848642 GCATTGTTGTTAGCAGGTCCAGG + Intergenic
1195111648 X:101656719-101656741 GCAAGGGTGTAACCAGGTCCCGG - Exonic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1197411631 X:126123564-126123586 GCTCTGATGTTAGTGGGTCCTGG + Intergenic
1197521026 X:127495905-127495927 GCACTGGTGTCAGCAGGTCCTGG - Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1199205642 X:145145703-145145725 GCACTGGGGTGAGCTCGTCCAGG - Intergenic
1199242941 X:145569217-145569239 GCCTTGGTGTTAGCAGGACCTGG - Intergenic
1200063744 X:153495188-153495210 GCACTGGGGACAGCAGGACCAGG - Intronic
1200358686 X:155578729-155578751 GCTCTGGTGTTAACAGGTGAAGG - Intronic
1201621518 Y:15964303-15964325 GCATTGCTGATAGCAGGTCATGG - Intergenic