ID: 1127410220 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:58697788-58697810 |
| Sequence | GGCCTTAGGGCAACATATGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 97 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 84} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127410220_1127410225 | -4 | Left | 1127410220 | 15:58697788-58697810 | CCAGCATATGTTGCCCTAAGGCC | 0: 1 1: 0 2: 1 3: 11 4: 84 |
||
| Right | 1127410225 | 15:58697807-58697829 | GGCCCAAGGACAGGCCCACTTGG | 0: 1 1: 4 2: 14 3: 53 4: 305 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127410220 | Original CRISPR | GGCCTTAGGGCAACATATGC TGG (reversed) | Intronic | ||