HTGT WGE

Individual CRISPR Summary

ID: 1127410225

 View in Genome Browser
Species Human (GRCh38)
Location 15:58697807-58697829
Sequence GGCCCAAGGACAGGCCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 4, 2: 14, 3: 53, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127410217_1127410225 12 Left 1127410217 15:58697772-58697794 CCTGCTAACACCAGTGCCAGCAT 0: 3
1: 8
2: 26
3: 56
4: 222
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410215_1127410225 21 Left 1127410215 15:58697763-58697785 CCACCTGGACCTGCTAACACCAG 0: 3
1: 3
2: 17
3: 35
4: 174
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410220_1127410225 -4 Left 1127410220 15:58697788-58697810 CCAGCATATGTTGCCCTAAGGCC 0: 1
1: 0
2: 1
3: 11
4: 84
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410218_1127410225 2 Left 1127410218 15:58697782-58697804 CCAGTGCCAGCATATGTTGCCCT 0: 1
1: 0
2: 5
3: 18
4: 138
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410216_1127410225 18 Left 1127410216 15:58697766-58697788 CCTGGACCTGCTAACACCAGTGC 0: 7
1: 11
2: 20
3: 56
4: 206
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305
1127410214_1127410225 22 Left 1127410214 15:58697762-58697784 CCCACCTGGACCTGCTAACACCA 0: 4
1: 5
2: 28
3: 47
4: 200
Right 1127410225 15:58697807-58697829 GGCCCAAGGACAGGCCCACTTGG 0: 1
1: 4
2: 14
3: 53
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127410225 Original CRISPR GGCCCAAGGACAGGCCCACT TGG Intronic