ID: 1127411027

View in Genome Browser
Species Human (GRCh38)
Location 15:58707067-58707089
Sequence AGGGCTATAAACTTTGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127411027 Original CRISPR AGGGCTATAAACTTTGGGGG GGG Intronic
902089746 1:13893513-13893535 AACACTATAAACTTTGGGGGCGG + Intergenic
904420100 1:30385689-30385711 AGAGTTATAAACACTGGGGGAGG - Intergenic
904438099 1:30512444-30512466 AGGGCTGTGGCCTTTGGGGGAGG - Intergenic
906357630 1:45120817-45120839 AGGTTTAGAAGCTTTGGGGGAGG - Intronic
907676863 1:56525903-56525925 AGGGCTCCAAAGTCTGGGGGAGG + Intronic
908179378 1:61588966-61588988 AGAGAGATAAACTTTGGGGGTGG - Intergenic
909573159 1:77140446-77140468 AGGGGTATCTACTTTTGGGGAGG - Intronic
915005921 1:152636181-152636203 AGGGCTATAAACTATGAATGAGG + Intergenic
915518147 1:156425381-156425403 AGGGCTATAAGGGATGGGGGTGG - Intronic
917751568 1:178058184-178058206 GGGGTTAGAAACCTTGGGGGTGG - Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
921777681 1:219121312-219121334 AAGGCTATATACTTGGGTGGAGG - Intergenic
1068013334 10:51482400-51482422 AGGGATACAAACTGTGGAGGAGG + Intronic
1068667455 10:59692305-59692327 AAGGCTATAAACCATGGGCGAGG + Intronic
1069992016 10:72321840-72321862 CAGGCTAGAAACCTTGGGGGCGG - Intergenic
1071315886 10:84397268-84397290 AGGACATTATACTTTGGGGGAGG - Intronic
1072602811 10:96945953-96945975 TGGGTTATAACCTTTAGGGGAGG + Intronic
1073134098 10:101210341-101210363 AGGGCTTTGAACTGTGGGGCAGG - Intergenic
1076942031 10:133616361-133616383 AGGGCTATTAACTTCTGGGCTGG - Intergenic
1078474363 11:11619008-11619030 GGGCCTATAAAATTTGGGGCTGG - Intronic
1079264997 11:18922085-18922107 AGGCCGATAACCTTTGGGTGGGG - Intergenic
1079267172 11:18944232-18944254 AGGCCGATAACCTTTGGGTGGGG - Intergenic
1079397946 11:20082242-20082264 TGTGCTTTAAATTTTGGGGGAGG - Intronic
1082764955 11:57159986-57160008 AGGGATTTAAGCTATGGGGGTGG - Intergenic
1085826964 11:79858116-79858138 AGGGCTGTGCACTTTGGGGGTGG + Intergenic
1085882905 11:80488868-80488890 AGGGCTATTAACTTGGGAGAGGG - Intergenic
1085921604 11:80964233-80964255 AGGGTTCAAAACTCTGGGGGTGG - Intergenic
1088070239 11:105774661-105774683 AGGGCTATAAATTTTGGATCAGG - Intronic
1090877814 11:130806693-130806715 AGGTCTGTAAACTTGGGGGGAGG - Intergenic
1091045182 11:132318833-132318855 ATGGCTGTAGACTTTGGAGGTGG + Intronic
1093879267 12:24384710-24384732 AAGGCTATGAACTTTGTGGGTGG + Intergenic
1093898692 12:24605356-24605378 AAGGACATGAACTTTGGGGGTGG - Intergenic
1098010106 12:66041853-66041875 AGGGCTAGGAACTTTGGCTGGGG - Intergenic
1098884344 12:75945179-75945201 AGGCCTTTAAACTTTGGTGCTGG - Intergenic
1098890850 12:76009169-76009191 AGGGCTACAAACAGTGGGGTAGG - Intergenic
1102112493 12:110374921-110374943 GAGGCTCTGAACTTTGGGGGTGG - Intronic
1102297859 12:111750726-111750748 AGGTTTCCAAACTTTGGGGGTGG - Intronic
1109156759 13:58921089-58921111 AAGGATATATACTTTGGGGAAGG + Intergenic
1109720529 13:66269838-66269860 AGAGCTACAAACTGTGGAGGAGG - Intergenic
1110172013 13:72512292-72512314 AGGGCTTTTGACTTTGGGAGGGG + Intergenic
1110890060 13:80688161-80688183 AGGCATATAAGCTTTGGGAGGGG - Intergenic
1111120845 13:83846972-83846994 ACGGATAGAAACTTTGGGGAGGG + Intergenic
1114555771 14:23561484-23561506 AAGGCTAGAAACTCTGGGGTAGG - Intronic
1118869676 14:69730766-69730788 ATGCCTATAAATTTTGGAGGAGG - Intronic
1118993308 14:70814985-70815007 AAAGCAATAAACTATGGGGGGGG + Intergenic
1120119105 14:80656531-80656553 AGGGGTATAAACTTTTCAGGTGG - Intronic
1120292322 14:82590788-82590810 AGGGACATAAATTTGGGGGGCGG + Intergenic
1120930017 14:89838987-89839009 AGGGCTTTGAGTTTTGGGGGAGG + Intronic
1121042978 14:90765290-90765312 AGGGCTATAGAGTTGGGGTGGGG + Intronic
1121526266 14:94621540-94621562 AGGGCTATAAACTAAGGGAGGGG + Intronic
1124352041 15:28963010-28963032 AGGGCTGAAAACTCTGGGTGGGG + Intronic
1124370450 15:29101810-29101832 TGGGCTGTGAACTTTGGGAGGGG - Intronic
1126688711 15:51270566-51270588 ATGCCTATAAAATATGGGGGAGG - Intronic
1127411027 15:58707067-58707089 AGGGCTATAAACTTTGGGGGGGG + Intronic
1134821072 16:17247873-17247895 AGGGCTAAGAACTTGGGGGCAGG + Intronic
1136103665 16:28013445-28013467 ATGACTATAATGTTTGGGGGTGG + Intronic
1136127649 16:28196108-28196130 AGGGTTATAGACCTTGGGGTAGG - Intronic
1139490261 16:67282169-67282191 AGGGCAATAAGCTGTGGAGGTGG - Intronic
1140606247 16:76542510-76542532 ATGGCTCTCAGCTTTGGGGGAGG + Intronic
1143478697 17:7217081-7217103 GGGGCTATAAACTGGGGGGAGGG - Intronic
1144261993 17:13530668-13530690 AGGACTATCAGCTTTTGGGGTGG - Intronic
1144364410 17:14528509-14528531 AAGACTATAAATTTTGGGGAAGG - Intergenic
1144543707 17:16172135-16172157 AGGTATATATTCTTTGGGGGTGG - Intronic
1145266908 17:21384011-21384033 AGGACAAGAAACTCTGGGGGTGG - Intronic
1147026841 17:37593532-37593554 AGGGCTATTGAGTTTCGGGGTGG + Intronic
1147482498 17:40780104-40780126 AGGGTTAGAAACTTTTTGGGAGG + Intronic
1147920232 17:43911818-43911840 AGGGATAACAACTTTGGGAGAGG + Intergenic
1148330907 17:46813453-46813475 ATGGCTCTAACCTTTGGCGGGGG + Intronic
1155384310 18:25260395-25260417 AGGGATATAAAGTATGGGTGGGG + Intronic
1157498649 18:48173780-48173802 AGGGCTGTGGACTTTGGAGGAGG - Intronic
1162775501 19:12976409-12976431 AGGGGTATCAGCTTTGGGAGAGG + Intergenic
1164418121 19:28063053-28063075 ATGGCTATGAACATTTGGGGTGG + Intergenic
1164468220 19:28506230-28506252 AGGGTTATAGACTTTGGAGCTGG - Intergenic
1165411721 19:35666318-35666340 AGGTCTATAAATCATGGGGGTGG + Intergenic
925410415 2:3636726-3636748 AGGGCTTAACACTTTGCGGGAGG + Intronic
929209848 2:39343737-39343759 AGATGTATAAACTTTTGGGGAGG - Intronic
929864256 2:45704844-45704866 AGGGCTATCAAATTTGGTTGAGG + Intronic
933848273 2:86344298-86344320 AGGGGTATGAACTTTTTGGGCGG + Intergenic
935078198 2:99766624-99766646 AGATCTATGAACTTTTGGGGGGG - Intronic
936115928 2:109703003-109703025 AGGACCATCAAATTTGGGGGTGG + Intergenic
942135704 2:172923238-172923260 AGGACTACAAACTTGGGAGGTGG + Intronic
942303662 2:174586111-174586133 AGGACTAGGAACTTTGAGGGCGG - Intronic
945430182 2:209754926-209754948 AGGTCCATAAAATTTGGGGGAGG + Intergenic
946089141 2:217205386-217205408 AGTGCTATATATTTTGGGAGGGG + Intergenic
1172288341 20:33757182-33757204 AGGGCTGTACACTGTGGGGGTGG - Exonic
1172332225 20:34083140-34083162 AAGGCTACTAAATTTGGGGGTGG - Intronic
1175646736 20:60680554-60680576 AGAGTTCTAAACTTTGGGGATGG - Intergenic
1177862307 21:26468704-26468726 TGGGCTAGATACTTTGGGAGGGG + Intronic
1181783320 22:25208278-25208300 AGGGCTATAATGTTGGGAGGCGG + Intergenic
1182936753 22:34230090-34230112 TGGGATGTAAACTTTGGGGCGGG + Intergenic
1184802017 22:46767065-46767087 AGGGCTATAAACTGCAGGAGAGG + Intronic
950515417 3:13461788-13461810 AAGGCTGTAGACTTTGAGGGTGG + Intergenic
953929692 3:46999725-46999747 AGAGGTAAAAGCTTTGGGGGAGG + Intronic
956110065 3:65861333-65861355 AGGGTCAGAAACTTTGGGTGGGG - Intronic
956873016 3:73436480-73436502 AAGGCCCTCAACTTTGGGGGAGG - Intronic
958763113 3:98331870-98331892 AAGGCTGTAAACTTTTTGGGTGG - Intergenic
960343477 3:116503629-116503651 AAAGCTATAAACATGGGGGGGGG + Intronic
966060582 3:175749494-175749516 AAGGCTATATCCTTTGGAGGAGG + Intronic
966161123 3:176969553-176969575 AGAGAAATAAACTTTGGAGGTGG - Intergenic
976002434 4:80387952-80387974 AGGGCTGTACACTGTGGGGGTGG + Intronic
978850111 4:113324892-113324914 AGGAATAGTAACTTTGGGGGTGG + Intronic
982144864 4:152375237-152375259 ATAGCTATATACTTTGGGAGAGG + Intronic
982624010 4:157742042-157742064 AGGACTATTAAATTTGTGGGTGG - Intergenic
982751943 4:159172515-159172537 AGGGCTTTAAATGTTGGGGGTGG + Intronic
984235446 4:177151915-177151937 AGGGATACAAAGTTTGGAGGTGG + Intergenic
984800773 4:183714919-183714941 AGTGTTATAAATTGTGGGGGAGG + Intergenic
990778622 5:59332750-59332772 AGGGCTGTAAGCTCTGGGGAAGG + Intronic
991374631 5:65953919-65953941 AGGTCTATAATGTTTGGGGGAGG - Intronic
992710273 5:79446242-79446264 GGGGCTCTAAACTGTAGGGGTGG - Intronic
995246097 5:109937242-109937264 AGGCATTTACACTTTGGGGGGGG + Intergenic
1001629676 5:173165443-173165465 GGGGCTATAAATAGTGGGGGAGG - Intergenic
1003538452 6:6996908-6996930 AGGGCTATAACCCTTTGTGGCGG + Intergenic
1004548239 6:16620686-16620708 AGGGCTAAAGCCTTTTGGGGGGG - Intronic
1008326339 6:50186751-50186773 AGGGCTTTAAACACTGGGAGAGG + Intergenic
1011017950 6:82779836-82779858 AGGGCTATTAACTCTGTGTGAGG - Intergenic
1015353311 6:132247800-132247822 AGCAGTATAAACTTTGGGAGAGG + Intergenic
1018959728 6:168440055-168440077 TTGGCTATGAACTTTGGGGGAGG - Intergenic
1021150713 7:17147712-17147734 AGGGATAAAGACTTTGGAGGAGG - Intergenic
1023164552 7:37330590-37330612 AGAGGCATAAAATTTGGGGGTGG - Intronic
1026438443 7:70420792-70420814 AGGGATAGAAGCTTTGGGGAGGG + Intronic
1027900114 7:84102520-84102542 AGGGCTATAAAATTAGGGCAAGG + Intronic
1027945943 7:84746397-84746419 AGAGGTATAAACCTTGGGGGTGG + Intergenic
1029026837 7:97425257-97425279 AGGGCTCTTTAGTTTGGGGGTGG + Intergenic
1029990245 7:104956639-104956661 AGGACTATGTATTTTGGGGGCGG + Intergenic
1030993728 7:116332855-116332877 AGGGCTAGAAAGTTTGGAGATGG + Intronic
1035533515 8:374000-374022 AGGCCATTAAATTTTGGGGGTGG - Intergenic
1038385756 8:27143101-27143123 ACCACTATAAACTTTGGGGGAGG - Intergenic
1039231599 8:35454666-35454688 AGGGCAATAAATTGTGGGGAAGG - Intronic
1040996094 8:53404116-53404138 AAAGCTTTAAACTTTTGGGGTGG - Intergenic
1043002906 8:74781069-74781091 AAGGCTATAAAATGAGGGGGTGG + Intronic
1044214423 8:89591896-89591918 AGGCTTATAAAGTTTGGGAGGGG + Intergenic
1044543536 8:93434232-93434254 AGGGTCATCAACTTAGGGGGGGG - Intergenic
1046698552 8:117373092-117373114 AGAGAAATAAACTTTGGGGGGGG + Intergenic
1048847124 8:138612484-138612506 AGGACTTAAAAATTTGGGGGGGG - Intronic
1051949432 9:22613513-22613535 AGGGCTACAAAAAGTGGGGGTGG - Intergenic
1052230161 9:26140835-26140857 AGGAATACAAAGTTTGGGGGAGG - Intergenic
1056130847 9:83585104-83585126 TGGGTTGTAAACTTTGTGGGCGG + Intergenic
1056693914 9:88830285-88830307 AGGACTCTGAACTTGGGGGGTGG + Intergenic
1192172365 X:68865052-68865074 AGGTCTTTAGTCTTTGGGGGTGG - Intergenic
1194178775 X:90687853-90687875 AGGGACATAAAATTTGGGAGGGG - Intergenic
1197014152 X:121604179-121604201 CGGGATATAACCTTTGGGGAAGG + Intergenic
1198749958 X:139929886-139929908 ACGGCTTCAAAATTTGGGGGAGG - Intronic
1198809843 X:140524265-140524287 AGGTCTTCAAACTTTTGGGGAGG + Intergenic
1199566463 X:149220917-149220939 AGGGCTATAAAAATTGAGTGAGG + Intergenic
1200525440 Y:4270024-4270046 AGGGACATAAAATTTGGGAGGGG - Intergenic