ID: 1127414606

View in Genome Browser
Species Human (GRCh38)
Location 15:58745805-58745827
Sequence GCACATACCCAGTTTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127414599_1127414606 21 Left 1127414599 15:58745761-58745783 CCAGGTGTATCATTAGGAATGAT 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1127414606 15:58745805-58745827 GCACATACCCAGTTTAAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127414606 Original CRISPR GCACATACCCAGTTTAAAGA GGG Intronic
907113956 1:51952232-51952254 GTACATACCCATTTCACAGATGG + Intronic
907913048 1:58843637-58843659 GAAAATACCCATTTTACAGAGGG + Intergenic
913534293 1:119756704-119756726 GAACATCCCCATTTTATAGATGG + Intronic
918451992 1:184667982-184668004 GCAGATACAAAGTTTAAAAAGGG - Intergenic
918817022 1:189199914-189199936 GACCATACCTAATTTAAAGAAGG - Intergenic
919099718 1:193079760-193079782 GTACAAACCCAATTTAAAAATGG + Intronic
924567752 1:245212239-245212261 GCTCATCCCCATTTTAAAGGTGG + Intronic
1063058573 10:2527495-2527517 GAAAATACCCACTTTAAATAAGG + Intergenic
1064585306 10:16833970-16833992 GTACAAAGCCAGTTTAGAGACGG + Intronic
1065130978 10:22620135-22620157 GCAGATACCAAGTTGACAGATGG - Intronic
1065254440 10:23851518-23851540 GCATATACCCAGTAAAGAGATGG + Intronic
1066660675 10:37736413-37736435 GCCCCTTCCCAGTTTAGAGAGGG + Intergenic
1068671311 10:59726556-59726578 TCAGACACCCAGTTAAAAGAAGG + Intronic
1069336545 10:67358469-67358491 ACAGACACCCAGTTTGAAGAAGG + Intronic
1071472537 10:85993960-85993982 TCAAATAACCAGTTTAAATATGG + Intronic
1071794758 10:88992022-88992044 CCACATCCCCATTTTACAGATGG + Intronic
1072549627 10:96467756-96467778 ATACATACACAGTTTAAAAAAGG + Intronic
1073476571 10:103757531-103757553 GCACATACCAAGTTGTAACAAGG + Intronic
1074903703 10:117841481-117841503 TCACATACCCACCTTGAAGATGG + Intergenic
1076325080 10:129614864-129614886 GCACCCACACATTTTAAAGATGG - Intronic
1077440695 11:2567372-2567394 CCACATCCCCAGTCTAAAGCAGG - Intronic
1078024979 11:7686252-7686274 CATCATACCCATTTTAAAGATGG - Intergenic
1078500092 11:11864700-11864722 ACACATACACAGTTTCAAAAAGG - Intronic
1083636282 11:64122656-64122678 GCACACCCCCACTTTACAGAAGG - Intronic
1084539763 11:69778560-69778582 GCTCATGCCCATTTTACAGATGG - Intergenic
1084610531 11:70199730-70199752 GCGCATCCCCAATCTAAAGAAGG + Intergenic
1085131566 11:74043781-74043803 GCAAATAACCAGTTTAAAAATGG - Intronic
1088890486 11:114040418-114040440 CTATATACCCATTTTAAAGACGG - Intergenic
1089355558 11:117849913-117849935 GCACATGCCCAGTTGAAGGGTGG - Intronic
1092019963 12:5193396-5193418 CCTCATACCCACTTTAAAGAAGG + Intergenic
1093363297 12:18259254-18259276 GTATATACCCATTTTAAAGCAGG - Intronic
1093886665 12:24469183-24469205 TCACATACACAGTTTACAGTAGG + Intergenic
1097991769 12:65842821-65842843 TCACATACCTAGTTTAGTGATGG + Intronic
1098311711 12:69155371-69155393 GCACATACCTTGTCTAAAGTGGG + Intergenic
1098471987 12:70855860-70855882 GCAAATTCCCAGTGTAAATAGGG - Intronic
1105225682 13:18429438-18429460 TCATAAAACCAGTTTAAAGAAGG - Intergenic
1105788897 13:23777924-23777946 GGACATACTAAGTTTTAAGAGGG + Intronic
1106044375 13:26124467-26124489 AAACATACCCAGTTTTAAAAAGG - Intergenic
1109058749 13:57585425-57585447 CTACACACCCAGTTTAAAGTTGG - Intergenic
1109729761 13:66396692-66396714 CCACATACCAAGTTTACAGATGG + Intronic
1110289846 13:73792059-73792081 ACACAAACCCAGATTAATGAAGG + Intronic
1111250953 13:85600664-85600686 GCACCTGCCCAGTGTAAAGAAGG - Intergenic
1112722737 13:102263306-102263328 GGACTTACTCATTTTAAAGATGG + Intronic
1114477053 14:23003478-23003500 GCATATACCCCCATTAAAGAAGG + Intronic
1117030574 14:51665236-51665258 GCACACACCCCGTATAAAGGGGG - Intronic
1117179501 14:53177728-53177750 GCATAAAACCAGCTTAAAGAAGG + Intergenic
1117594494 14:57312303-57312325 GGGCATACCCTATTTAAAGAGGG - Intergenic
1118179472 14:63477641-63477663 GCAAATACTCATTTTAAGGAAGG + Intronic
1120343431 14:83251886-83251908 ACACATACACAGATTGAAGAAGG + Intergenic
1126759051 15:51952599-51952621 GCACATACTCAGTCTAGAGAAGG + Intronic
1127414606 15:58745805-58745827 GCACATACCCAGTTTAAAGAGGG + Intronic
1128280543 15:66390511-66390533 GCCCTTACCCAGTTCAGAGATGG + Intronic
1128501927 15:68232732-68232754 TCACACAGCCACTTTAAAGAAGG + Intronic
1131650589 15:94394188-94394210 TCACACAGCCAGTTTAAAGGGGG - Intronic
1133302152 16:4788942-4788964 GCACATGGCCTATTTAAAGAGGG - Intronic
1137698256 16:50477277-50477299 ACACATGCCCCGTCTAAAGAGGG + Intergenic
1141166106 16:81661936-81661958 GCACATGCCCACATTAAGGATGG - Intronic
1144909244 17:18667356-18667378 ACTTATACGCAGTTTAAAGATGG - Intronic
1149217001 17:54369390-54369412 ACACACACTCAGTTTAAAAAGGG + Intergenic
1150523695 17:65898318-65898340 GCACACACTCAGTTTATAAATGG + Intronic
1151701084 17:75742893-75742915 GCCCTTACCCATTTTACAGATGG - Intronic
1152292390 17:79447510-79447532 GCACAGTCCCATTTTACAGAAGG + Intronic
1153770027 18:8407986-8408008 CCACCCACCCAGTTTAAGGAGGG - Intergenic
1158161783 18:54493186-54493208 CCATATACACAGTTTAAAAATGG + Intergenic
1158804897 18:60958774-60958796 GCATATACCCAGTAAAGAGATGG - Intergenic
1160503086 18:79411797-79411819 GCAAACACCCATTTCAAAGAGGG + Intronic
1161657331 19:5524361-5524383 GCACATTCCCAGCTAAAAGTGGG + Intergenic
1162022190 19:7873026-7873048 GCACATGCCCATTTCACAGATGG - Intronic
1162575442 19:11496290-11496312 GCCTGTACCCAGTTTAAAGGGGG + Intronic
1166114217 19:40642930-40642952 TCACATACCCATCTTACAGATGG + Intergenic
1168469599 19:56629581-56629603 GCCCATTCCCAGTTCATAGAGGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
928568384 2:32577518-32577540 GGAAATACACAGTTTAAAGAAGG - Intronic
936766623 2:115857731-115857753 ACACATACACAGTATAAGGATGG - Intergenic
941169945 2:162124539-162124561 GCACAGACCCAGTGTGGAGATGG - Intergenic
941400614 2:165026138-165026160 CCACATACCCACTGTAAAGGAGG + Intergenic
942562402 2:177234705-177234727 GCAAATATCCAGTTTATAGAGGG + Intronic
942965091 2:181882685-181882707 TCACATAGCCATTTTAAAGATGG - Intergenic
1169585194 20:7074148-7074170 GCAAAAACCCAATTTAAAAATGG - Intergenic
1172505670 20:35460474-35460496 GCACATGCCCTGTCTAAAGGGGG + Intronic
1174902135 20:54511228-54511250 GTATATCCCCATTTTAAAGATGG - Intronic
1175608541 20:60331192-60331214 GCACAGACCCAGCCTAGAGAAGG + Intergenic
1175862090 20:62155968-62155990 ACACATACCCACTTGAAAAAGGG - Intronic
1177812395 21:25938303-25938325 TCACATGGCCAGTTTATAGATGG + Intronic
1178915199 21:36702100-36702122 GCACAGAGCCGGTTTAAAGGTGG - Intronic
1180573365 22:16750054-16750076 GGAAATACCTAGTTTACAGAAGG + Intergenic
949526637 3:4911019-4911041 GCACATATACAGTGTAAACATGG + Intergenic
949950931 3:9228218-9228240 GCACATACCTTGTCTAAAAAAGG + Intronic
950300880 3:11877109-11877131 ACAAAAACCCAGTTTAAAAATGG - Intergenic
951144851 3:19214671-19214693 GGATATACCCAGTTTATTGAGGG - Intronic
951703483 3:25520879-25520901 GCACTGGCCCATTTTAAAGATGG + Intronic
952583524 3:34863991-34864013 TCACATACCCATTTTACATATGG + Intergenic
955631338 3:60978647-60978669 TGGCATACCCAGTTTATAGATGG - Intronic
959146298 3:102549618-102549640 GCACATATCCAGTTCAAAGAAGG - Intergenic
959559872 3:107767372-107767394 GTACATATCCAATTTAAAAAAGG + Intronic
960514672 3:118590377-118590399 GCATATACCCAGGTAAAAGATGG + Intergenic
960810938 3:121626996-121627018 GCAAATAGGCAGTTTACAGAAGG - Exonic
965115225 3:164479443-164479465 GCATTTTCTCAGTTTAAAGAAGG - Intergenic
969716167 4:8869299-8869321 GCACTTGCCCAGATTGAAGAGGG + Intronic
971913590 4:32828753-32828775 TCAGAGACCCAGTTAAAAGATGG - Intergenic
973794281 4:54408011-54408033 TTACATAGCCTGTTTAAAGAAGG + Intergenic
973960436 4:56104472-56104494 GCAAATACACATTTTTAAGAGGG + Intergenic
974293982 4:59970470-59970492 GAACATATCCAGTTGAAACATGG + Intergenic
977246005 4:94632170-94632192 GCCCTTACTGAGTTTAAAGAAGG - Intronic
977349726 4:95867274-95867296 GGACAATCACAGTTTAAAGAAGG - Intergenic
978024368 4:103853736-103853758 ACAAATACCCAGTTTATAGCAGG + Intergenic
978170036 4:105658915-105658937 GCACCTACCCAGATTAAAAGAGG - Intronic
978281734 4:107024933-107024955 GCATATACCCAGATTGAACATGG + Intronic
981934839 4:150228548-150228570 GCACACAAACAGTTGAAAGATGG + Intronic
984323085 4:178218445-178218467 GCACAGAAACAGTGTAAAGATGG - Intergenic
985136447 4:186791006-186791028 CATCATACCCATTTTAAAGATGG + Intergenic
985721294 5:1490629-1490651 GCACAGCCCCAGTTTAACCATGG + Intronic
986783157 5:11085622-11085644 GCACAGATCCAGGTAAAAGATGG + Intronic
987872202 5:23635095-23635117 GTATATACAGAGTTTAAAGAGGG + Intergenic
998535038 5:142922068-142922090 TCACATACACAGTTTGAAAATGG - Intronic
1003384796 6:5657326-5657348 GGACAAACCCAGATGAAAGATGG + Intronic
1004740312 6:18453824-18453846 GCAAGTACCCAGTTCAAACAAGG - Intronic
1005564279 6:27074250-27074272 AAACATACACAGATTAAAGAAGG + Intergenic
1006584908 6:35102918-35102940 ACAGATACACAGTTTAAAAAGGG - Intergenic
1008135386 6:47770384-47770406 GCAAATCCCTATTTTAAAGATGG - Intergenic
1011635183 6:89365756-89365778 TCATATACCCAGCTTAAACATGG + Exonic
1011759513 6:90546379-90546401 ACACATACATAGTTAAAAGATGG + Intronic
1013228181 6:108136133-108136155 CCACATACCCAGATTAAAGGTGG + Intronic
1016651176 6:146462667-146462689 AAAAATACCCATTTTAAAGATGG + Intergenic
1017031166 6:150223677-150223699 AAACACACCCAGTTAAAAGATGG - Intronic
1022911298 7:34901712-34901734 GCACCTACCCTGTTTGAAGTGGG + Intergenic
1023100992 7:36718117-36718139 AGACAAACCCAATTTAAAGAGGG + Intronic
1028718025 7:93996567-93996589 GTACATACCAAATTAAAAGATGG - Intronic
1029011279 7:97264316-97264338 GAACACACACAGTTTAAATAAGG + Intergenic
1029058511 7:97772232-97772254 GCACAAAACCAGTTTATTGAAGG + Intergenic
1031643499 7:124194292-124194314 GACCACACCCAGTATAAAGAAGG - Intergenic
1034108832 7:148516317-148516339 GCACATACAGAATATAAAGATGG + Intergenic
1034742070 7:153484516-153484538 GTGCATACCCAGATTAAAGATGG + Intergenic
1035812995 8:2507891-2507913 GCACATACGCAGTTCACAGCAGG - Intergenic
1036772484 8:11588652-11588674 GCACATCCAGAGTTTCAAGATGG + Intergenic
1039243016 8:35577330-35577352 GAACTTATCCAGATTAAAGAAGG - Intronic
1040369855 8:46758717-46758739 GCACAAAACCAGTTTATTGAAGG - Intergenic
1040395105 8:46991248-46991270 GAACCTACCCAGTTTTAACATGG - Intergenic
1047032231 8:120895145-120895167 GCCCAAACCCAGCATAAAGAAGG - Intergenic
1047213382 8:122857789-122857811 TCACATACCCATTCTACAGATGG - Intronic
1047411593 8:124628792-124628814 GCCCATCCTCATTTTAAAGATGG + Intronic
1052316548 9:27121831-27121853 GCACATACACAGTTCTAAAAAGG - Intronic
1058273414 9:103006062-103006084 ACACACACACAGTTTAATGAAGG + Exonic
1059944476 9:119394875-119394897 GCACAGACCTTGTTAAAAGAAGG - Intergenic
1061715499 9:132516070-132516092 GCACATACCTGGTCTAAAGTTGG + Intronic
1061815530 9:133192287-133192309 TCACATGCCCATTTTACAGATGG - Intergenic
1187149896 X:16671925-16671947 GCATATACCCAGGTAAAGGATGG + Intronic
1190894385 X:54602410-54602432 AATCATGCCCAGTTTAAAGATGG - Intergenic
1194334567 X:92629662-92629684 GGAAATACCCAGTGAAAAGATGG - Intergenic
1195738572 X:108038685-108038707 GCACATGCCCACTTTTAAAAAGG - Intergenic
1197947731 X:131858827-131858849 GAATATATCCACTTTAAAGAAGG - Intergenic
1199811689 X:151356169-151356191 GGATATACCCACTTTACAGATGG - Intergenic
1200643047 Y:5746716-5746738 GGAAATACCCAGTGAAAAGATGG - Intergenic