ID: 1127417568

View in Genome Browser
Species Human (GRCh38)
Location 15:58771878-58771900
Sequence CAGCGACCCGAGCCCTCCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 101}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127417557_1127417568 26 Left 1127417557 15:58771829-58771851 CCGCCGGCTCCGAAGAGCCCAGC 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417563_1127417568 8 Left 1127417563 15:58771847-58771869 CCAGCAGCGCCGGCGGCCTCAGC 0: 1
1: 0
2: 3
3: 32
4: 335
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417565_1127417568 -8 Left 1127417565 15:58771863-58771885 CCTCAGCAGCAGTTGCAGCGACC 0: 1
1: 0
2: 1
3: 22
4: 229
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417558_1127417568 23 Left 1127417558 15:58771832-58771854 CCGGCTCCGAAGAGCCCAGCAGC 0: 1
1: 0
2: 4
3: 27
4: 370
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417560_1127417568 17 Left 1127417560 15:58771838-58771860 CCGAAGAGCCCAGCAGCGCCGGC 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417562_1127417568 9 Left 1127417562 15:58771846-58771868 CCCAGCAGCGCCGGCGGCCTCAG 0: 1
1: 0
2: 1
3: 8
4: 180
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417564_1127417568 -1 Left 1127417564 15:58771856-58771878 CCGGCGGCCTCAGCAGCAGTTGC 0: 1
1: 0
2: 2
3: 16
4: 341
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1127417556_1127417568 29 Left 1127417556 15:58771826-58771848 CCGCCGCCGGCTCCGAAGAGCCC 0: 1
1: 0
2: 2
3: 6
4: 162
Right 1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG 0: 1
1: 0
2: 1
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127417568 Original CRISPR CAGCGACCCGAGCCCTCCTG GGG Exonic
900548237 1:3240700-3240722 CAGCAAGCTGAGCCCCCCTGGGG + Intronic
903466301 1:23554707-23554729 CAGCGGCCCGAGCGCAGCTGGGG + Intergenic
906157270 1:43621004-43621026 CACCCACCCCAGCCCTCCAGGGG - Intronic
910238579 1:85061932-85061954 CAGCGAGCTGGGCCCTCCTAGGG - Intronic
913047789 1:115089019-115089041 CAGGGACCCAAGTCCTCCGGAGG + Intronic
913333506 1:117686569-117686591 CAGCCGCCCCAGCCCTCCTAGGG + Intergenic
916174123 1:162023724-162023746 CAGCCACCTGAGCCCTCCTGCGG - Exonic
922675276 1:227545620-227545642 GAGGGACCCCACCCCTCCTGGGG + Intergenic
1063429684 10:5977665-5977687 CAGCGTCCCCACCCCTGCTGGGG + Intronic
1063920198 10:10925302-10925324 CAGCTCCCCCAGCTCTCCTGGGG + Intergenic
1065024307 10:21526339-21526361 CAGCGGCCCCAGCCCTTCCGCGG + Intergenic
1065921020 10:30392791-30392813 CAGCGGCCTGAGCGCGCCTGCGG + Intergenic
1065961097 10:30734974-30734996 CAGCTACCCGAGCCCTACCAGGG + Intergenic
1067449142 10:46370793-46370815 CAGGGACCCATGCCCTCATGGGG + Intronic
1067470557 10:46534882-46534904 CAGTGACTCAGGCCCTCCTGAGG + Intergenic
1067588227 10:47489972-47489994 CAGGGACCCATGCCCTCATGGGG - Intronic
1067635352 10:47998063-47998085 CAGGGACCCATGCCCTCATGGGG - Intergenic
1069158121 10:65054159-65054181 CAGCGACTCGCGCCCGGCTGCGG - Intergenic
1069667433 10:70172251-70172273 CAGCCTCCCAAGCCATCCTGTGG - Intergenic
1069723014 10:70561588-70561610 CAGCGGCCCCAGCACTTCTGTGG + Intronic
1071609776 10:87022007-87022029 CAGGGACCCATGCCCTCATGGGG + Intronic
1072720486 10:97777864-97777886 CAGTCATCCCAGCCCTCCTGGGG - Intergenic
1083780927 11:64916896-64916918 CAGCGACCTGAGGCTCCCTGCGG - Intronic
1085259583 11:75196589-75196611 CTGCGACCCCAGCACTCGTGTGG + Exonic
1089346563 11:117795386-117795408 CTGCGAGCCGAGCCAGCCTGCGG + Intronic
1095465487 12:42483955-42483977 CAGCGCCGGGAGCCCGCCTGGGG + Intronic
1095699156 12:45173493-45173515 CAGCGACTGAAGCCCTCTTGTGG - Intergenic
1095874843 12:47068895-47068917 CATCCACCCGTCCCCTCCTGGGG - Intergenic
1104649641 12:130522406-130522428 CTGCGACCCTGTCCCTCCTGCGG + Intronic
1105000609 12:132687699-132687721 CAGCGCCCCGAGCCCGGCTTCGG - Exonic
1106078865 13:26484229-26484251 CAGGGACCTGAGCCCTGCTGAGG - Intergenic
1108156744 13:47592720-47592742 CAGGGACCCAAGCCCCACTGAGG + Intergenic
1114671435 14:24413437-24413459 CAGCCTCCCAGGCCCTCCTGGGG + Intronic
1115661122 14:35495019-35495041 CAGTGACACAAGCACTCCTGTGG - Intergenic
1115979152 14:39030321-39030343 CAGCAGCCCGGGCCCTCCTCCGG + Intergenic
1122415837 14:101549087-101549109 CCGAGAACCGAGGCCTCCTGGGG - Intergenic
1122534921 14:102455391-102455413 CAGAGTCCAGAGCCCGCCTGGGG - Intronic
1127417568 15:58771878-58771900 CAGCGACCCGAGCCCTCCTGGGG + Exonic
1132771700 16:1567174-1567196 CAGCTGCTCGAGCCCTCCAGTGG + Intronic
1135423090 16:22317439-22317461 CAGGAACCCGAGCCCGCCTGTGG - Intronic
1142006390 16:87691366-87691388 GAGCGAGCAGAGCCCTGCTGGGG - Intronic
1144496537 17:15749582-15749604 CAGCGGCCCGAGCCCGGCTGCGG + Intergenic
1144905041 17:18635117-18635139 CAGCGGCCCGAGCCCGGCTGCGG - Exonic
1147675914 17:42205477-42205499 CAGCCTCCCTGGCCCTCCTGAGG + Intronic
1148454883 17:47805861-47805883 CAGCGACCCCAGTCCTGCTCTGG - Intergenic
1149460903 17:56829508-56829530 CTAAGACCCAAGCCCTCCTGGGG - Intronic
1151876443 17:76870067-76870089 CCGCGCCCGGAGCCCACCTGTGG - Intronic
1152933752 17:83124261-83124283 CGGCTGCCCGAGCCCTCCAGGGG - Intergenic
1161520260 19:4719922-4719944 CAGGCACCCCTGCCCTCCTGAGG - Exonic
1162597311 19:11639543-11639565 CAGTGACCTGACCCCTCCCGGGG - Intergenic
1163178908 19:15584757-15584779 GAGCCACCCGCGCCCTCCTCAGG + Intergenic
1167416478 19:49375821-49375843 CAGCCACCCGAGCTCTCATTGGG + Intergenic
1168187758 19:54710463-54710485 TAGCGTCCTGAGCTCTCCTGGGG - Intergenic
926042022 2:9681009-9681031 CAGCCACCACAGCCATCCTGAGG + Intergenic
930743459 2:54857328-54857350 CTGAGGCCTGAGCCCTCCTGTGG + Intronic
932103474 2:68922424-68922446 CAGAGCCCCAAGCCCTGCTGGGG - Intergenic
939671048 2:145012963-145012985 CAGGCACCTGAGCCCTGCTGGGG - Intergenic
946224325 2:218255101-218255123 CAGGGACCAGAGTCCTGCTGGGG - Intergenic
946951404 2:224879257-224879279 CATCTACCCCAGTCCTCCTGGGG - Intronic
947591064 2:231386193-231386215 CAGTGACCCCAGACCTGCTGGGG + Intergenic
1169863126 20:10172526-10172548 CAGCGCCCCGAGGGCTCCCGCGG - Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1170897000 20:20423553-20423575 ATGCGACCTGAGCCCACCTGTGG - Intronic
1175842803 20:62041090-62041112 CAGCGACCTGAGCGCTCCAAAGG + Intronic
1176384910 21:6134495-6134517 CAGCTCCCCGGGCCCTGCTGGGG + Intergenic
1179738562 21:43403757-43403779 CAGCTCCCCGGGCCCTGCTGGGG - Intergenic
1179818910 21:43925186-43925208 CACTGTCCCGGGCCCTCCTGTGG + Exonic
1180961957 22:19766216-19766238 CGGCGCCCCGAGCCCTCCCCGGG - Intronic
1181082122 22:20422966-20422988 CAGCCACTGGAACCCTCCTGGGG + Intergenic
1182711733 22:32327522-32327544 GAGAGACCCGAGGCCTGCTGGGG + Intergenic
1183745056 22:39687243-39687265 CACCCACCCCCGCCCTCCTGGGG - Exonic
1184399259 22:44264310-44264332 GAGAGACCCGAGGCCTGCTGGGG + Intronic
954450481 3:50568964-50568986 CAGTGGCCCGAGCCCACCAGGGG - Intronic
956929413 3:74025666-74025688 CTCCTACCAGAGCCCTCCTGAGG - Intergenic
958757680 3:98270705-98270727 GAGTGACCCAAGCACTCCTGTGG + Intergenic
966896461 3:184448629-184448651 TGGCGTCCAGAGCCCTCCTGTGG - Intronic
971357917 4:25911699-25911721 CAGAGACCAGAACTCTCCTGAGG - Intronic
977536266 4:98260228-98260250 CAGCGACCGGAGTCCTTCAGGGG - Intergenic
985657732 5:1140722-1140744 CAGCCACCTGAGCCCTCCCCGGG - Intergenic
986813719 5:11385385-11385407 CTGCGCCCCGAACTCTCCTGGGG + Intronic
997635018 5:135398687-135398709 CAGCGCCGCGGGGCCTCCTGCGG + Intronic
998716516 5:144890173-144890195 CAGTGACCCAAGCACCCCTGTGG - Intergenic
999175227 5:149627334-149627356 CAGAGACCCGGGCACTCTTGTGG + Intronic
1002521600 5:179795721-179795743 CTGCGACCCGGACCCGCCTGGGG - Intronic
1003033685 6:2624303-2624325 CAGAGGCCTGAGCCCTCCTAAGG - Intronic
1006424967 6:33958201-33958223 CAGCATCCCAAGCCCACCTGGGG - Intergenic
1015519202 6:134114520-134114542 CAGCCACCTGAGGCCGCCTGGGG - Intergenic
1018178619 6:161200782-161200804 CAGAGACAAGAGCCATCCTGCGG - Intronic
1022403266 7:30061997-30062019 CAGCGACTGAAGCCCTCTTGTGG + Exonic
1022442607 7:30446456-30446478 CAGGGACCTGAGCCCTCCCTGGG + Intronic
1027053270 7:75032781-75032803 CACCGCACCCAGCCCTCCTGTGG - Intronic
1032083281 7:128870462-128870484 AAGAGAGCCGAGGCCTCCTGGGG - Intronic
1033249651 7:139747700-139747722 CATCAGCCCCAGCCCTCCTGTGG + Intronic
1035459637 7:159030974-159030996 CAGCGTCCCCCGCCCTCCTGTGG - Intronic
1035689917 8:1553302-1553324 CCGCAACCCTGGCCCTCCTGGGG + Intronic
1044115410 8:88328226-88328248 CACCGACCCGAGCCACCCAGGGG - Intergenic
1048286170 8:133143296-133143318 CAGGCACTCGAGCCTTCCTGAGG + Intergenic
1050021788 9:1292103-1292125 CAGCAGCCCCTGCCCTCCTGAGG - Intergenic
1055552707 9:77446033-77446055 CAGTGACCAGGGCCCTGCTGGGG + Intronic
1059347431 9:113639099-113639121 CAGCATCCCCAGCCCTGCTGGGG + Intergenic
1061444976 9:130632494-130632516 CAGAGTCCCCAGCCCGCCTGAGG - Intronic
1062130117 9:134888049-134888071 GAGGGACCCGAGCACTCCTGAGG + Intergenic
1187400012 X:18951087-18951109 CAGCAACCCCAGCTCACCTGAGG + Exonic
1190725406 X:53187206-53187228 CAGTAACCCAAGCCCCCCTGTGG + Intergenic
1191797335 X:65034994-65035016 CAGCGGCCCGGACCCTCCTGGGG - Intergenic
1192053017 X:67744595-67744617 CAGGGAGCTGGGCCCTCCTGTGG - Intergenic
1200124840 X:153808310-153808332 CAGGGCCCGGGGCCCTCCTGAGG + Intronic
1200224854 X:154411794-154411816 CAGCGCCCCGGGCCGGCCTGTGG - Exonic
1200954091 Y:8927899-8927921 TACCGACCCGCACCCTCCTGGGG + Intergenic
1202199536 Y:22331743-22331765 TACCGACCCGTGCCCTCTTGGGG + Intronic