ID: 1127430594

View in Genome Browser
Species Human (GRCh38)
Location 15:58903524-58903546
Sequence GCTTAAGAATGTGCATCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127430594 Original CRISPR GCTTAAGAATGTGCATCTGA CGG Intronic
902850286 1:19150075-19150097 GCTTAAGAATATGCCACTGTAGG + Intronic
903702566 1:25261225-25261247 GCTTCAAAATATGAATCTGAGGG + Intronic
904588448 1:31593433-31593455 GCTGATGAAGGTGCAACTGAGGG + Intergenic
906962396 1:50426512-50426534 GCGTAAGAATGTGCTCCTGTCGG - Intergenic
908319928 1:62969127-62969149 GCTGAAGAAAGGGCATGTGAGGG + Intergenic
914318270 1:146534432-146534454 GCTCAAGTATGAGCAACTGAAGG + Intergenic
914496090 1:148198924-148198946 GCTCAAGTATGAGCAACTGAAGG - Intergenic
918472725 1:184890924-184890946 ATTTAAGTATGTGCATCTGACGG + Intronic
920024074 1:202979353-202979375 CCTTAAGAATGAGGATTTGAAGG - Intergenic
920942537 1:210497618-210497640 GCTTAAGATTTTACACCTGAGGG + Intronic
922525096 1:226295619-226295641 GCTTAAAAGTGTGCATTTGTAGG + Intronic
923486180 1:234433502-234433524 GCTTATAAATCTGCATTTGAAGG - Exonic
923962054 1:239096819-239096841 GCTTAAGCACGTGCACCAGATGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1063491668 10:6469889-6469911 ACTTAAGAATATGCATTTAAGGG - Intronic
1066065294 10:31757292-31757314 GCTTAAGAATTTGCCTCTGGGGG + Intergenic
1073363225 10:102917322-102917344 GATTAAGAATGAGCCTCTGTGGG + Intergenic
1075598119 10:123747145-123747167 CATTAAGAATTTGCATCTGCAGG - Intronic
1076108906 10:127846175-127846197 GATTAAGAATATGGAACTGATGG - Intergenic
1078184797 11:9042422-9042444 GTTTAGAAAGGTGCATCTGATGG - Intronic
1078559924 11:12362564-12362586 GTTTAAGAATATGCATGTGCTGG - Intergenic
1079871396 11:25802599-25802621 GCTTAAGAATGTAAATTAGAAGG - Intergenic
1080300960 11:30784526-30784548 GCTAAAGAAAGTGCACCTGCAGG - Intergenic
1081434046 11:43007412-43007434 GCTTAAGATTGCAGATCTGAAGG + Intergenic
1089942473 11:122433284-122433306 GCTTAAACATATGCATCTCAGGG - Intergenic
1090353818 11:126125666-126125688 GCTACAGAATGTGCATCTGCAGG - Intergenic
1096470779 12:51874211-51874233 GCTTAAGAGAGAGCATCAGAGGG + Intergenic
1096681420 12:53257989-53258011 GATTAAAAATGTGGATCTGAGGG + Intergenic
1097424793 12:59429967-59429989 TCTGAAGAATGACCATCTGAGGG + Intergenic
1102774851 12:115509479-115509501 TCTTAAGTAGGTGCATCTCATGG + Intergenic
1103007555 12:117433999-117434021 TGTTGAGAATGTGCATGTGAGGG - Intronic
1105970734 13:25427231-25427253 GCATTAGACTGTGCATGTGAGGG + Intronic
1107341504 13:39411814-39411836 GTTTAAGTATGTGCCTCAGAAGG - Intronic
1107540265 13:41382950-41382972 GATTAAGAATTTGTATCTGATGG - Intergenic
1107632739 13:42358732-42358754 GCTCAAGCATGATCATCTGATGG - Intergenic
1108441011 13:50452792-50452814 GCTGAAGAAGGTTCATCAGATGG + Intronic
1109468766 13:62776714-62776736 GCTTCAAAATGTACATCTCATGG + Intergenic
1111562296 13:89967150-89967172 TCTTATGATTGTTCATCTGAAGG + Intergenic
1112947229 13:104944313-104944335 GATGAAGCATGTGCTTCTGAAGG + Intergenic
1115672412 14:35629109-35629131 GCTAAAGACTGTGATTCTGAGGG + Intronic
1118812677 14:69286646-69286668 ACTTAATAATATGCATGTGAAGG + Intronic
1121806271 14:96827044-96827066 GCTTATTAATGTGCCTCTCAGGG - Intronic
1121823320 14:96989375-96989397 GCCTGAGAAGGAGCATCTGAAGG - Intergenic
1124116995 15:26853641-26853663 ACTTAAGAAAGAGCATCAGAAGG - Intronic
1124258963 15:28169628-28169650 GCAGAAGAATCAGCATCTGAAGG + Exonic
1126654616 15:50963514-50963536 AGTTAAAAATGTGCATCTTATGG + Intronic
1127430594 15:58903524-58903546 GCTTAAGAATGTGCATCTGACGG + Intronic
1131611861 15:93973453-93973475 GCTCAATGATGTGCAGCTGAAGG - Intergenic
1131915761 15:97264382-97264404 TCTTAAGAACTTGGATCTGAGGG + Intergenic
1133911401 16:10069639-10069661 GCTCAAGTGTGTGCATCTAATGG - Intronic
1141322134 16:83020969-83020991 CCTTCTGAATGTGCATCTCAAGG - Intronic
1144643229 17:16950878-16950900 TCTTAACAATCTGCCTCTGATGG + Intronic
1145205512 17:20983141-20983163 TCTTAACAATCTGCCTCTGATGG - Intergenic
1146105236 17:30029053-30029075 AATTAAAAATGTGCCTCTGATGG - Intronic
1150811369 17:68359801-68359823 GCTTCAGAAATTGCATCTTAAGG + Intronic
1154423463 18:14253858-14253880 CCTTAAGAAAGAGCATCAGAAGG + Intergenic
1155065618 18:22266565-22266587 GTTTAAAAATCTGCATCTCAAGG + Intergenic
1155086352 18:22463125-22463147 GCTCAGGAATGAGCCTCTGATGG - Intergenic
1156329421 18:36105631-36105653 GTTTAAGAATGAGCAGCAGAGGG - Intergenic
1157728118 18:49980518-49980540 TCTTAAAAATGCTCATCTGATGG + Exonic
1157903388 18:51542699-51542721 GCTTAAGCATGTGTGTCTTATGG - Intergenic
1158453624 18:57587816-57587838 GCTTAAATATGTGCTACTGATGG + Intergenic
1158628317 18:59090559-59090581 GCTTCAGAATATGAATTTGAGGG + Intergenic
1160126390 18:76176269-76176291 GCTCAAATATGTGCAGCTGAAGG + Intergenic
1160162400 18:76483592-76483614 GCTTAAGAAGGTGAGTCTCAGGG + Intronic
1160445348 18:78923079-78923101 GCTTGAGAACGTGCCTGTGACGG + Intergenic
927643576 2:24860925-24860947 CCTTAAGAGTGTGCGGCTGAAGG - Intronic
930814478 2:55579255-55579277 GCATATGAATGTGCATTTGGAGG + Intronic
937317932 2:120943823-120943845 GCTGAACAATGTGGAGCTGAGGG - Intronic
940717455 2:157243771-157243793 ACTTAAGAAAGTGCAGCTTATGG - Intergenic
943642365 2:190373605-190373627 CTTTAAGCATGTGCCTCTGATGG + Intergenic
943977415 2:194502117-194502139 GCTTGAGAATATGCATGTAAAGG + Intergenic
944837097 2:203590556-203590578 CCTTAAAAAGGTGAATCTGATGG - Intergenic
946624554 2:221596450-221596472 TCTTAAGTAAGTGCAGCTGAGGG + Intergenic
948032565 2:234831081-234831103 GACTAAGACTGTGCAGCTGAAGG + Intergenic
1172165739 20:32898033-32898055 GCATGAGAATGTGCATTTCACGG - Intronic
1173708845 20:45136832-45136854 GCTTCAGGGTGTGCAACTGATGG + Intergenic
1183757006 22:39777085-39777107 GTTTAAAAATGTGTAACTGAAGG + Intronic
1183904848 22:41032864-41032886 GCCTAAGGATCTGCATTTGATGG - Intergenic
949500431 3:4675241-4675263 GCTGAAGAGTGAGTATCTGAGGG + Exonic
952625672 3:35399831-35399853 GCTTATGAAAGTGCATCCTATGG - Intergenic
952850213 3:37721932-37721954 TCTTAAAAATGTGAATCAGATGG + Intronic
953159968 3:40409615-40409637 GGTTAAGAAAGGGCAGCTGAAGG + Intronic
953615098 3:44482830-44482852 GCTTAAACATGTGCATCATATGG - Intergenic
953731267 3:45450444-45450466 GCTTAAAAAAGTGGATCTCATGG - Intronic
954849039 3:53584787-53584809 GCTTAAGAGTGTGTGTCTGCAGG + Intronic
955622918 3:60884988-60885010 GCTTAAAAGTGTGGATCTCATGG + Intronic
957512582 3:81208390-81208412 GCTTAAGCATGTTCATCATATGG - Intergenic
959258376 3:104043424-104043446 GCTGAAGAATTTACATTTGATGG + Intergenic
959397994 3:105865906-105865928 GCTAAAGAGTGTGCATTTGAAGG - Intronic
959799304 3:110472579-110472601 GTTTAAGAATTTACTTCTGAAGG + Intergenic
961125985 3:124418190-124418212 GAATAGGAATGTGGATCTGAGGG + Intronic
961530043 3:127535097-127535119 GCTTAAGAAGTTTCATGTGAAGG - Intergenic
967062899 3:185888458-185888480 GCTTAAGAATATGCAACTTGAGG + Intergenic
972194765 4:36640404-36640426 GCTCAGGAATTTGCATCTTAAGG - Intergenic
972991825 4:44829926-44829948 GAGTCAGAATGTGCATCTGCTGG + Intergenic
976633894 4:87267934-87267956 GCTTAATAATGTGTATCAAATGG - Intergenic
979118384 4:116858891-116858913 GCTTTACAAAGTGCAGCTGAAGG + Intergenic
979614684 4:122729186-122729208 GCTTAAGTGTGTGCATCATATGG - Intergenic
980517901 4:133888860-133888882 GATTATGTATGAGCATCTGATGG + Intergenic
984704313 4:182836649-182836671 GCTGAAGGATGTGCAGCTGCTGG - Intergenic
984704327 4:182836728-182836750 GCTGAAGGATGTGCAGCTGCTGG - Intergenic
987095333 5:14544611-14544633 GCTTAACAATTTGTATGTGATGG - Intergenic
987390895 5:17374640-17374662 GCTTAAAAATCTTTATCTGAGGG + Intergenic
988942446 5:36159816-36159838 GCTTCAGAATCTGCTTCTGGGGG + Intronic
991568100 5:68026058-68026080 GCTCAAGAATGTGCTTTTGGAGG + Intergenic
992912022 5:81405131-81405153 GTTTCAGAATTTGCATCTGAAGG + Intergenic
993659640 5:90616938-90616960 GCTAAAGAATGTGGACCTGATGG - Intronic
993912726 5:93704107-93704129 GCTAGGGGATGTGCATCTGAGGG + Intronic
994254374 5:97576066-97576088 GCTTCAGCATATGAATCTGAGGG - Intergenic
996355311 5:122589571-122589593 GCTTATGAATGAACTTCTGAGGG + Intergenic
998727304 5:145032141-145032163 GCTTAAGAATCTGCATAAGTAGG - Intergenic
1001044320 5:168360264-168360286 GTTTAAAAATGTGCATCTTTTGG + Intronic
1002458257 5:179358422-179358444 GCTTCAGTATGTGAATTTGAAGG - Intergenic
1002515470 5:179754919-179754941 GAATAAGAAGGTGCAGCTGAAGG + Intronic
1002633345 5:180595123-180595145 GAATGAGAATGTGCATGTGAAGG + Intergenic
1004485344 6:16061139-16061161 TTTTAAGAAAGTGCATATGAAGG + Intergenic
1007536941 6:42600310-42600332 GCTACAGAATGTTCATCTGTTGG - Intronic
1014581282 6:123140569-123140591 ACTTTAGAATGTCCATCTGTGGG - Intergenic
1015423811 6:133041127-133041149 GCTTCAACATGTGAATCTGAGGG - Intergenic
1016608250 6:145959785-145959807 ACTTATGAATGTGCAGGTGATGG + Intronic
1020717759 7:11698063-11698085 GCTTAATATTGTGGATCTGCTGG + Intronic
1021418309 7:20416098-20416120 TCTTGAGAATGTGCAATTGAAGG - Intergenic
1022211667 7:28216367-28216389 GGTTAAGATATTGCATCTGATGG + Intergenic
1026253686 7:68692440-68692462 GCTTGAGAATGGGCATTTTATGG - Intergenic
1032694913 7:134326885-134326907 CCTTAACAATGTGAATTTGAAGG - Intergenic
1033863144 7:145654808-145654830 GGTTTAGACTGTGCTTCTGATGG - Intergenic
1035930790 8:3777704-3777726 GCCTGAGACTCTGCATCTGAAGG - Intronic
1036127644 8:6077974-6077996 GCTTAAGAAATGGAATCTGATGG - Intergenic
1036625088 8:10463998-10464020 GCATCAGAATGTTCTTCTGATGG - Intergenic
1040959304 8:53014285-53014307 GTTTTTGAATGTGCCTCTGACGG + Intergenic
1041454875 8:58047986-58048008 GCTTAATGATTTACATCTGAAGG + Intronic
1042320743 8:67472833-67472855 GTGTAAGAATTTGCATTTGAAGG - Intronic
1043549193 8:81349787-81349809 GCTTCAGAAGGTGCAGCGGAGGG - Intergenic
1044161055 8:88915561-88915583 GCTGAAGAAAGTGCATTTAAAGG - Intergenic
1045035284 8:98171879-98171901 GCTTCAGTATGTGAATCTTAGGG + Intergenic
1046509925 8:115189378-115189400 GATTAAGAATCTGCATCTCTAGG + Intergenic
1047386368 8:124413498-124413520 GATTAAAAATGTGCATCACAAGG + Intergenic
1048708570 8:137182670-137182692 GTTTATGAATCTTCATCTGATGG - Intergenic
1049242758 8:141546764-141546786 GCTTCAGAATCTGCTTCTAAGGG - Intergenic
1049431614 8:142567796-142567818 GCTTCAGCATGTGAATCTGGTGG - Intergenic
1052597760 9:30582398-30582420 TATTATGAATGTGCATATGAGGG - Intergenic
1055912908 9:81372242-81372264 GCTTTAGCAGGAGCATCTGAGGG - Intergenic
1055928512 9:81535831-81535853 GCTTAAGAATTTGTATTAGAAGG + Intergenic
1057678138 9:97152303-97152325 CTTTAAGAAAGTGCATCAGAAGG - Intergenic
1059548634 9:115204846-115204868 GGTTTAGAATGTGAGTCTGAAGG - Intronic
1060048846 9:120362411-120362433 GCTTCAGCATGTGAATTTGAGGG - Intergenic
1061967018 9:134020683-134020705 GCTGGAAAATGTGCCTCTGAAGG + Intergenic
1062450967 9:136615619-136615641 GCTTCAGCTTGTGAATCTGAGGG + Intergenic
1187055349 X:15737551-15737573 GCTTAGGAAAGCCCATCTGAAGG + Intronic
1187288589 X:17930569-17930591 GCTTAAGAGGGAGCATCAGATGG - Intergenic
1189369306 X:40415108-40415130 ACTCAAGAAAGTGCATCAGAAGG + Intergenic
1189751036 X:44223182-44223204 ACTTAAGACTGTGCCTCAGAAGG + Intronic
1196262744 X:113603883-113603905 GCTTAAGCATGTGCATCTTATGG + Intergenic
1196283097 X:113846949-113846971 GGTTAAGAATAGGCTTCTGATGG - Intergenic
1198708317 X:139473790-139473812 GCTCAAAAATGTGAATGTGAAGG - Intergenic
1199006030 X:142696889-142696911 ACTTGAGAATGTGTATTTGAAGG + Intergenic
1199387130 X:147236078-147236100 GGTTAAGAAGGAGCAACTGAAGG + Intergenic