ID: 1127433376

View in Genome Browser
Species Human (GRCh38)
Location 15:58933541-58933563
Sequence GGCTGCCGCTACCGGTGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433376_1127433387 30 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433387 15:58933594-58933616 GCGAGTGGGCTGCAGGGCGGCGG 0: 1
1: 0
2: 1
3: 36
4: 395
1127433376_1127433385 24 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433385 15:58933588-58933610 GAGGCAGCGAGTGGGCTGCAGGG 0: 1
1: 0
2: 2
3: 27
4: 324
1127433376_1127433382 16 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433382 15:58933580-58933602 GCGCTGCCGAGGCAGCGAGTGGG 0: 1
1: 0
2: 1
3: 4
4: 78
1127433376_1127433384 23 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433384 15:58933587-58933609 CGAGGCAGCGAGTGGGCTGCAGG 0: 1
1: 0
2: 1
3: 28
4: 219
1127433376_1127433380 5 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433380 15:58933569-58933591 AGAAGAGCAGCGCGCTGCCGAGG 0: 1
1: 0
2: 0
3: 6
4: 107
1127433376_1127433386 27 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433386 15:58933591-58933613 GCAGCGAGTGGGCTGCAGGGCGG 0: 1
1: 0
2: 4
3: 29
4: 416
1127433376_1127433381 15 Left 1127433376 15:58933541-58933563 CCACCGCACCGGTAGCGGCAGCC 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1127433381 15:58933579-58933601 CGCGCTGCCGAGGCAGCGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433376 Original CRISPR GGCTGCCGCTACCGGTGCGG TGG (reversed) Exonic