ID: 1127433410

View in Genome Browser
Species Human (GRCh38)
Location 15:58933703-58933725
Sequence TGCAGGTTGCGCTAGGGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433410_1127433424 29 Left 1127433410 15:58933703-58933725 CCGCCACCCTAGCGCAACCTGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1127433424 15:58933755-58933777 CGCGCGTGCGCGTTGGCGCAGGG 0: 1
1: 0
2: 2
3: 4
4: 37
1127433410_1127433415 -2 Left 1127433410 15:58933703-58933725 CCGCCACCCTAGCGCAACCTGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1127433415 15:58933724-58933746 CAGCAGCAGCCGCCAGCACCCGG 0: 1
1: 0
2: 5
3: 41
4: 477
1127433410_1127433416 5 Left 1127433410 15:58933703-58933725 CCGCCACCCTAGCGCAACCTGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1127433416 15:58933731-58933753 AGCCGCCAGCACCCGGATGACGG 0: 1
1: 0
2: 0
3: 5
4: 75
1127433410_1127433423 28 Left 1127433410 15:58933703-58933725 CCGCCACCCTAGCGCAACCTGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433410_1127433421 22 Left 1127433410 15:58933703-58933725 CCGCCACCCTAGCGCAACCTGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1127433421 15:58933748-58933770 TGACGGCCGCGCGTGCGCGTTGG 0: 1
1: 0
2: 1
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433410 Original CRISPR TGCAGGTTGCGCTAGGGTGG CGG (reversed) Intronic
900547363 1:3236331-3236353 TGCTGGAAGCCCTAGGGTGGGGG - Intronic
901018779 1:6245696-6245718 TGTAGGTGGAGCTAGAGTGGGGG - Intergenic
903602591 1:24553650-24553672 AGCAGGGTGGGATAGGGTGGGGG - Intergenic
905106498 1:35566221-35566243 CCCAGGTTGCCCTAGGATGGAGG - Exonic
906660091 1:47575806-47575828 TGCAGGGGGCCCTAGGGTAGTGG - Intergenic
909334199 1:74451875-74451897 GGCAGTTTGCACTAGGGTGATGG - Intronic
912330892 1:108819160-108819182 TGCAGCTTGACCAAGGGTGGTGG - Intronic
912382117 1:109253401-109253423 CCCAGGTGGCGCTGGGGTGGGGG + Intronic
916398510 1:164419086-164419108 TGCAGGCTGTGCTGGGGTGGTGG - Intergenic
917122377 1:171655686-171655708 AGCAGGGGGCGCTAGGGAGGTGG + Intergenic
917423956 1:174893998-174894020 TGGAGGGTGGGCTGGGGTGGAGG + Intronic
921177768 1:212608807-212608829 TGAAGGGTGCGCTCGGGCGGCGG - Exonic
922676931 1:227559102-227559124 AGCAGGCTGGGGTAGGGTGGAGG - Intergenic
922834301 1:228618099-228618121 AGCAGGTCGGGATAGGGTGGAGG + Intergenic
922836528 1:228627015-228627037 AGCAGGTCGGGATAGGGTGGAGG + Intergenic
1063383841 10:5603668-5603690 TGCAGGCTGCGCAAGGCTGGGGG - Intergenic
1067533949 10:47094501-47094523 TGAACGTGGCGCAAGGGTGGGGG - Intergenic
1070766490 10:79059497-79059519 TGCGGGAGGGGCTAGGGTGGGGG + Intergenic
1075082182 10:119391523-119391545 TGCAGGTTGCGGGGTGGTGGAGG - Intronic
1076883865 10:133252452-133252474 TGCAGGGTGGGCTGGGGTGCAGG - Intergenic
1076990823 11:272667-272689 TGCTGGGTGGGCTTGGGTGGTGG - Intergenic
1077533582 11:3108380-3108402 TGCAGGTGGAGTTAGGGAGGAGG + Intronic
1077638983 11:3864188-3864210 TGCAGGTGAAGCTAGGGAGGTGG - Intronic
1081039308 11:38191512-38191534 TGCAGATGGAGTTAGGGTGGCGG + Intergenic
1081691265 11:45080230-45080252 TGGAGCTGGCGCTGGGGTGGGGG - Intergenic
1084526014 11:69698486-69698508 TGCAGGTTGACATAAGGTGGGGG + Exonic
1084551180 11:69843085-69843107 TGCAGATTTTGCTGGGGTGGGGG + Intergenic
1092209692 12:6638243-6638265 GGCAGGTTGGGCTGGGGTGTGGG + Exonic
1092837015 12:12500107-12500129 TGCAGGTTGGGCTTGGATTGAGG - Intronic
1095099049 12:38162643-38162665 AGCAGGCTGGGGTAGGGTGGAGG + Intergenic
1096368013 12:51044966-51044988 TGCAGCTTAGCCTAGGGTGGTGG + Intergenic
1101832734 12:108271985-108272007 TGCAGAATGCCCCAGGGTGGGGG + Intergenic
1103160157 12:118722079-118722101 TTCAGGTTGCACTAAGGTGTGGG + Intergenic
1104207431 12:126653246-126653268 TGCACGTTGTCCTAGGGAGGTGG + Intergenic
1106577840 13:30992549-30992571 TGCTGTTTGAGGTAGGGTGGTGG + Intergenic
1106883736 13:34160010-34160032 TGGAGATTGCTCTAGGGTGCAGG + Intergenic
1109353141 13:61208490-61208512 GTCAGGTAGCGCTATGGTGGAGG - Intergenic
1113472870 13:110559212-110559234 GGCAGGGTGGGCTGGGGTGGGGG - Intronic
1114675522 14:24437592-24437614 TCCAAGCTGAGCTAGGGTGGAGG + Exonic
1117065436 14:52009202-52009224 TCCACTTTGCGCTAAGGTGGAGG + Exonic
1117837119 14:59819281-59819303 TGCAGTTGGGGCTCGGGTGGCGG + Intronic
1117924258 14:60760388-60760410 TGCATGTTACGCAAGTGTGGTGG - Intronic
1119766215 14:77189777-77189799 GGCAGGTTTCACTGGGGTGGGGG + Intronic
1121825470 14:97006857-97006879 AGCAGTTAGCGCCAGGGTGGTGG + Intergenic
1122383678 14:101329366-101329388 TGGAGGGTGCGATGGGGTGGGGG - Intergenic
1124971959 15:34496540-34496562 TGCATGTTCTGCCAGGGTGGTGG + Intergenic
1125748304 15:42012222-42012244 TGCAGCTTGTGCTAGAGTGCAGG - Intronic
1127433410 15:58933703-58933725 TGCAGGTTGCGCTAGGGTGGCGG - Intronic
1128580867 15:68808742-68808764 TGCAGGGGGTGATAGGGTGGAGG - Intronic
1130810185 15:87368543-87368565 TGCACGTTCTGGTAGGGTGGAGG - Intergenic
1131281494 15:91024975-91024997 TGGAGGTTGCCCTAAAGTGGTGG + Intergenic
1133984751 16:10660167-10660189 GGGAGGCTGGGCTAGGGTGGGGG - Intronic
1135403919 16:22184781-22184803 TGCAGGTGGGACTAGGGTGAGGG - Intronic
1136499457 16:30662768-30662790 TGCAGCTGGGGCTGGGGTGGGGG - Exonic
1137617488 16:49856207-49856229 TGAGGGTGGCGGTAGGGTGGGGG - Intronic
1139914068 16:70417487-70417509 TGCAGGGTGTGCTAAAGTGGGGG - Intronic
1140812159 16:78588828-78588850 TGCAGGTTTACCCAGGGTGGTGG + Intronic
1143163296 17:4885217-4885239 TGCAGGTTGCTCTGGGGAGATGG + Intronic
1146163513 17:30572092-30572114 GGCAGGCTGGGCTGGGGTGGTGG - Intergenic
1146356010 17:32134890-32134912 TGGAGGTTGGGGTGGGGTGGAGG + Intergenic
1148041029 17:44707478-44707500 AGCAGCTTGAACTAGGGTGGTGG + Intergenic
1150280195 17:63925717-63925739 TGCAGGTGCTGCTAGGGTTGGGG - Intergenic
1150294690 17:64001533-64001555 TTCAGGTAGGGCTGGGGTGGTGG + Intronic
1150713332 17:67549944-67549966 GGCATATTGCGCTAGGGTGTGGG + Intronic
1153765030 18:8366899-8366921 TGCAGGTAGCGCTGGGCTGCAGG + Intronic
1155654185 18:28176476-28176498 TGCAGGGTGGGGTAAGGTGGAGG + Intronic
1158414421 18:57236944-57236966 TGCAAATGGCGCCAGGGTGGAGG + Intergenic
1158562945 18:58530820-58530842 TGCAGGTTGGGCTAGTGTTGAGG + Intronic
1159588104 18:70301510-70301532 TGCAAGTGGGGCTGGGGTGGGGG + Intronic
1160303212 18:77705184-77705206 TCCAGGTGGGGCTAGGATGGTGG + Intergenic
1160564300 18:79777510-79777532 TGGAGGCAGCTCTAGGGTGGAGG + Intergenic
1166547144 19:43640213-43640235 TGGAGGCTGTGCGAGGGTGGGGG + Intergenic
1166875206 19:45892765-45892787 TGGTGGTTGGGCCAGGGTGGGGG - Intronic
1167037310 19:47002012-47002034 GGAAGGCTGGGCTAGGGTGGTGG - Exonic
1167661118 19:50796672-50796694 TGCAGGTGGCCCTTGTGTGGAGG - Intergenic
927216689 2:20671417-20671439 TGCAGGTAGCGCGAGGGCCGGGG + Exonic
932307461 2:70714282-70714304 GGCAGGTGGCGGTAGGGTGGGGG - Intronic
933950698 2:87326810-87326832 CACAGGTTGCACCAGGGTGGAGG + Intergenic
934962962 2:98694043-98694065 TGGAGCTGGGGCTAGGGTGGAGG - Intronic
936329080 2:111531768-111531790 CACAGGTTGCACCAGGGTGGAGG - Intergenic
938109878 2:128556810-128556832 TGCAGGCTGTGCTGGGCTGGTGG - Intergenic
945336619 2:208599947-208599969 TCCAGGTTGCGCTGGGGCTGTGG - Intronic
946201476 2:218073155-218073177 TTGAGGTTGAGCTGGGGTGGGGG + Intronic
1170962430 20:21037346-21037368 TGCAGGTGGCGCTGAGGTGGAGG + Intergenic
1173294078 20:41740199-41740221 GGCAGGTTGGGGTAGGGTGGTGG + Intergenic
1173430138 20:42980583-42980605 TACAGGCTGCAGTAGGGTGGGGG - Intronic
1174042646 20:47710814-47710836 TGCAGGCAGCTCTACGGTGGAGG + Intronic
1175546881 20:59783957-59783979 TGCAGGCTCCGCAAGGGTGAAGG + Intronic
1176868453 21:14069807-14069829 AGCAGGCTGGGGTAGGGTGGAGG - Intergenic
1178078661 21:29037983-29038005 TGGAGCTTGCACTTGGGTGGAGG + Intronic
1179893826 21:44350659-44350681 TGCAGGGTGCGGTGGGGTGCAGG + Intronic
1182368289 22:29793203-29793225 TTCAGGGTGGGCTGGGGTGGAGG + Intronic
1182726562 22:32451546-32451568 GGCAGGTTGGGGTAGGGTGGAGG + Intronic
1183296460 22:37032643-37032665 TGCAGGTTGGACTAGGGTAGGGG - Intergenic
953532170 3:43748559-43748581 AGCAGCTTGTGGTAGGGTGGAGG + Intergenic
956127950 3:66028655-66028677 CGCAGGTTGTGGTAGTGTGGAGG - Intronic
957074452 3:75590647-75590669 TGCAGTTGGAGCTATGGTGGTGG - Intergenic
959359235 3:105367993-105368015 AGCAGGTTTCGCAAGGGGGGCGG - Intronic
961099739 3:124188355-124188377 TGAGGGGTGCGCAAGGGTGGTGG + Intronic
962917112 3:139914262-139914284 TTCAGTTTGACCTAGGGTGGGGG + Intergenic
962949921 3:140208919-140208941 TGAAGGTGGCGGTGGGGTGGAGG - Intronic
969477807 4:7431305-7431327 TGCAGGTAGCTCTGGGGTGGGGG + Intronic
970376842 4:15467353-15467375 TGCAGGTAGAGGTAGGATGGGGG + Intergenic
970464400 4:16308203-16308225 TTCAGTTTGCTCTATGGTGGTGG - Intergenic
972127524 4:35788313-35788335 TGCAGGTTGCACGGGGGCGGGGG + Intergenic
973544228 4:51964450-51964472 TGCAGTTCCAGCTAGGGTGGAGG - Intergenic
976874346 4:89836289-89836311 CGCGGGGTCCGCTAGGGTGGAGG - Intronic
977613571 4:99062199-99062221 TGAAGTTTGCACTATGGTGGAGG + Exonic
978373246 4:108050353-108050375 TGCAGGGTGCTCTAGATTGGAGG + Intronic
978373334 4:108050904-108050926 TGCAGGGTGCTCTAGATTGGAGG - Intronic
987091130 5:14508585-14508607 TGCAAGCTGCGCTGGGGTGGAGG + Exonic
992507790 5:77405406-77405428 TCCAGGTTTTGCTAGGTTGGGGG + Intronic
995271072 5:110220206-110220228 TTCAGGTAGGGCCAGGGTGGTGG + Intergenic
995425494 5:112017233-112017255 TGCAGTTTGATCTAGGCTGGCGG - Intergenic
998524676 5:142831657-142831679 TGCAGGTTGGGAGAGGGAGGAGG - Intronic
1001417410 5:171555695-171555717 TGGAGGTCGGGCTAGGCTGGGGG - Intergenic
1002784294 6:390400-390422 TGCAGGTTGACCTACGGTGGTGG + Intergenic
1003571527 6:7259386-7259408 TGCAGGTTGCAGCAGGGTGGAGG + Intergenic
1004690009 6:17985623-17985645 TGCAGTTTGCGGGGGGGTGGGGG + Intronic
1006581159 6:35078702-35078724 TGCAGGTGGTGCTAGGGAGGTGG - Intronic
1007819892 6:44553513-44553535 TGCAGGGTGGGCCAGGGTGAAGG + Intergenic
1010007338 6:71010387-71010409 TGCAGGATGAGCTGGGGTGCTGG + Intergenic
1016674775 6:146751128-146751150 GGCATGTTGCGGGAGGGTGGGGG - Intronic
1018690339 6:166339311-166339333 AGCAGGTTTCTCTAGGGAGGAGG - Intronic
1018989047 6:168659564-168659586 TGTAGGTTGAGTCAGGGTGGAGG + Intronic
1018989054 6:168659588-168659610 TGTAGGTTGGGTGAGGGTGGAGG + Intronic
1018989066 6:168659636-168659658 TGTAGGTTGGGTGAGGGTGGAGG + Intronic
1022693120 7:32677583-32677605 TGCAGATTGCCCTTGGGTAGGGG - Intergenic
1030143731 7:106331762-106331784 TGCAGGTTGCCCTGGGGGGAAGG + Intergenic
1031373936 7:121001588-121001610 AGTAGGTGGCGTTAGGGTGGTGG + Intronic
1032071335 7:128809229-128809251 AGCAGGTTGCTCTAGACTGGTGG - Intronic
1034585718 7:152090649-152090671 TGCAGGGTGGGGTGGGGTGGGGG - Intronic
1035770389 8:2142626-2142648 TGCAGGTTCTGCAAGGGAGGAGG - Intronic
1036379499 8:8227936-8227958 TGCAGGCTGCGCTCAGGAGGCGG - Intergenic
1036614017 8:10374393-10374415 TGCAGGATGTGCTAGGTTGGTGG - Intronic
1042444947 8:68872662-68872684 CGCAGGCTGCCCTAGGGTGTTGG - Intergenic
1043072320 8:75654033-75654055 TGCAGGTTGCTTTAGGGTAATGG + Intergenic
1043954407 8:86343428-86343450 TGGGGGTTGCGCTGGGGGGGCGG - Intronic
1047482879 8:125301463-125301485 TGGAGGTGGCGGTGGGGTGGTGG + Intronic
1049019847 8:139948598-139948620 TGGAGGTGGAGGTAGGGTGGGGG - Intronic
1056607295 9:88096732-88096754 AGGAGGTTGTGCTGGGGTGGAGG + Intergenic
1057987240 9:99729743-99729765 TGCAGGTTGGGTGGGGGTGGGGG - Intergenic
1058713141 9:107698381-107698403 TGCAGGCTGGGTCAGGGTGGAGG + Intergenic
1060496442 9:124122775-124122797 TGCAGGTTGGACTGGGCTGGAGG - Intergenic
1061135563 9:128731420-128731442 TGGAGGGTGGGCTTGGGTGGGGG + Intronic
1061651539 9:132054379-132054401 TGCAGGCTGCACAAGCGTGGCGG - Intronic
1062091565 9:134681156-134681178 TGCAGGGAGGGCTGGGGTGGGGG + Intronic
1062499352 9:136845630-136845652 TGCAGGGTGCGGTACGGTCGCGG - Exonic
1188007296 X:25024247-25024269 TGCAGGTTGTGTTGGGGGGGAGG - Intergenic
1189376284 X:40468593-40468615 TACAGGCTGAGCTGGGGTGGCGG + Intergenic
1189974071 X:46445090-46445112 TGCAGCTTGCGGGCGGGTGGAGG + Intergenic
1198363066 X:135914891-135914913 TGCACCTTGTGCAAGGGTGGCGG - Intergenic
1201567861 Y:15385353-15385375 TGCAGGCTGCCCCAGGCTGGTGG + Intergenic