ID: 1127433411

View in Genome Browser
Species Human (GRCh38)
Location 15:58933706-58933728
Sequence TGCTGCAGGTTGCGCTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433411_1127433416 2 Left 1127433411 15:58933706-58933728 CCACCCTAGCGCAACCTGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1127433416 15:58933731-58933753 AGCCGCCAGCACCCGGATGACGG 0: 1
1: 0
2: 0
3: 5
4: 75
1127433411_1127433423 25 Left 1127433411 15:58933706-58933728 CCACCCTAGCGCAACCTGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433411_1127433415 -5 Left 1127433411 15:58933706-58933728 CCACCCTAGCGCAACCTGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1127433415 15:58933724-58933746 CAGCAGCAGCCGCCAGCACCCGG 0: 1
1: 0
2: 5
3: 41
4: 477
1127433411_1127433421 19 Left 1127433411 15:58933706-58933728 CCACCCTAGCGCAACCTGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1127433421 15:58933748-58933770 TGACGGCCGCGCGTGCGCGTTGG 0: 1
1: 0
2: 1
3: 2
4: 33
1127433411_1127433424 26 Left 1127433411 15:58933706-58933728 CCACCCTAGCGCAACCTGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1127433424 15:58933755-58933777 CGCGCGTGCGCGTTGGCGCAGGG 0: 1
1: 0
2: 2
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433411 Original CRISPR TGCTGCAGGTTGCGCTAGGG TGG (reversed) Intronic
900969249 1:5980370-5980392 TGCAGCAGGCTGGGCCAGGGAGG + Intronic
905106501 1:35566224-35566246 TGCCCCAGGTTGCCCTAGGATGG - Exonic
910458958 1:87427461-87427483 TGCTGGAGGTAGCGGCAGGGCGG + Intergenic
915841313 1:159215739-159215761 TGCTGGAGGTAGTGGTAGGGTGG - Intergenic
917122376 1:171655683-171655705 GGCAGCAGGGGGCGCTAGGGAGG + Intergenic
920048643 1:203150155-203150177 TGCTGCATGTTGTTCTGGGGAGG + Intronic
921177769 1:212608810-212608832 GGCTGAAGGGTGCGCTCGGGCGG - Exonic
923055930 1:230426016-230426038 TGCTGCGGGCTGCGCTGGTGGGG - Intergenic
1066463451 10:35632951-35632973 TGCTGCAGGCTGTGCCCGGGAGG - Intergenic
1066622577 10:37374141-37374163 TGCTGTAGCTTGCAGTAGGGAGG - Intronic
1067130572 10:43560706-43560728 TTCTGCTGATTGGGCTAGGGAGG - Intronic
1072903059 10:99426603-99426625 TGCTACAGGTTGCACCAGGTTGG + Intronic
1075324090 10:121516782-121516804 TGCTGCATGTTGCGATAGGATGG - Intronic
1076081086 10:127581051-127581073 TGCTGCAGGGTGTGTTGGGGTGG - Intergenic
1076882727 10:133247499-133247521 TGGTGCAGGTGCCGCTGGGGAGG + Intergenic
1077533581 11:3108377-3108399 TTCTGCAGGTGGAGTTAGGGAGG + Intronic
1082767485 11:57180931-57180953 GGCTGCAGGTTGGGTCAGGGAGG + Intergenic
1083485716 11:62981884-62981906 AGCTGCAGGTGGCGCCAGTGGGG + Exonic
1084587627 11:70072280-70072302 GGCTGCAGGTTTCTCTTGGGGGG - Intergenic
1090841353 11:130490225-130490247 TGCTGCAGGATGAGCTGTGGGGG + Intergenic
1091302694 11:134517570-134517592 TGCTGTAGGTTGTGTTGGGGCGG + Intergenic
1096706563 12:53425611-53425633 TCCTGGAGGTTGTGCTGGGGAGG + Intronic
1100358443 12:93854235-93854257 TGAGGCAGGATGCTCTAGGGCGG + Intronic
1100403170 12:94249973-94249995 TGCTGCAGGTTTTGCAACGGTGG + Intronic
1103007934 12:117436618-117436640 TGTTCCAGGTTGAGCTAGGGTGG - Intronic
1103937332 12:124483527-124483549 TGCTGCTGGTTGGGCTGGGTGGG - Intronic
1104307993 12:127627180-127627202 TGCTGGAGGTTGCTTCAGGGTGG + Intergenic
1107064425 13:36197327-36197349 TGCTGCAGGTTGAGCGATGCTGG - Intronic
1111537517 13:89622994-89623016 TGCTGGAGGTTGGGCTGGGTGGG - Intergenic
1118182458 14:63507129-63507151 TGCTGCAGGGGGCACAAGGGAGG + Intronic
1121788225 14:96679191-96679213 TGCTGCAGCTTGCAATGGGGAGG + Intergenic
1127433411 15:58933706-58933728 TGCTGCAGGTTGCGCTAGGGTGG - Intronic
1133609620 16:7421109-7421131 TGCTACAGGTTGGGCCAAGGTGG + Intronic
1135758695 16:25118867-25118889 TGCTGCAGGTCACTCGAGGGAGG + Intronic
1136417352 16:30112279-30112301 TGCTGCAGGCAGGGCTAGGGCGG - Intronic
1137740999 16:50773975-50773997 TTCTGCAGGTGACACTAGGGAGG - Intronic
1141429586 16:83964824-83964846 TGGTGTAGGATGCTCTAGGGTGG - Intronic
1141798946 16:86294374-86294396 TGCTGCTGGGTGGGGTAGGGTGG + Intergenic
1144828694 17:18120409-18120431 CGCTGGAGGTTGCGCTGGCGCGG - Exonic
1146535542 17:33647502-33647524 TGCTGTAGCTTGCAGTAGGGAGG + Intronic
1146890399 17:36502882-36502904 TGCTGTGGGTGGTGCTAGGGAGG - Intronic
1150608358 17:66713449-66713471 TGCTGCAGGTGGGAGTAGGGTGG - Intronic
1152401604 17:80069933-80069955 TGCTGGAGCCTGCCCTAGGGAGG + Intronic
1159886037 18:73908281-73908303 TGCTGCAGTTTGAGCTTAGGTGG - Intergenic
1160083884 18:75756239-75756261 TGCTCCAGGTTGGGCGAGAGAGG - Intergenic
1160732504 19:647701-647723 TGCTGCAGGTGCCGCCAGGACGG - Exonic
1165906452 19:39197280-39197302 CGCAGCAGGTTGCGGTAGAGCGG - Exonic
1166547141 19:43640210-43640232 TGCTGGAGGCTGTGCGAGGGTGG + Intergenic
927421380 2:22934992-22935014 TACTGGAGGTTGCTCTTGGGTGG - Intergenic
934035470 2:88085365-88085387 TCCTGGAGGTTCCGCTGGGGTGG + Intronic
942492016 2:176498874-176498896 TCCTGCAGGTTGCTCAAGGAAGG - Intergenic
948386563 2:237584359-237584381 TCCTGCAGGCTCTGCTAGGGTGG + Intronic
1177010852 21:15729722-15729744 TGCGGCAGGTTGCGCGACGCTGG - Intergenic
1180844147 22:18972356-18972378 TGCTGCATGATGGGCAAGGGTGG + Intergenic
1181057324 22:20266355-20266377 TGCTGCATGATGGGCAAGGGTGG - Intronic
1182726561 22:32451543-32451565 TGGGGCAGGTTGGGGTAGGGTGG + Intronic
949657536 3:6238193-6238215 TGCTGGACGTTGCTCTAGTGGGG - Intergenic
950095143 3:10324660-10324682 TCCTGCAGGTAGCGCAAGAGTGG + Exonic
952609349 3:35188709-35188731 TTCTGCAGTTTGCTCTAGGATGG + Intergenic
959920041 3:111859678-111859700 TGCCGCCGGTTGCGCTGCGGAGG + Intronic
966929913 3:184669637-184669659 TGCTGCTGGTCGCCTTAGGGAGG + Intronic
973632535 4:52832953-52832975 GGCTGCAGGCTGCCCTAGCGTGG - Intergenic
974288434 4:59899003-59899025 TGCTGCAGGTTGTGTGTGGGTGG + Intergenic
986068510 5:4259455-4259477 TGCTGCAGCTTGGGCTCTGGAGG - Intergenic
986202005 5:5587529-5587551 TGCTGTAGCTTGGGCTGGGGTGG + Intergenic
986723168 5:10575022-10575044 GGCTGCAGGATGAGCTAGGATGG + Intronic
987091129 5:14508582-14508604 AGCTGCAAGCTGCGCTGGGGTGG + Exonic
987213225 5:15706174-15706196 TGCTGCAGGTGGGGCCTGGGGGG + Intronic
996535052 5:124569141-124569163 TGATGGAGGTTGGGCAAGGGAGG + Intergenic
997339254 5:133129905-133129927 TGCTGAAGGTTTCCTTAGGGGGG + Intergenic
997472106 5:134122849-134122871 TGCTGCAGGTGGGGACAGGGAGG + Intronic
998524677 5:142831660-142831682 GGCTGCAGGTTGGGAGAGGGAGG - Intronic
1001299267 5:170522273-170522295 TGCTGCAGGCTGTCCTCGGGAGG - Intronic
1001565686 5:172697780-172697802 TTCTGCAGGATGCGCTCGGGGGG - Intergenic
1001999947 5:176191910-176191932 TGATGCAGGGTGGGCGAGGGTGG - Intergenic
1003571526 6:7259383-7259405 TTCTGCAGGTTGCAGCAGGGTGG + Intergenic
1006400520 6:33814656-33814678 TGCTGGAGGGAGCGGTAGGGAGG - Intergenic
1006581160 6:35078705-35078727 TGGTGCAGGTGGTGCTAGGGAGG - Intronic
1012398775 6:98827863-98827885 TGCTGCTGGTTGCTATAGCGAGG - Intergenic
1021425635 7:20496244-20496266 TGCAGCAGGTAGCGGTAGGGTGG - Intergenic
1021958765 7:25852453-25852475 TGCTCCGGGTTTCGCGAGGGCGG + Intergenic
1023376347 7:39559656-39559678 TGCTGCAAATTGCTCTTGGGTGG + Intergenic
1025003353 7:55336795-55336817 TGCTGCAGGTCTTGCGAGGGGGG - Intergenic
1026929706 7:74217044-74217066 TGCTGTAGCTTGGGTTAGGGAGG + Intronic
1028770616 7:94616144-94616166 TGCTGCAGGTTGGGCTCATGGGG + Intronic
1035353555 7:158263877-158263899 GGGTGCAGGGTGTGCTAGGGAGG - Intronic
1035770390 8:2142629-2142651 GGCTGCAGGTTCTGCAAGGGAGG - Intronic
1036379500 8:8227939-8227961 GGCTGCAGGCTGCGCTCAGGAGG - Intergenic
1045051973 8:98335705-98335727 TGCCGCACGTTCCCCTAGGGAGG - Intergenic
1048032529 8:130646178-130646200 TGATGCAGGTTGGGCAAGTGTGG - Intergenic
1049476857 8:142800956-142800978 TGCTGCAGGTTCCTTTTGGGAGG + Intergenic
1053117867 9:35521251-35521273 TGCTACAAGTTGAGCTAAGGAGG + Intronic
1058149376 9:101447160-101447182 TGCTGAAGGTGGGGCTAGGTGGG - Intergenic
1060594603 9:124840594-124840616 TGCTCCAGGCTGCCCGAGGGGGG + Intergenic
1062151901 9:135023980-135024002 TGCTGCAGGCTGCACGGGGGCGG + Intergenic
1195756763 X:108206275-108206297 TACTTTAGGTTGAGCTAGGGTGG + Intronic