ID: 1127433412

View in Genome Browser
Species Human (GRCh38)
Location 15:58933709-58933731
Sequence TGCTGCTGCAGGTTGCGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433412_1127433421 16 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433421 15:58933748-58933770 TGACGGCCGCGCGTGCGCGTTGG 0: 1
1: 0
2: 1
3: 2
4: 33
1127433412_1127433416 -1 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433416 15:58933731-58933753 AGCCGCCAGCACCCGGATGACGG 0: 1
1: 0
2: 0
3: 5
4: 75
1127433412_1127433423 22 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433412_1127433424 23 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433424 15:58933755-58933777 CGCGCGTGCGCGTTGGCGCAGGG 0: 1
1: 0
2: 2
3: 4
4: 37
1127433412_1127433425 28 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433425 15:58933760-58933782 GTGCGCGTTGGCGCAGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 82
1127433412_1127433415 -8 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433415 15:58933724-58933746 CAGCAGCAGCCGCCAGCACCCGG 0: 1
1: 0
2: 5
3: 41
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433412 Original CRISPR TGCTGCTGCAGGTTGCGCTA GGG (reversed) Intronic
900580142 1:3404728-3404750 TGCTGCTCCAGGCTGCGCAGAGG - Exonic
901012582 1:6209949-6209971 TGCTGCTGCAGGCTGTGCAGAGG + Exonic
901883147 1:12205569-12205591 TGCTGCTGCATGGTGGGCTATGG - Intronic
902556442 1:17249529-17249551 GGATGCTGCAGGTTGGGCTGAGG + Intronic
903026901 1:20435801-20435823 TGCTGCTGCAGGTGGTGCCTGGG - Intergenic
908206301 1:61853429-61853451 TGCTGTTGCAGTTTTCTCTAAGG + Intronic
909150896 1:72003316-72003338 TGCTGCTTCAGCTTGAGCTTAGG - Intronic
914995072 1:152536310-152536332 TGCTGCTGATGGTGGCCCTAAGG - Intronic
915441976 1:155951075-155951097 CGCTGCTGCAGGAGGAGCTACGG - Exonic
920715798 1:208338743-208338765 TGCTGCTGCAGGTGGCCTCAAGG + Intergenic
1063620869 10:7647433-7647455 TGTTGCTGGAGGTTGCTCTGGGG - Intronic
1069088592 10:64171868-64171890 GACTGCTGCAAGTTGCGCTTTGG + Intergenic
1070961913 10:80505365-80505387 TGCTGCTGCTTGTTGCCCTGTGG + Intronic
1072537062 10:96371766-96371788 TTCTGCTGCAGGTTCAGCCATGG + Intronic
1076401106 10:130186005-130186027 GGCTTCTGCAGTTTGCTCTAAGG + Intergenic
1076875535 10:133213883-133213905 TGCTGGTGCAGGGTGGGCTGGGG - Intronic
1078319636 11:10322635-10322657 AGCTGCTGCAGCTTGGGCTCAGG - Intronic
1078433246 11:11303592-11303614 TGCTGACTGAGGTTGCGCTAGGG - Intronic
1078745424 11:14109303-14109325 AGCTGCTTCAGGTTTCCCTAGGG + Intronic
1079143223 11:17828056-17828078 TGCAGCTGCAAGTTCCACTAGGG + Intronic
1080880260 11:36313161-36313183 TGCTGCTGAAGGTGGCGGTGAGG - Intronic
1080997230 11:37618977-37618999 TGCTGCTCCAGCTTTAGCTATGG + Intergenic
1082651400 11:55798511-55798533 TGATGCTGCAGGTTCCTCTCTGG - Intergenic
1083602191 11:63955622-63955644 TTCTGCTGCAGCCTGAGCTATGG - Exonic
1083769592 11:64859068-64859090 TGCTGCGGGAGCTGGCGCTAGGG - Intronic
1088372457 11:109106654-109106676 TGCTGTTGCAGGTGGCGGTGTGG + Intergenic
1089422608 11:118342964-118342986 AGCTGCTACGGCTTGCGCTATGG - Intergenic
1091716797 12:2783468-2783490 TGATGCTACAGGGTGCGCTCAGG - Intergenic
1102307127 12:111813646-111813668 TGCTGATGCATGTTGCGATGTGG + Intergenic
1104133928 12:125919636-125919658 GGCTGCTGGGGGTTGCTCTATGG + Intergenic
1104841624 12:131828568-131828590 TGCTGCTGCTGCTGGCGCTGGGG + Exonic
1106499327 13:30311992-30312014 TGCTGCTGCAGGTAATGCTTTGG - Intergenic
1107472852 13:40706612-40706634 TGCTGCTGCTGGCTGTGCTGAGG + Intergenic
1109212250 13:59547984-59548006 TGCTGCTGCACCTTGCACTTGGG + Intergenic
1111965756 13:94859724-94859746 TCCTGCTGCAGGCTGTGCTGAGG - Intergenic
1119808623 14:77498716-77498738 CGCTGCTGGAGGCGGCGCTAGGG - Exonic
1122975266 14:105168361-105168383 TGCTGCTGCTGCTGGCGCTCTGG - Exonic
1123099670 14:105788194-105788216 TGCTGCTCCAGGTTCAGCCAAGG + Intergenic
1123922879 15:25082905-25082927 TGTTGCTGCAGGTTGCACCAAGG + Intergenic
1127433412 15:58933709-58933731 TGCTGCTGCAGGTTGCGCTAGGG - Intronic
1136417353 16:30112282-30112304 TGGTGCTGCAGGCAGGGCTAGGG - Intronic
1138555593 16:57769610-57769632 TGCTGCTGCAGGAGGCCCTCAGG - Exonic
1140479389 16:75254214-75254236 TCCTGCTGCAGGGTGGGCTGAGG - Intronic
1142740708 17:1930392-1930414 TGCTGCTGCAAGATGTGCTTGGG - Intergenic
1142967895 17:3592372-3592394 GGCTGCTGCAGGTTGCACACTGG - Exonic
1143369257 17:6428306-6428328 AGCTGCTGCAGGTGGGGCTGGGG - Exonic
1143386491 17:6534227-6534249 AGATGCTGCAGGGTGGGCTATGG - Intronic
1155420202 18:25647684-25647706 TGCTGCTGCAGTTTGTCTTAAGG + Intergenic
1156033486 18:32740834-32740856 TGCTACTGCAGGTTTCACTGGGG + Intronic
1159188364 18:65008923-65008945 TGCTGCTGAGGGTTCAGCTATGG + Intergenic
1160496539 18:79379302-79379324 TGCCGCAGCAGTTTGCGTTAGGG + Intergenic
1168098665 19:54129266-54129288 TGCTTCTGCAGGGTCCGCTGTGG - Exonic
1168141362 19:54389651-54389673 TGCTTCTGGAGGTTGCCCTGTGG - Intergenic
925325684 2:3020219-3020241 TGCTGCCCGAGGTTGGGCTATGG - Intergenic
927216686 2:20671411-20671433 TGCGGCTGCAGGTAGCGCGAGGG + Exonic
927421381 2:22934995-22935017 TGCTACTGGAGGTTGCTCTTGGG - Intergenic
929946830 2:46378051-46378073 TGCTGCTGCTGGTGGCACTGGGG - Exonic
930807207 2:55503004-55503026 TGCTGCTGGAGGTTACGGTGTGG - Intergenic
939467664 2:142579682-142579704 CTCTGCTGCAGCTTGCACTATGG + Intergenic
942773244 2:179548364-179548386 TGCTGGTGCAGGTAGCTCTCTGG + Intronic
947720092 2:232365002-232365024 TGATGCTGCAGGTAGCGATGGGG - Intergenic
948886723 2:240888494-240888516 CCCTGCAGCAGGTTGCGCTGCGG + Exonic
1168963894 20:1887299-1887321 TGCTGCTGCAGCTTCCGATTGGG - Intergenic
1169342610 20:4807974-4807996 TGCTGCTGCTGTTTGCCTTAAGG - Intronic
1178254385 21:31038331-31038353 AGCTTCCGCAGGTTGGGCTATGG - Exonic
1178487343 21:33027464-33027486 TGCTGCTGCCGGGTGCGCGGTGG - Exonic
1178859493 21:36277022-36277044 TGCTGCTGCAGCTTCAGCAATGG + Exonic
1179391072 21:40991835-40991857 TGCTGCAACAAGTTGAGCTAAGG - Intergenic
1181359371 22:22323073-22323095 TGCTGCTGCAGGTTCTCCCATGG + Intergenic
1181360144 22:22327921-22327943 TGCTGCTGCAGCTTCCCCCATGG + Intergenic
1181372990 22:22432569-22432591 TGCTGCTGCAGCTTCCCCCATGG + Intergenic
1183484155 22:38080499-38080521 TGGGGCTGCAACTTGCGCTAAGG + Intronic
950284840 3:11736630-11736652 TGCTGAAGCAGGGTGCGCTGAGG - Intergenic
950460612 3:13120154-13120176 TGCTGCTGCAGACTGCGTTCTGG - Intergenic
952055113 3:29434784-29434806 TGCTGCTGCTGTTTGTGCTGGGG - Exonic
953090568 3:39721789-39721811 TGCTGCTGCGGTTTGAGGTATGG + Intergenic
953879748 3:46685513-46685535 TCCTGCTGCAGGTTGGGGTGGGG - Exonic
960592902 3:119382322-119382344 TGCTGCTGAAGGAGGCGATATGG - Exonic
962318424 3:134372997-134373019 TCCTGCTTCAGTTTGGGCTATGG + Intronic
962361792 3:134749080-134749102 AGGTCCTGCAGGTTGAGCTAAGG + Intronic
965603598 3:170478512-170478534 TGCTTCTGAAGGCTGCTCTATGG - Intronic
969608481 4:8214086-8214108 TGATGCTGCAGGTGGGGCTGGGG + Intronic
970001666 4:11371263-11371285 TGCTGCTGCAGGTGATCCTAAGG + Intergenic
970664646 4:18322600-18322622 TGCTTCTGCATGTTGCTCTATGG + Intergenic
974708702 4:65558979-65559001 TGCTGCTGGAGTTTGGGATAAGG - Intronic
983739663 4:171113713-171113735 TGCTCCTGCAGGGTGGCCTAGGG - Intergenic
989199252 5:38747341-38747363 TGCTGCTTGAGGCTGGGCTAGGG - Intergenic
996790741 5:127290641-127290663 AGATCCTGCATGTTGCGCTAGGG + Intergenic
997450296 5:133977162-133977184 GGCTGCAGCAGGTTGTGCCAAGG - Intronic
998149830 5:139750616-139750638 TCCTCCTGGAGGTTGCCCTAGGG + Intergenic
1001565689 5:172697783-172697805 GGCTTCTGCAGGATGCGCTCGGG - Intergenic
1001940674 5:175737382-175737404 TGCTGCTGAAGGGTGCCCGACGG + Intergenic
1007009999 6:38407506-38407528 GGCTGCTGCAGGTTGCACACAGG - Intronic
1018156872 6:160992725-160992747 TGCTACTGCAGGAAGCTCTAAGG + Intronic
1026504403 7:70969954-70969976 AGCTGCTGCTGGTTCCGCCATGG - Intergenic
1031918255 7:127582998-127583020 GGCTGCTGCAGGTTGCGGCCAGG - Exonic
1035274263 7:157737912-157737934 TGCTGCTGCAGGTCTGGCCAAGG - Intronic
1036167454 8:6449695-6449717 TGCTGCTGTAGTTTGGGCTCAGG + Intronic
1048969951 8:139639888-139639910 TGCCTCTGCAAGATGCGCTAAGG + Intronic
1052778316 9:32755299-32755321 TGCTGCTGCTGGGTGTGCTGAGG + Intergenic
1052820571 9:33135268-33135290 TGCTCCTGCCGGTTGCGGAATGG + Exonic
1056814155 9:89789586-89789608 TGCTTCTGCAGGCTGGGCTTGGG + Intergenic
1060088417 9:120721768-120721790 TGATGGTGCAGATTGCGCTGTGG + Intergenic
1060547430 9:124469507-124469529 TGCTGCTGCAGGCAGGGCTGTGG - Exonic
1187023295 X:15406797-15406819 TTCTGCTGCTGGGTTCGCTAAGG + Intronic
1189870927 X:45381931-45381953 TGCTGCTGCAGCTGGTGCTGGGG - Intergenic
1191768745 X:64732582-64732604 AGCTGCTGCAGGGTGTGCTGGGG + Intergenic
1192078960 X:68029480-68029502 TGCTGCTGAAGGTGGAGCAAAGG + Intergenic
1199864133 X:151827750-151827772 TGCTGCTGCTGATTGAGCTAAGG + Intergenic
1200301330 X:154979632-154979654 TGCTGCTGCAGGCTGCTGTGGGG - Intronic