ID: 1127433413

View in Genome Browser
Species Human (GRCh38)
Location 15:58933710-58933732
Sequence CTGCTGCTGCAGGTTGCGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433413_1127433424 22 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433424 15:58933755-58933777 CGCGCGTGCGCGTTGGCGCAGGG 0: 1
1: 0
2: 2
3: 4
4: 37
1127433413_1127433415 -9 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433415 15:58933724-58933746 CAGCAGCAGCCGCCAGCACCCGG 0: 1
1: 0
2: 5
3: 41
4: 477
1127433413_1127433421 15 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433421 15:58933748-58933770 TGACGGCCGCGCGTGCGCGTTGG 0: 1
1: 0
2: 1
3: 2
4: 33
1127433413_1127433416 -2 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433416 15:58933731-58933753 AGCCGCCAGCACCCGGATGACGG 0: 1
1: 0
2: 0
3: 5
4: 75
1127433413_1127433425 27 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433425 15:58933760-58933782 GTGCGCGTTGGCGCAGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 82
1127433413_1127433423 21 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433413 Original CRISPR CTGCTGCTGCAGGTTGCGCT AGG (reversed) Intronic
900243385 1:1627139-1627161 CTGGTGGTGGAGGTGGCGCTGGG + Exonic
900364636 1:2306075-2306097 CTCCTTCCGCAGGTTACGCTTGG - Exonic
900504878 1:3024964-3024986 CTGCTGCTGCTGGGGGCGGTGGG + Intergenic
900642169 1:3692915-3692937 CTGCTGCTGCCCGGTGCCCTGGG + Intronic
901162757 1:7192598-7192620 CTGCTCCTGCAGGTGGCACTCGG - Intronic
901241527 1:7696913-7696935 TTGCTGGTGCAGGCTGGGCTGGG + Intronic
901628064 1:10634830-10634852 CTGCAGCTGCGGGTTGGGATGGG - Intergenic
902582523 1:17417303-17417325 CTGCTGCTGCAGGTGGCTGCAGG - Intronic
903026902 1:20435802-20435824 TTGCTGCTGCAGGTGGTGCCTGG - Intergenic
903597060 1:24502952-24502974 CTGCTGCTGCAGGCGGCTCCCGG + Exonic
906097495 1:43234234-43234256 CTGGTGCTGTAGGGTGCTCTCGG - Intronic
906527896 1:46507066-46507088 CTGCTGGTGCAGGTTGTACATGG - Exonic
907867682 1:58414277-58414299 CTGCTTCTGCAGGATGAGTTAGG - Intronic
912430655 1:109626829-109626851 CAGCTGCTGCAGGTAGCGGCGGG - Exonic
914932912 1:151950515-151950537 CTGCTGCTGGAGGCTCCACTTGG + Intergenic
915264655 1:154708111-154708133 CTGCTGCTGCTGCTGGCGCAGGG + Exonic
917845534 1:179017056-179017078 CTGCTGCTGCATGCTGGGCCTGG - Intergenic
920224035 1:204424999-204425021 CCGCTGCTGCAGGTCACCCTTGG + Exonic
921603706 1:217134121-217134143 CTGCTGCTGCAATGTGAGCTCGG + Intronic
923461797 1:234214836-234214858 CAGCTGCTGCCAGATGCGCTGGG - Intronic
1063620870 10:7647434-7647456 GTGTTGCTGGAGGTTGCTCTGGG - Intronic
1067726838 10:48776906-48776928 CTGAGGCTGCAGGTTGCGTGGGG - Exonic
1068945548 10:62725333-62725355 CAGCTGGTGCAGGTTCCTCTGGG - Intergenic
1069562051 10:69437526-69437548 CTTCTGCTGCAGGCTGTGCGTGG - Intergenic
1069880362 10:71588923-71588945 CCCCTGCTGCAGGCTGCACTTGG + Intronic
1071770876 10:88727890-88727912 CTGCTGCTGCAGGCTCCACATGG - Intronic
1072242443 10:93509423-93509445 CTGCTGCTGCTGCTGGCCCTTGG + Intronic
1073461579 10:103668664-103668686 CTCCTGCTGCCGCTTGCTCTCGG - Intronic
1074815513 10:117138863-117138885 CTTCTGCCGCAGGGTGCGCAGGG - Intergenic
1075689302 10:124384931-124384953 CTGCTGCTGGAGGGAGCCCTGGG - Intergenic
1076875536 10:133213884-133213906 CTGCTGGTGCAGGGTGGGCTGGG - Intronic
1076900893 10:133336849-133336871 CAGCTGCTGCAGGACGCGGTCGG + Exonic
1076934036 10:133555632-133555654 CTGCAGCTGCTGGTGGCGCTGGG + Exonic
1077046591 11:549422-549444 CAGCTGCTGGAGGTGGCGGTGGG - Intronic
1077383274 11:2257353-2257375 CTGCTGGCCCAGGTTTCGCTGGG + Intergenic
1077556422 11:3228183-3228205 CTGCTGCTGCGGGTGGAGCGAGG - Exonic
1078433247 11:11303593-11303615 CTGCTGACTGAGGTTGCGCTAGG - Intronic
1078745423 11:14109302-14109324 CAGCTGCTTCAGGTTTCCCTAGG + Intronic
1079143222 11:17828055-17828077 CTGCAGCTGCAAGTTCCACTAGG + Intronic
1081493364 11:43583398-43583420 CTGCTGCTGCAGCTGCTGCTTGG + Intronic
1081596360 11:44462246-44462268 CTGCTGCTGCAGCTTCCTCTAGG + Intergenic
1081807090 11:45896630-45896652 CTGCAGCTGAGGGCTGCGCTGGG + Intronic
1083233092 11:61335488-61335510 GTGCTGCTGGAGGCTGGGCTTGG + Intronic
1083255309 11:61491808-61491830 CTGCTGCTCAAGGCTGTGCTGGG - Intergenic
1083418787 11:62542201-62542223 CTGGGGCTGCAGGCTGCCCTGGG - Intronic
1083769593 11:64859069-64859091 CTGCTGCGGGAGCTGGCGCTAGG - Intronic
1083885518 11:65571703-65571725 TAGCTGCTGCAGGCTGCGCAGGG - Exonic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1084547054 11:69819718-69819740 CTGCTCCTGCAGGAAGCGCCGGG - Intergenic
1084676494 11:70638417-70638439 CTGGGGCTGCAGGATGTGCTCGG + Intronic
1089292016 11:117443246-117443268 CGGCTGCTACAGCTTGCCCTTGG + Intronic
1089494676 11:118902165-118902187 CTCCTCCTGCAGCTTGCGCCAGG + Exonic
1089526011 11:119097131-119097153 CTGCTGCTGCAGGTGAGGATGGG - Exonic
1090610932 11:128469648-128469670 GTGCAGCTTCAGGTTGAGCTTGG - Intronic
1093465036 12:19440123-19440145 CTGCTGCTGCTGGCGGCGCCGGG - Exonic
1093710235 12:22321423-22321445 CTGCTGCTTCAGTTTGGGCAGGG - Intronic
1093895499 12:24570466-24570488 CTGCTGCTGCAGGTCATGCCAGG + Intergenic
1094129774 12:27062671-27062693 CTGATCCTACAGGTTGCCCTGGG - Intronic
1096609901 12:52794272-52794294 CTGCTGGAGCAGGTTCCACTTGG + Exonic
1097909024 12:64949285-64949307 CTGCTGCTGCTGCTTCCTCTTGG + Intergenic
1098496196 12:71138184-71138206 CTGCTCCTGCAGGTGGCGACAGG - Exonic
1102210812 12:111125691-111125713 GTGCTGCTGCAGATTCCGCATGG + Intronic
1103170888 12:118818849-118818871 CTGCTGTTGCATGTTGCTCAAGG - Intergenic
1103703705 12:122860516-122860538 CAGCTGGTGTAGGTTGCCCTGGG + Exonic
1103937334 12:124483531-124483553 GTTCTGCTGCTGGTTGGGCTGGG - Intronic
1104841623 12:131828567-131828589 CTGCTGCTGCTGCTGGCGCTGGG + Exonic
1106125989 13:26900395-26900417 CAGCTGCTGCATGTTGCTCTGGG + Intergenic
1106759831 13:32857761-32857783 ATCCTGCTGCAGCTTGCTCTTGG + Intergenic
1107835624 13:44410504-44410526 CTGCACCTGCAGGGTGCGCTAGG - Intergenic
1107851031 13:44573950-44573972 ATGCCCCTGCAGGTTGTGCTGGG + Exonic
1107962505 13:45570964-45570986 CTGCAGCTGCAGGTTCCGTGTGG + Intronic
1108596256 13:51952245-51952267 CTGCTGCTGAAGCTGGCCCTGGG - Intronic
1109212249 13:59547983-59548005 TTGCTGCTGCACCTTGCACTTGG + Intergenic
1109956903 13:69580657-69580679 CAGCAGCTGCAGGATGTGCTGGG + Intergenic
1110298410 13:73897329-73897351 CTGTAGATGCATGTTGCGCTTGG - Intronic
1111000000 13:82165833-82165855 CTGCAGCTGCAAGATGCCCTGGG + Intergenic
1113492863 13:110706035-110706057 CCGCTGCTCCAGGCCGCGCTGGG - Exonic
1114493065 14:23115206-23115228 CAGCTGCTGCACGTCACGCTGGG + Intergenic
1116857219 14:49963412-49963434 CTGCTGCAGCAGGGTCTGCTTGG + Intergenic
1118285257 14:64465348-64465370 CTGCTGCTGCAGGTGGGTCCCGG + Intronic
1118849466 14:69573054-69573076 CTGCTGCTGCTGCCCGCGCTCGG + Exonic
1119973612 14:79000695-79000717 CTGCTGGTGGAGGTTGCGGGAGG + Intronic
1121969618 14:98344293-98344315 CTGCTGCAGCAGGTCTGGCTGGG - Intergenic
1122204261 14:100140787-100140809 CTCATGCTCCAGGTTGAGCTTGG - Intronic
1122282891 14:100634654-100634676 CTGCTGCTACAGGTGGGCCTTGG - Intergenic
1122772697 14:104104374-104104396 CTCCTGCAGCAGGTCGGGCTTGG - Exonic
1124671793 15:31647408-31647430 CTTCTGCTGCAGCTTGTGTTTGG - Intronic
1125421584 15:39510110-39510132 CAGCAGCTGCAGGAAGCGCTGGG + Intergenic
1126007099 15:44268402-44268424 CTGCTGCTGCTTGTTGCACTAGG + Intergenic
1127433413 15:58933710-58933732 CTGCTGCTGCAGGTTGCGCTAGG - Intronic
1129153700 15:73704433-73704455 GTGCTGCAGCAGGATGCGCACGG + Exonic
1130115768 15:81002806-81002828 CTGCTGCTGGAGGTGTCGCAGGG + Exonic
1130297434 15:82657056-82657078 CTGCTGGTGAAGGCTGGGCTGGG - Intergenic
1131009335 15:89004259-89004281 CTTCTGCTGCAGGGTGCAATGGG + Intergenic
1131168697 15:90161332-90161354 CTGCTGGATCAGGTTGCTCTTGG + Intronic
1132381547 15:101369874-101369896 CTGCTGGTGCAGGTTCTGCAGGG + Intronic
1132669833 16:1098046-1098068 CGGCTGCTGCCGGGTGCCCTGGG + Intergenic
1132893103 16:2214205-2214227 GGGCTGCTGCAGGTAGCGCAGGG + Exonic
1133930515 16:10228501-10228523 CTGATTCTGCAGGATGCTCTGGG - Intergenic
1138175355 16:54893109-54893131 CTGCTGCTGCAGCTGGAGATGGG - Intergenic
1139294052 16:65884618-65884640 CTGGTCCTGCAGGGTGCCCTGGG + Intergenic
1139347967 16:66316659-66316681 CTGCTGCTGCAGATTGAGGGAGG + Intergenic
1142106063 16:88303466-88303488 GTGCTGCTGCAGGCTGTGGTGGG - Intergenic
1142374154 16:89698148-89698170 CAGCTGGTGCAGGTGGCCCTGGG - Exonic
1142625780 17:1191011-1191033 CTGCGGCTGCAGATTGCGCTGGG + Intronic
1142740709 17:1930393-1930415 TTGCTGCTGCAAGATGTGCTTGG - Intergenic
1142807627 17:2379804-2379826 CTGCGGCTGCAGGTGGCAGTGGG - Exonic
1143369258 17:6428307-6428329 GAGCTGCTGCAGGTGGGGCTGGG - Exonic
1143501571 17:7342432-7342454 CTGCTGCTGCAGTGTGTGTTGGG - Exonic
1143521156 17:7445146-7445168 CTGATGCTGCTGGGGGCGCTGGG + Exonic
1143631606 17:8143323-8143345 CTGCTGTTGCAGGAGGCCCTGGG - Exonic
1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG + Intergenic
1144838949 17:18173890-18173912 CTGCAGCTGCAAGGTGCGCTGGG - Exonic
1144842889 17:18199243-18199265 ATGCTGCGGCAGCTTGCCCTCGG - Intronic
1147372136 17:39999740-39999762 GTGCTGCTCCAGGTTGGGCACGG + Intergenic
1147859918 17:43513201-43513223 CTGCTGTTGGAGGCTGAGCTGGG + Intronic
1150344163 17:64391250-64391272 CTGCTGGGGCAGGCTGAGCTTGG + Intronic
1152639540 17:81443907-81443929 CTGCTGCTGCAGTGAGAGCTGGG + Exonic
1152729567 17:81962788-81962810 CTGCGGGTGCAGGCGGCGCTGGG - Intergenic
1156033485 18:32740833-32740855 ATGCTACTGCAGGTTTCACTGGG + Intronic
1157556480 18:48616082-48616104 CTGCTGCTGCAGGCAGAGCCTGG + Intronic
1157763999 18:50284059-50284081 CTGCCACTGCTGGATGCGCTGGG + Exonic
1160496538 18:79379301-79379323 CTGCCGCAGCAGTTTGCGTTAGG + Intergenic
1160583261 18:79899653-79899675 CTGCTGCTGCTCCTTGAGCTCGG - Exonic
1162349082 19:10137999-10138021 CCTCTGTTGCAGGTTGAGCTCGG - Exonic
1163235297 19:16026208-16026230 CTGCTGCTGCTTGCTGGGCTGGG - Intergenic
1164365953 19:27581890-27581912 TTTGTGCTGCAGGTTGCGTTGGG - Intergenic
1165430274 19:35768044-35768066 CTGCTGCTGCAGGCTGCAGAAGG + Exonic
1166748342 19:45152520-45152542 CTGCTGCTGCAGCAGGCGCACGG + Exonic
1168174014 19:54609620-54609642 CGGCTGCTGCTGTTTGCGGTGGG - Intronic
1168698134 19:58417618-58417640 CTGCTGGTGCCGATTGCGGTAGG - Exonic
925024007 2:593842-593864 CTGCTCCTGTAGGGTGGGCTGGG - Intergenic
925290904 2:2748169-2748191 CTGCTGCAGCTGGTTGGGCCTGG + Intergenic
927216685 2:20671410-20671432 CTGCGGCTGCAGGTAGCGCGAGG + Exonic
927421382 2:22934996-22935018 CTGCTACTGGAGGTTGCTCTTGG - Intergenic
928444131 2:31318116-31318138 TTGCTGCTGCAGGTAACTCTGGG - Intergenic
929946831 2:46378052-46378074 CTGCTGCTGCTGGTGGCACTGGG - Exonic
933997614 2:87681283-87681305 CTGCTGCTGCCTGCTGAGCTGGG + Intergenic
935978649 2:108605020-108605042 CTGCAGCTGCAGGTGAGGCTAGG - Intronic
936296238 2:111269587-111269609 CTGCTGCTGCCTGCTGAGCTGGG - Intergenic
936712068 2:115142891-115142913 CTGCTGCTGCTGGTGGTGGTGGG + Intronic
937285879 2:120750887-120750909 ATGCTGCTGGAGGCTGCACTGGG + Intronic
938795126 2:134712253-134712275 CTGCTGCTGGAAGTTGGGGTTGG - Intronic
938960508 2:136336341-136336363 CTGCTGCTGCAAGAGGCGCTGGG - Intergenic
945535037 2:211005948-211005970 CTTCTGCTACTGGTTGCTCTAGG - Intergenic
947720093 2:232365003-232365025 CTGATGCTGCAGGTAGCGATGGG - Intergenic
948385263 2:237576883-237576905 CGGCAGCTGCAGGGTGGGCTCGG - Intronic
948635039 2:239329421-239329443 CTGCAGCAGCAGCTTGGGCTGGG + Intronic
948635171 2:239330040-239330062 CTGCAGCAGCAGCTTGGGCTTGG - Intronic
948831577 2:240600926-240600948 CTGATGGTGCAGGTTGAGGTGGG + Intronic
1168771886 20:420866-420888 CTGCTGCTGCTGCTTCCGCTGGG - Exonic
1168963895 20:1887300-1887322 TTGCTGCTGCAGCTTCCGATTGG - Intergenic
1172655266 20:36532997-36533019 CTGCTGCTCCAGGCGGGGCTGGG + Intergenic
1172772603 20:37390354-37390376 CAGCTGATGCATGTTGTGCTGGG + Intronic
1176069213 20:63217346-63217368 CTGCTGCTCCAAGTTGCTCCAGG + Intergenic
1177552220 21:22638867-22638889 CTGCTGCTGAAGGTTTCTGTTGG + Intergenic
1178518729 21:33269326-33269348 CTCCTGCTGCTGTTTGCGCCTGG - Intronic
1179166352 21:38938184-38938206 CTGGTGCTGCTGGTTGTGCTAGG - Intergenic
1179556656 21:42182887-42182909 CTGCTGCCGCTGGCTGGGCTGGG - Intergenic
1179614479 21:42572975-42572997 CTCCTCCTGCAGGTTCCGCAGGG - Intronic
1179941162 21:44639474-44639496 CGGCTGCTGCTGGTTGTCCTGGG - Intronic
1179972169 21:44842288-44842310 CGGCGCCTGCAGGTTGCTCTGGG - Intergenic
1180231917 21:46431605-46431627 CTCCTTCTGCAGGTTGTCCTTGG - Exonic
1180796728 22:18609435-18609457 CTGCTGCAGCAGGCGGCGCGCGG - Exonic
1181224996 22:21385836-21385858 CTGCTGCAGCAGGCGGCGCGCGG + Exonic
1181253636 22:21548977-21548999 CTGCTGCAGCAGGCGGCGCGCGG - Exonic
1181672197 22:24430900-24430922 TTGCTGCTGCTGGTGGTGCTGGG + Intronic
1182294705 22:29306296-29306318 CTGCTGCTGCCGGCTGGGCTGGG - Intergenic
1183186284 22:36293350-36293372 CTGCTTCTCCAGGTTGTGCTTGG + Exonic
1184362420 22:44026353-44026375 CTGCTGATGCTGCTTTCGCTGGG + Intronic
1184687175 22:46101938-46101960 CTGCTGTTGCAGGTTTCACCTGG + Intronic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
949773844 3:7609409-7609431 ATGTTGCTGCAGGGTGGGCTTGG + Intronic
949938620 3:9136426-9136448 CGGCTGCTGCACGTGGCGCGCGG - Intronic
950532804 3:13562621-13562643 CTGCTGTTGCAGGCCGCGCCCGG + Intronic
952055114 3:29434785-29434807 TTGCTGCTGCTGTTTGTGCTGGG - Exonic
953879749 3:46685514-46685536 GTCCTGCTGCAGGTTGGGGTGGG - Exonic
958650402 3:96930456-96930478 GGGCTGCTGCAGGTTGCTGTGGG + Intronic
962422096 3:135237876-135237898 CTGCTGCTGCATGAGGAGCTTGG - Intronic
963001119 3:140682764-140682786 GTGCTCCTGCATGTAGCGCTTGG - Exonic
965543868 3:169896057-169896079 CTGGTACTGCAGGTGGCACTTGG + Intergenic
966235888 3:177701049-177701071 CTGCTCCTGCTGGCTGGGCTTGG + Intergenic
966860960 3:184230635-184230657 CTGCGGCTGCGGGTTGCGGTAGG - Exonic
969608480 4:8214085-8214107 CTGATGCTGCAGGTGGGGCTGGG + Intronic
969630606 4:8333724-8333746 CCGCTGCTGCAGGTAACTCTTGG - Intergenic
976643438 4:87362790-87362812 CTGCTGCTGTCGGTTGAGCAGGG - Intronic
983739664 4:171113714-171113736 CTGCTCCTGCAGGGTGGCCTAGG - Intergenic
985531091 5:434191-434213 CTGGTGCTGCAGGCTCCTCTGGG - Exonic
985549086 5:524264-524286 CTGCTGCTGGCGCTGGCGCTGGG - Exonic
985758508 5:1733178-1733200 CGGCTGCTGCAGGATGAGATGGG - Intergenic
988090210 5:26529619-26529641 CAGCTGCTGCAGCTTGCTATGGG + Intergenic
989199253 5:38747342-38747364 CTGCTGCTTGAGGCTGGGCTAGG - Intergenic
991562228 5:67965791-67965813 CTGCTCCTGCACATTGCCCTGGG - Intergenic
992479141 5:77133303-77133325 CTGCTGATTCAGGCTGAGCTTGG - Intergenic
992515845 5:77491949-77491971 CTGCAGCTCCAGGGTGCGCCTGG + Intronic
993255971 5:85590530-85590552 CTATTGCTGCAGGTTGCCTTAGG - Intergenic
994977774 5:106831972-106831994 CTGCTGCTCCTGGCTGGGCTTGG - Intergenic
995650439 5:114362481-114362503 CTGCTGCTGCTCGTCGCGCCGGG + Exonic
1001565690 5:172697784-172697806 CGGCTTCTGCAGGATGCGCTCGG - Intergenic
1011856056 6:91692863-91692885 CTGCTGCTGCAGCTTTGGTTGGG + Intergenic
1015496859 6:133891546-133891568 ATGCAGCCGCAGGGTGCGCTAGG + Intronic
1016034654 6:139373816-139373838 CTGCTGCTGCTGGTGGTGATGGG + Exonic
1016495769 6:144660052-144660074 CAGCAGCGGCAGCTTGCGCTGGG - Intronic
1016948044 6:149552109-149552131 CTGCAGCTGCAGGCTGCTGTGGG - Intergenic
1017986325 6:159445974-159445996 ATGCTGCTGTAGGTGGAGCTGGG + Intergenic
1020022606 7:4878080-4878102 CTGCCGCTTCAGTTTGCTCTTGG + Exonic
1020098424 7:5381075-5381097 CTTCTGTGGCAGGTGGCGCTTGG - Intronic
1022626609 7:32043259-32043281 CTGCTGCTGGAAGTTGAACTTGG + Intronic
1023270424 7:38456193-38456215 CTGCTGCTGCAGGTTGCAGCGGG + Intronic
1023844745 7:44114287-44114309 CTGCTGCTGTAGCTTGAGTTGGG - Exonic
1026853486 7:73738673-73738695 CTGCTGCTGCTGGGTGCGACAGG + Exonic
1029133990 7:98355348-98355370 CTGCTGCTGAAGGTTCCCCGGGG - Intronic
1029506484 7:100966489-100966511 GTGCTGCTGCTGCTGGCGCTGGG + Exonic
1033238750 7:139659485-139659507 CTGCAGCTGCAGCTTGTGCACGG + Intronic
1035394294 7:158525328-158525350 CTTCTGCTGCAGCTTCTGCTCGG - Intronic
1035563764 8:627984-628006 CTGCTGCTGCCCCTTGAGCTGGG - Intronic
1037465682 8:19157689-19157711 CTGCTGCTCCAGGCTGCCTTTGG - Intergenic
1038304278 8:26384382-26384404 CTGCTGCTCCAGGTTTTGATGGG + Intronic
1038504822 8:28075245-28075267 CTCCTGGTGGAAGTTGCGCTTGG - Intronic
1039888904 8:41671423-41671445 CTGCTGCTGGAGCTGGCGTTCGG - Intronic
1039966629 8:42288752-42288774 CTGCTGCTCCAGCTTTCCCTTGG - Intronic
1040580783 8:48697077-48697099 CTGCAGTTGCAGGCTGTGCTGGG - Intergenic
1042294111 8:67201568-67201590 CTGCTTCAGAAGGTTGGGCTTGG + Exonic
1042939729 8:74095579-74095601 CTGCTGCTGCAAGGTGAGATGGG - Intergenic
1043266698 8:78275283-78275305 CTGCAGCTGCAAGTGGCACTGGG - Intergenic
1044973868 8:97644687-97644709 CTGCTGCTGCTGTTTCTGCTGGG + Exonic
1045520567 8:102899481-102899503 CTGCTGCTGCAGGTGTCTCTGGG + Intronic
1049356872 8:142193360-142193382 CTGCTGCTGTGGGCTGGGCTGGG - Intergenic
1049371768 8:142271324-142271346 CTGCAGCAGCAGGTTTTGCTGGG + Intronic
1052972864 9:34387942-34387964 CTAGTGCTGAAGATTGCGCTGGG + Intronic
1053573762 9:39336768-39336790 TTGCTGCTGCTGGTTGCGGGTGG + Intergenic
1054095328 9:60895452-60895474 TTGCTGCTGCTGGTTGCGGGTGG + Intergenic
1054116790 9:61171376-61171398 TTGCTGCTGCTGGTTGCGGGTGG + Intergenic
1054123382 9:61282241-61282263 TTGCTGCTGCTGGTTGCGGGTGG - Intergenic
1054590963 9:67011185-67011207 TTGCTGCTGCTGGTTGCGGGTGG - Intergenic
1055421277 9:76145611-76145633 CTGGTGCTGCAGTCTGTGCTAGG - Intronic
1055563269 9:77543071-77543093 CTGCTGCTGCAGGCTTCTGTGGG - Intronic
1056814154 9:89789585-89789607 GTGCTTCTGCAGGCTGGGCTTGG + Intergenic
1056931689 9:90883197-90883219 CTGCTGCTACAGGCTGCTGTGGG + Intronic
1057592806 9:96388309-96388331 CTGCTCCTGCAGCCGGCGCTGGG + Exonic
1059117074 9:111609394-111609416 CTCCTGCGGCAGATTCCGCTGGG - Intergenic
1062497126 9:136837249-136837271 CTGCTGCTGCTGCTGGGGCTGGG - Intronic
1062571620 9:137188420-137188442 CTGGTGCCGCCGGCTGCGCTGGG - Exonic
1189870928 X:45381932-45381954 ATGCTGCTGCAGCTGGTGCTGGG - Intergenic
1191768744 X:64732581-64732603 GAGCTGCTGCAGGGTGTGCTGGG + Intergenic
1192759837 X:74085754-74085776 CTGCTGCTGCAAGCTGCTATGGG + Intergenic
1194412791 X:93577855-93577877 CTGCTGCTGCAGATAGGGCATGG + Intergenic
1200301331 X:154979633-154979655 CTGCTGCTGCAGGCTGCTGTGGG - Intronic