ID: 1127433417

View in Genome Browser
Species Human (GRCh38)
Location 15:58933733-58933755
Sequence GGCCGTCATCCGGGTGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433417_1127433421 -8 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433421 15:58933748-58933770 TGACGGCCGCGCGTGCGCGTTGG 0: 1
1: 0
2: 1
3: 2
4: 33
1127433417_1127433425 4 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433425 15:58933760-58933782 GTGCGCGTTGGCGCAGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 82
1127433417_1127433426 10 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433426 15:58933766-58933788 GTTGGCGCAGGGACCGGCAGCGG 0: 1
1: 0
2: 0
3: 13
4: 117
1127433417_1127433430 28 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433430 15:58933784-58933806 AGCGGCGCGCTCGGTCGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 32
1127433417_1127433423 -2 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433417_1127433427 19 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433427 15:58933775-58933797 GGGACCGGCAGCGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 125
1127433417_1127433429 27 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433429 15:58933783-58933805 CAGCGGCGCGCTCGGTCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1127433417_1127433424 -1 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433424 15:58933755-58933777 CGCGCGTGCGCGTTGGCGCAGGG 0: 1
1: 0
2: 2
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433417 Original CRISPR GGCCGTCATCCGGGTGCTGG CGG (reversed) Intronic
900227743 1:1540756-1540778 GGCCGGCGTCCGGGGGATGGCGG - Intergenic
901684798 1:10937826-10937848 GGTGGGCATCCGGGTGTTGGCGG - Intergenic
902255964 1:15188770-15188792 AGCAGTCACCCAGGTGCTGGGGG - Intronic
905798048 1:40826535-40826557 GGCCGGCCTCCGGTAGCTGGTGG - Intronic
913600968 1:120420928-120420950 GGCCGTCCACCAGGTCCTGGGGG + Intergenic
914086088 1:144455705-144455727 GGCCGTCCACCAGGTCCTGGGGG - Intronic
914191980 1:145419656-145419678 GGCCGTCCACCAGGTCCTGGGGG - Intergenic
914589887 1:149097606-149097628 GGCCGTCCACCAGGTCCTGGGGG - Intronic
917542960 1:175933308-175933330 GACACTCAGCCGGGTGCTGGTGG - Intergenic
923010458 1:230083972-230083994 CGCCAACATCCGGGTGCTGATGG - Intronic
1063786834 10:9394326-9394348 GGCTGTCATCAGGTTGCAGGTGG + Intergenic
1066975981 10:42367995-42368017 GGGCGGCTTCCGGGTGTTGGCGG - Intergenic
1069546858 10:69335026-69335048 AGCCACCATCAGGGTGCTGGGGG + Intronic
1069829988 10:71277189-71277211 GGCTGTCACCCCGGGGCTGGGGG + Intronic
1070189168 10:74095660-74095682 GGCTGCCATCCGGGGGCTTGTGG + Exonic
1073146313 10:101284273-101284295 GGCCGACATCAGGGTAATGGGGG + Intergenic
1073251107 10:102120749-102120771 GTCCGTCCTCCGGGTGCCGCCGG + Intergenic
1077185036 11:1232039-1232061 GGCCCTCAGCGGGGTGGTGGAGG + Exonic
1083097188 11:60263664-60263686 TGCGGTCATCTGGGGGCTGGTGG + Intergenic
1083508323 11:63182221-63182243 GGCCTTCCTCTGGGTGCTGAGGG + Intronic
1083949866 11:65947918-65947940 GGCTGTGCTCTGGGTGCTGGGGG + Intronic
1088599170 11:111460315-111460337 GCCCGTTGTCCAGGTGCTGGAGG + Intergenic
1090471310 11:126983705-126983727 GGCTGGCATCCAGGTGCTGCAGG - Intronic
1096204270 12:49707640-49707662 GGCCGTCAATCGGGCGCAGGTGG - Intronic
1098266125 12:68721879-68721901 GGCCTACTTCCGGGTGATGGTGG + Exonic
1103901031 12:124303694-124303716 GGCCCACATCCTGGGGCTGGGGG - Intronic
1108396128 13:49993662-49993684 GGCCGGCATTCGGGGGCGGGGGG + Intergenic
1112749783 13:102570371-102570393 GGCTGTCATCTGGGTGCTTCAGG - Intergenic
1112793581 13:103029976-103029998 GGGGGTCAGCCTGGTGCTGGGGG + Intergenic
1113741926 13:112716910-112716932 GGTGGACATCCGGGAGCTGGAGG + Intronic
1121511498 14:94516235-94516257 GGCTGTCATCCTGGGTCTGGTGG + Intronic
1121762268 14:96455845-96455867 GGCAGTCACCCTGGTGGTGGTGG + Intronic
1122648039 14:103207789-103207811 GGCCGTCCTGCTGGTGCTGGTGG + Intergenic
1122658640 14:103279523-103279545 GGCCGTCCCGCGGGTGCTGGTGG + Intergenic
1125726604 15:41871439-41871461 GGCCGCCTGCCGGCTGCTGGCGG - Exonic
1127261735 15:57331585-57331607 GGGCCTCTTCTGGGTGCTGGGGG - Intergenic
1127433417 15:58933733-58933755 GGCCGTCATCCGGGTGCTGGCGG - Intronic
1132679293 16:1133144-1133166 GGCTGGCCTCTGGGTGCTGGGGG + Intergenic
1132758056 16:1495580-1495602 GGAGGTCGTCCGGGTGCTGCAGG + Exonic
1132996321 16:2825380-2825402 GGCCGCCAGCCGTCTGCTGGGGG - Intronic
1133031604 16:3013824-3013846 GGCCCTCAAGCGGGAGCTGGGGG + Exonic
1137587283 16:49671217-49671239 GGCAGTCATCCTTGTGTTGGAGG - Intronic
1139350052 16:66329268-66329290 GGACTGCATCTGGGTGCTGGTGG - Intergenic
1139797416 16:69494971-69494993 GGCCCACAACCGGGTGGTGGTGG - Intergenic
1141029216 16:80573221-80573243 AGCCATCATTCGAGTGCTGGGGG - Intergenic
1141281437 16:82633021-82633043 GGCGGTAATGCGAGTGCTGGGGG + Intronic
1142411553 16:89919543-89919565 GGCCGTCATCCTCCTGCTGGAGG + Exonic
1143335093 17:6166088-6166110 GGCTGTCCTCAGGCTGCTGGAGG + Intergenic
1148758747 17:49988279-49988301 GGCTGGCATCCGTGGGCTGGAGG + Intergenic
1151728257 17:75896724-75896746 GGCCCTCAGCGGCGTGCTGGAGG - Exonic
1157478332 18:48037260-48037282 GGCCGTCATTCTGGAGCAGGAGG + Intronic
1158755576 18:60320613-60320635 GCCCATCATCGGGGTGGTGGGGG + Intergenic
1160716382 19:578645-578667 TGCCGTCAGCCTGGGGCTGGGGG + Intronic
1160906407 19:1453573-1453595 GGCCACCATCCGGCTGCTGGAGG + Exonic
1162461766 19:10817840-10817862 GGCCGCCTTCCTGGTGCTGCCGG - Intronic
1163276770 19:16289693-16289715 GGCCGCCATCAGGGAGTTGGGGG - Intergenic
1163427049 19:17245620-17245642 GGCCGCCATCCGAGCGCGGGAGG + Exonic
1165031265 19:32999555-32999577 GGCCCACATCTGGGTGCAGGGGG + Intronic
1165135882 19:33668348-33668370 GGCCTTCATCATGGAGCTGGGGG + Intronic
1165227781 19:34366408-34366430 GGACGTGATGCGGATGCTGGTGG + Exonic
1165236827 19:34428477-34428499 GGCCGGGGGCCGGGTGCTGGTGG + Exonic
1165362679 19:35346406-35346428 GGCCGGCATCCAGGACCTGGAGG - Intronic
1166007074 19:39915292-39915314 GCCTGCCTTCCGGGTGCTGGTGG - Exonic
1166820276 19:45574993-45575015 GGCTCTCATCCAGGTGCAGGTGG - Intronic
927697004 2:25245682-25245704 CGCCCTCAGCCTGGTGCTGGTGG - Intronic
932435819 2:71702103-71702125 GGCCGGCATCTGGGTCCTGTGGG + Intergenic
932823358 2:74920020-74920042 GGCCGTCCCCCGGGAGCGGGTGG + Intergenic
933698615 2:85238335-85238357 GGCCGTTCTCCAGGTACTGGGGG + Intronic
934503301 2:94874851-94874873 GGCCAACCTGCGGGTGCTGGTGG + Exonic
935050953 2:99524651-99524673 GGCTCTCATCTGGGTGCTGTGGG - Intergenic
942521219 2:176806247-176806269 AGCCGTCATGTGGGTGCTTGGGG - Intergenic
945080951 2:206085720-206085742 GGCCGGCGCCCGGGTGGTGGAGG - Intronic
947175049 2:227357980-227358002 GACCTTCATCCTGGTGGTGGTGG + Intergenic
947567133 2:231201366-231201388 GGCAGCCAGCCGGGTGCTGGAGG - Intronic
948921665 2:241068789-241068811 GGAGGTCATCCTGCTGCTGGTGG - Intronic
1171334508 20:24371223-24371245 GGCCCTCATCTTGGTGCTTGAGG + Intergenic
1179221996 21:39416540-39416562 GACCATAATCTGGGTGCTGGAGG + Intronic
1179598897 21:42462339-42462361 GGCCGTCCTCTGTGGGCTGGAGG + Intergenic
1181416421 22:22762638-22762660 CACAGTCATCCTGGTGCTGGAGG - Intronic
1185139347 22:49091711-49091733 GGCCAGCATCCGGGTGGCGGGGG - Intergenic
950033889 3:9870271-9870293 GCCCTTCTTCCTGGTGCTGGAGG - Exonic
951718631 3:25674641-25674663 CGCCTTCAGCCGGGTGCTTGAGG + Intergenic
953768025 3:45759067-45759089 GGCTGTCATCGGGCTGCTTGTGG - Exonic
961647467 3:128400264-128400286 GTCCCTCAACAGGGTGCTGGTGG - Intronic
961717637 3:128869645-128869667 GCCCTTCTTCCTGGTGCTGGAGG + Intergenic
964179509 3:153866069-153866091 GGCGGTCACCAGGGTGCTTGTGG + Intergenic
966927179 3:184652407-184652429 GGCATTCATCTGGGTGCTTGTGG - Intronic
968647451 4:1747798-1747820 GTCCGCCATCAGGGTGCTGGCGG - Intergenic
969611505 4:8229844-8229866 GGCCCTCCCCGGGGTGCTGGGGG + Intronic
978503563 4:109433901-109433923 GGGCGGGATCCGGGCGCTGGCGG - Exonic
983996630 4:174190208-174190230 GGCGGTCAACTGGGTGGTGGAGG + Intergenic
993581610 5:89668829-89668851 GTCAGTCATCGAGGTGCTGGTGG + Intergenic
994072722 5:95620422-95620444 GGGGGTCATCCTGGTGGTGGCGG + Exonic
1001065910 5:168534989-168535011 GGCAGACATCATGGTGCTGGTGG - Intergenic
1007257923 6:40541549-40541571 GGCAGACATCAGGGTGCTGATGG + Intronic
1012737826 6:102973693-102973715 GGGTGTCTTCCGGGTGCTGCAGG - Intergenic
1017834954 6:158168490-158168512 GCCTGTCCACCGGGTGCTGGGGG + Intronic
1018050908 6:160006621-160006643 GGCCATCAGCCTGGTGCTGTGGG + Intronic
1020094600 7:5361501-5361523 GGCCTGCCTCGGGGTGCTGGGGG - Intronic
1024965541 7:55019704-55019726 GGGCGAAAGCCGGGTGCTGGTGG + Intronic
1026100663 7:67382063-67382085 GGCAGTCAGCTTGGTGCTGGGGG + Intergenic
1026800591 7:73397709-73397731 GGCAGTAAGCCTGGTGCTGGAGG + Intergenic
1035813507 8:2513523-2513545 GGCCGCCCGCCGGGGGCTGGGGG + Intergenic
1037815018 8:22107554-22107576 GGCCGTCCTGCGGCTGCTGCAGG - Exonic
1037949055 8:23007043-23007065 GGACGTCATCCTGGTGCTGCAGG + Exonic
1039595732 8:38788221-38788243 GGCTGTCATCCGCGTGATTGCGG + Intronic
1052743247 9:32414654-32414676 TGCCATCCTCCTGGTGCTGGAGG + Intronic
1053841558 9:42191890-42191912 GGCCGGCACCGGGGTGCAGGGGG + Intergenic
1054120020 9:61198284-61198306 GGCCGGCACCGGGGTGCAGGGGG + Intergenic
1054587736 9:66984278-66984300 GGCCGGCACCGGGGTGCAGGGGG - Intergenic
1058420741 9:104830989-104831011 GGCAATCATCAGGGTGCTGACGG - Exonic
1062057260 9:134475090-134475112 ATCCTTCCTCCGGGTGCTGGGGG + Intergenic
1185468670 X:369963-369985 GGCCGTCATCTGGGTGGGCGAGG - Intronic
1189057333 X:37711689-37711711 GGCAAGCATCCGGGTGCAGGTGG - Intronic
1189293165 X:39900232-39900254 GGGCGTGATAAGGGTGCTGGCGG + Intergenic
1194797128 X:98225630-98225652 GGCAGTCATGCTGGTCCTGGAGG + Intergenic
1197717505 X:129720057-129720079 GGCCATGATGGGGGTGCTGGTGG - Intergenic
1200079710 X:153570167-153570189 GGCCGCCTTCCCGGGGCTGGAGG + Intronic