ID: 1127433418

View in Genome Browser
Species Human (GRCh38)
Location 15:58933736-58933758
Sequence CGCGGCCGTCATCCGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433418_1127433425 1 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433425 15:58933760-58933782 GTGCGCGTTGGCGCAGGGACCGG 0: 1
1: 0
2: 0
3: 5
4: 82
1127433418_1127433429 24 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433429 15:58933783-58933805 CAGCGGCGCGCTCGGTCGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 37
1127433418_1127433423 -5 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433418_1127433430 25 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433430 15:58933784-58933806 AGCGGCGCGCTCGGTCGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 32
1127433418_1127433427 16 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433427 15:58933775-58933797 GGGACCGGCAGCGGCGCGCTCGG 0: 1
1: 0
2: 0
3: 12
4: 125
1127433418_1127433426 7 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433426 15:58933766-58933788 GTTGGCGCAGGGACCGGCAGCGG 0: 1
1: 0
2: 0
3: 13
4: 117
1127433418_1127433424 -4 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433424 15:58933755-58933777 CGCGCGTGCGCGTTGGCGCAGGG 0: 1
1: 0
2: 2
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433418 Original CRISPR CGCGGCCGTCATCCGGGTGC TGG (reversed) Intronic
900217216 1:1487964-1487986 CGCGGCTGTCATCCTGGGCCAGG + Intronic
906068554 1:43000439-43000461 CGCTGCAGTCATCTGGGGGCTGG - Intergenic
1073122663 10:101131925-101131947 TGCGGGGGTAATCCGGGTGCCGG + Exonic
1084118774 11:67056892-67056914 GGCCGCCGTCATCCCGGGGCCGG - Exonic
1084787019 11:71448406-71448428 CGCTGACATCATCCGGGGGCGGG - Exonic
1091744523 12:2982612-2982634 CGCGGCCCACATCCCGGGGCTGG - Intronic
1092524426 12:9301141-9301163 GGCCGCCGGCATCCGGCTGCAGG + Intergenic
1096204271 12:49707643-49707665 CGCGGCCGTCAATCGGGCGCAGG - Intronic
1122648038 14:103207786-103207808 CGGGGCCGTCCTGCTGGTGCTGG + Intergenic
1122658639 14:103279520-103279542 CGGGGCCGTCCCGCGGGTGCTGG + Intergenic
1127433418 15:58933736-58933758 CGCGGCCGTCATCCGGGTGCTGG - Intronic
1130486177 15:84399468-84399490 CGCGGACGACACCTGGGTGCAGG - Intergenic
1132757583 16:1493577-1493599 CGCTGCAGTCACCCGGGAGCCGG + Exonic
1138506158 16:57479330-57479352 CGCGGCTGCCCTCCGGCTGCCGG - Intronic
1141934755 16:87229845-87229867 CTCGGCCCTCATCAGGGTGATGG + Intronic
1149855441 17:60078776-60078798 AGCTGCTGTCATCCGGGCGCAGG + Exonic
1152124070 17:78435854-78435876 CGCGCCCCTCAGCAGGGTGCAGG + Intronic
1152396249 17:80035617-80035639 GGCCGCCGTCCTCGGGGTGCGGG - Intronic
1152607583 17:81300463-81300485 AGCGGCCGAGATCTGGGTGCTGG + Intergenic
1157706786 18:49813924-49813946 CGCGGCCGCCAGCTGGGGGCGGG + Exonic
1158137607 18:54224258-54224280 CGCGGCCGTCCCCCGAGTGGCGG - Exonic
1161040090 19:2105804-2105826 GGCTGCCGTCAGCCGGGCGCGGG + Intronic
1161401501 19:4067695-4067717 CGCGGCCCGCAGCCGGGTGGGGG - Intergenic
1161504975 19:4639206-4639228 CGAGGCCGTCGTGGGGGTGCCGG - Intergenic
1166309893 19:41957018-41957040 CTCGGCCGTCTTCTGGGTGCTGG - Exonic
932823357 2:74920017-74920039 GGCGGCCGTCCCCCGGGAGCGGG + Intergenic
938319865 2:130355734-130355756 AGGGGCCGACCTCCGGGTGCCGG - Intergenic
1169191340 20:3660727-3660749 CGCGGCCGGGATCCGGGCGAGGG - Intronic
1169557879 20:6768724-6768746 CGCGGCCGGCACCCGGGAGAAGG + Exonic
1176546734 21:8205539-8205561 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1176554629 21:8249729-8249751 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1176565685 21:8388586-8388608 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1176573550 21:8432754-8432776 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1179675109 21:42975315-42975337 CGTGGCCCTCAGCCGGGCGCCGG + Intronic
1183540501 22:38426881-38426903 GGCGGGCATCATCCGGATGCTGG - Exonic
1185338383 22:50280911-50280933 CGAGGCCGGCATCCCCGTGCTGG - Exonic
1203251599 22_KI270733v1_random:121805-121827 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1203259649 22_KI270733v1_random:166887-166909 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
950184746 3:10938149-10938171 CACGGCGGACATCTGGGTGCTGG - Intronic
950487763 3:13282986-13283008 CGCGGCCGGCCTCCGGGCGGGGG - Intergenic
953982274 3:47418755-47418777 TGCGGCCGTCCTGAGGGTGCCGG + Exonic
983238629 4:165207430-165207452 GGCGGGCGCCAGCCGGGTGCGGG - Intronic
995659732 5:114467719-114467741 AGCTGCCGTCTTCCGGGTACAGG + Intronic
1001381572 5:171309617-171309639 CGCAGGCGTGATCCGGGTGCCGG + Exonic
1019518086 7:1448362-1448384 CGGGGCCCTCATCCTGCTGCAGG - Intronic
1024817778 7:53291752-53291774 CGCTGCCCTCTTCCTGGTGCAGG + Intergenic
1029701337 7:102248664-102248686 CGCGGGCGTCGTCCGGGCCCGGG - Exonic
1049299557 8:141862379-141862401 CGGTGCCCTCAGCCGGGTGCAGG - Intergenic
1049421181 8:142517350-142517372 CTGGGGTGTCATCCGGGTGCCGG - Intronic
1203468001 Un_GL000220v1:104956-104978 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1203475822 Un_GL000220v1:148928-148950 CGCCCCCGTCCCCCGGGTGCCGG + Intergenic
1189491329 X:41473603-41473625 CGCGGGCCTCCTGCGGGTGCCGG + Exonic