ID: 1127433423

View in Genome Browser
Species Human (GRCh38)
Location 15:58933754-58933776
Sequence CCGCGCGTGCGCGTTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127433417_1127433423 -2 Left 1127433417 15:58933733-58933755 CCGCCAGCACCCGGATGACGGCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433414_1127433423 11 Left 1127433414 15:58933720-58933742 CCTGCAGCAGCAGCCGCCAGCAC 0: 1
1: 2
2: 3
3: 66
4: 506
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433411_1127433423 25 Left 1127433411 15:58933706-58933728 CCACCCTAGCGCAACCTGCAGCA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433418_1127433423 -5 Left 1127433418 15:58933736-58933758 CCAGCACCCGGATGACGGCCGCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433413_1127433423 21 Left 1127433413 15:58933710-58933732 CCTAGCGCAACCTGCAGCAGCAG 0: 1
1: 0
2: 1
3: 24
4: 222
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433412_1127433423 22 Left 1127433412 15:58933709-58933731 CCCTAGCGCAACCTGCAGCAGCA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60
1127433410_1127433423 28 Left 1127433410 15:58933703-58933725 CCGCCACCCTAGCGCAACCTGCA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127433423 Original CRISPR CCGCGCGTGCGCGTTGGCGC AGG Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG + Exonic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1064086241 10:12348830-12348852 CCGCGCGGGCGCCCTGGTGCTGG - Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1077360805 11:2139471-2139493 CCGCGGGCGCCCATTGGCGCGGG - Intronic
1094466057 12:30754836-30754858 ACGCGAGTGCGGGGTGGCGCCGG - Intronic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1125805628 15:42491116-42491138 GTGCGCCTGCGCGTTGGCGGCGG - Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1133029617 16:3004257-3004279 CCGCGGGTGCGAGCTGGAGCGGG - Intergenic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1139467110 16:67159900-67159922 CCGGGTGTGCGCGGAGGCGCTGG + Exonic
1142509639 17:385749-385771 CCGCACGTGCGCGCCGGGGCGGG + Intronic
1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG + Intergenic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1152552280 17:81035612-81035634 CCGCGCGCTCGCCTTGGCGTCGG + Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG + Intergenic
1163850991 19:19663551-19663573 CCGCGCGCGCTCCTTGCCGCCGG - Exonic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165157346 19:33796503-33796525 CCGCGCGCGCCCGTTCGCGCTGG + Intronic
926077383 2:9951942-9951964 CCGCGCGGGCGGGCGGGCGCGGG + Intronic
929787819 2:45004774-45004796 CCGCGCGTACTCCTTGGCGGTGG - Intergenic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
931869058 2:66440034-66440056 GCGCGCGTGTGTGTTGGCGAAGG - Intronic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
935645259 2:105329486-105329508 CCGTGCGTGTGCGCTGGGGCAGG - Intronic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1184127966 22:42500953-42500975 CCGGGCGTGCGCGTGGGTGTCGG + Intergenic
1184136756 22:42554269-42554291 CCGAGCGTGCGCGTGGGTGTCGG + Intronic
1184680765 22:46071259-46071281 CCCCGCGTGCGCGTCCCCGCGGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
959539838 3:107525153-107525175 CCGCGCGGGGACGTCGGCGCCGG - Intronic
959683103 3:109118138-109118160 CTGCGCGTGAGCGTGGGCGTGGG - Exonic
968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG + Exonic
968506518 4:973573-973595 CCGCGCCTGCGCAGTGGGGCAGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
970192178 4:13527692-13527714 CCGCGCGGGGGCAGTGGCGCAGG + Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
997282260 5:132656507-132656529 CCGCGCGTGGGAGAAGGCGCTGG - Intronic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG + Intronic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1031025197 7:116672252-116672274 CGGCCCGGGCGCGTTGGGGCCGG - Intergenic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1062435577 9:136545408-136545430 CCGCGCGTGGGGCTTGCCGCCGG - Intronic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1186496555 X:10015918-10015940 CAGCGCATCCGCGGTGGCGCCGG - Intronic
1190936067 X:55000318-55000340 CCTCCCGCGCGCGTTTGCGCAGG - Intergenic