ID: 1127435824

View in Genome Browser
Species Human (GRCh38)
Location 15:58957314-58957336
Sequence CTCTCAAGGACCCCTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127435817_1127435824 15 Left 1127435817 15:58957276-58957298 CCTACAGTCATTTGAGGCTTCAC 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1127435824 15:58957314-58957336 CTCTCAAGGACCCCTGTAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127435824 Original CRISPR CTCTCAAGGACCCCTGTAGC TGG Intronic
903875464 1:26470728-26470750 CTCTCCAGGAACCCTGTGCCAGG - Exonic
903930108 1:26857012-26857034 CTCTCTAGGACCCCCATAGGGGG + Exonic
904263339 1:29303790-29303812 CTCTCCAGGACCCCCGAGGCTGG + Intronic
904969212 1:34405885-34405907 CTGTAAAGGACCCCTTTAGCTGG + Intergenic
905358314 1:37400542-37400564 CCCTCAAGGCCCCCTCCAGCTGG + Intergenic
905452327 1:38064665-38064687 CTCCCAAGGACCTCTGGAACTGG - Intergenic
905864886 1:41371313-41371335 CTCCCCTGGACCCCAGTAGCAGG - Intronic
905923012 1:41731585-41731607 CTCTCTTGGACCCCAGTTGCTGG + Intronic
909940016 1:81600511-81600533 CTCTCAAGAACACCAGCAGCAGG + Intronic
910054934 1:83022441-83022463 CTCCCAAGTACCACAGTAGCTGG + Intergenic
916244579 1:162674793-162674815 CTCTCTAGGACCTCTTTAACTGG + Intronic
918658321 1:187056943-187056965 GTCTCAACCTCCCCTGTAGCTGG + Intergenic
919880578 1:201898069-201898091 CTGTCCAGGGCCCATGTAGCTGG - Exonic
920402919 1:205688019-205688041 CTCTCAAAGACCCTAGTAGCTGG + Intergenic
921333369 1:214062772-214062794 CTCTCAAGGTACCCATTAGCTGG + Intergenic
921483435 1:215689659-215689681 CTGTGAAGGACCCCTGTGGAGGG + Intronic
1064674764 10:17749851-17749873 CTCTCAAGGCCCCCGGCAGAAGG - Intergenic
1074540598 10:114362397-114362419 CTTACAAGGACCCCAGTCGCTGG - Intronic
1076124315 10:127962342-127962364 CTCTCAAGGCCCCATGAGGCAGG + Intronic
1078944399 11:16047267-16047289 CTCTCCAGTACCCCAGTTGCTGG + Intronic
1079494797 11:21029979-21030001 CTCTCAAGTACCCATTCAGCAGG - Intronic
1081847497 11:46251490-46251512 CTCAGCAGGACCCCTGAAGCAGG + Intergenic
1082044348 11:47712917-47712939 CTCCCAAGTACCCAGGTAGCTGG - Intronic
1083268884 11:61560749-61560771 CTTTCAAGGTCCCTTCTAGCTGG - Intronic
1084669307 11:70595903-70595925 CTCACAAGGACACCAGTCGCTGG - Intronic
1094814282 12:34168066-34168088 CAGTCCAGGACCCCTGTGGCTGG - Intergenic
1098081444 12:66790243-66790265 GTCTGAAGGACCTATGTAGCTGG - Intronic
1098338103 12:69424299-69424321 CTCTGAGTGACCCCTGTAGCAGG - Intergenic
1115776388 14:36720006-36720028 AGATCAAGGGCCCCTGTAGCCGG - Intronic
1119095251 14:71824010-71824032 CTCTCAAGTAGCCAAGTAGCTGG - Intergenic
1122848228 14:104512431-104512453 CCCTGAAGGCCCCCTGTGGCAGG - Intronic
1124553761 15:30707339-30707361 CTCTCTGGGACCCCTCTTGCTGG + Intronic
1124677487 15:31698335-31698357 CTCTCTGGGACCCCTCTTGCCGG - Intronic
1124912908 15:33940036-33940058 CTCTCGAGGAACCATGAAGCAGG + Intronic
1125671508 15:41476824-41476846 CTGTCAAGGCCACCTGTGGCTGG + Intronic
1126360978 15:47845797-47845819 CTCTAAAGGACCAGTGCAGCAGG - Intergenic
1127290221 15:57563245-57563267 CTCTCATGTACTCCTATAGCAGG + Intergenic
1127435824 15:58957314-58957336 CTCTCAAGGACCCCTGTAGCTGG + Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1130604943 15:85307406-85307428 CTCTCAAGTCTCCCAGTAGCAGG - Intergenic
1137623622 16:49893543-49893565 CTCTCAATGAGCTCTGCAGCTGG - Intergenic
1138394141 16:56691308-56691330 CTCTGAAGGACCACTGATGCTGG - Intronic
1139599309 16:67976979-67977001 CTCTCAAGGAACCCAGAGGCAGG - Intronic
1143631151 17:8141031-8141053 CTCTCATGGACTCCTGGAGATGG + Exonic
1146192102 17:30778298-30778320 CTCCCAAGTACCCAAGTAGCTGG - Intronic
1146337271 17:31985038-31985060 CTCCCAAGTACCCAAGTAGCTGG - Intronic
1151095322 17:71490825-71490847 GTCTCAAGGAGACCTGTGGCTGG - Intergenic
1151447773 17:74178414-74178436 CTCCCAAGTACCCAGGTAGCTGG + Intergenic
1152844888 17:82593608-82593630 CTCACAAGGACCCTTGCAGAGGG + Intronic
1153482068 18:5556827-5556849 CTCTCAATGATCCTTGAAGCAGG - Intronic
1153764780 18:8365179-8365201 CTCCCAAAGGGCCCTGTAGCTGG + Intronic
1156342327 18:36220804-36220826 CTCCCAAGTACCCAAGTAGCTGG - Intronic
1161064031 19:2228821-2228843 CTCTCCAGGACCTCTGCAGCCGG - Intronic
1161071089 19:2261517-2261539 CTCACAAGGACCCCAGGAGGTGG - Intronic
1165857177 19:38886566-38886588 CTCTCAAGCTCCCAAGTAGCTGG + Intronic
925556109 2:5133038-5133060 CTCTGCAGGACACCTGCAGCTGG + Intergenic
930041527 2:47128859-47128881 CTCTCTGTGACCACTGTAGCTGG + Intronic
932139777 2:69264994-69265016 CCCACAAGGAGCCCTGGAGCTGG - Intergenic
933996310 2:87672519-87672541 CTCTCATGCACCCCAGTGGCTGG + Intergenic
935094832 2:99934526-99934548 CTCTCAAGAACCACAGAAGCAGG + Intronic
936297545 2:111278392-111278414 CTCTCATGCACCCCAGTGGCTGG - Intergenic
937917959 2:127108245-127108267 CTCTCAGGGACCTCTGTCCCTGG - Intergenic
937965321 2:127503063-127503085 CTCTCATGGCCCCTTCTAGCTGG + Intronic
938199801 2:129363350-129363372 CTCTCAAGGACCCTTGCAGATGG + Intergenic
939323884 2:140661550-140661572 ATCTCAACCACCCCAGTAGCTGG - Intronic
939546902 2:143565904-143565926 CACACAAGGATCCCTGTTGCTGG + Intronic
940519331 2:154723168-154723190 ATCTCAGTCACCCCTGTAGCTGG - Intronic
946392846 2:219426687-219426709 CTCTCCAGAGCCCCTGCAGCAGG - Exonic
947256094 2:228165190-228165212 CACTCATTGACCCCTGTAGTGGG - Intronic
1168898700 20:1341837-1341859 CTCTCAAGGACCCCTGTTCCTGG + Intronic
1172068357 20:32237695-32237717 TTCTGAAGGACCTCTCTAGCTGG + Exonic
1172869953 20:38129747-38129769 GTCCCAAGGGCCCCTGGAGCTGG + Exonic
1173650373 20:44659983-44660005 CTCCCATGGACTCCTGGAGCAGG - Intergenic
1175162989 20:57022517-57022539 CTCTCCTGGTCCCCTCTAGCTGG + Intergenic
1176309745 21:5143144-5143166 CTGTCAAGTAAGCCTGTAGCCGG + Intronic
1177147295 21:17420436-17420458 CTCTCAACCTCCCCTGAAGCTGG - Intergenic
1179847313 21:44118889-44118911 CTGTCAAGTATGCCTGTAGCCGG - Intronic
1180137614 21:45871460-45871482 CTCTCCAGGACCCCAGGGGCAGG + Intronic
1181978138 22:26747045-26747067 CTTTCTAGGACCCCTGTTTCTGG + Intergenic
1183402666 22:37613777-37613799 CCCTCAAGGAGCTGTGTAGCCGG - Intronic
1184822297 22:46918390-46918412 TTCTCCAGGTCCCCTGTGGCTGG - Intronic
949337280 3:2989276-2989298 CTCTCAAGGTCACGAGTAGCAGG + Intronic
950303554 3:11901468-11901490 CGCTCAGGGGCCCCTGCAGCAGG + Intergenic
961063947 3:123858104-123858126 CTCCCAAGAGCCTCTGTAGCAGG - Intronic
962134222 3:132716817-132716839 CTCTGAAGGACTGCTGAAGCTGG + Exonic
967833869 3:193944460-193944482 TTCTCAAGAGCCCCTGTTGCTGG + Intergenic
970129034 4:12846014-12846036 CTCTCAGTGACCCCTAGAGCCGG + Intergenic
971086921 4:23289183-23289205 ATCTCAAGGAATTCTGTAGCTGG + Intergenic
984137178 4:175955226-175955248 CTCCCATGGACCCCAGTAACAGG - Intronic
985450489 4:190059286-190059308 CTCTGCAGGACCCCTGAAGGAGG - Intergenic
987046881 5:14116841-14116863 CTCTCAAGGACCCATGGAAGAGG - Intergenic
987360352 5:17100708-17100730 CTCTCAATCTCCCTTGTAGCTGG + Intronic
989775347 5:45200256-45200278 ATCTTAAGAACCCCTGTGGCTGG + Intergenic
991410405 5:66339913-66339935 CTCTCCTGGGCTCCTGTAGCTGG + Intergenic
997906637 5:137823510-137823532 CTCTCAGCCTCCCCTGTAGCTGG - Intergenic
999250138 5:150177636-150177658 CTCTCAATGACCCGTGGAGTTGG - Intronic
999664011 5:153894114-153894136 CTCTCCAGGACCTCTGAAACAGG + Intergenic
1000036378 5:157451706-157451728 CTCTCCAGGATCCCTGAAGGAGG + Intronic
1001296618 5:170503519-170503541 CCCTCAAGGACCCGCGGAGCAGG + Intronic
1001412981 5:171523931-171523953 CTCTCATGGAGCCCTGTGCCTGG + Intergenic
1002884479 6:1281471-1281493 CTCTCAAGGAGGCCTGCTGCTGG + Intergenic
1003905788 6:10698555-10698577 CTCTCAAGGACTCCAGGATCTGG - Intronic
1006472454 6:34236553-34236575 CTCCCTGGGACCCCTGTACCAGG + Intergenic
1008646213 6:53517513-53517535 TTCTCAAGAACCCTTGTAGCTGG - Intronic
1009739007 6:67720160-67720182 TTCTCAAGGACTCGTGTATCAGG + Intergenic
1017881146 6:158563442-158563464 CTCTCAAGAACCCCAGTTCCTGG - Intronic
1018046815 6:159972619-159972641 CTCGCAGGCACCCCTGAAGCAGG - Intronic
1018747826 6:166776045-166776067 CTCTCCAGCACCGCTGTGGCTGG - Intronic
1019264372 7:104864-104886 ATCTCAAGGCCCCCAGTAGATGG + Intergenic
1023049148 7:36236192-36236214 CGCTCAAGGAGCCCTTCAGCCGG + Intronic
1025104625 7:56161009-56161031 GTCTCAACCACCCCAGTAGCTGG + Intergenic
1026823446 7:73565462-73565484 CTCTCAAGTAGCCCAGTAGCTGG + Intergenic
1037320318 8:17635092-17635114 CTCTGAAGGACCCCAGGAGGAGG - Intronic
1037752596 8:21692600-21692622 CTCTCAAGCCCTCCTGGAGCTGG + Exonic
1038095964 8:24310456-24310478 CCTTTAAGGACCCCTGTAGGAGG + Intronic
1039141306 8:34391746-34391768 CACTCAAGGACCCCTGTGGAGGG - Intergenic
1043542136 8:81276002-81276024 CTCTGAAGGACCCAAGCAGCAGG - Intergenic
1051916757 9:22217640-22217662 CTCTTAGGGACCCCAGTTGCAGG + Intergenic
1056784282 9:89578914-89578936 CTCACAAGGACCTCTGTGGTTGG + Intergenic
1059551889 9:115237389-115237411 CTGTCAATGTCCCCTGTTGCAGG + Intronic
1059931112 9:119262069-119262091 CTCACAAGCACCCCAGGAGCTGG + Intronic
1062034029 9:134374853-134374875 TTCTTAAGGACTCCTGCAGCTGG + Intronic
1189944699 X:46166047-46166069 CTCTGAAGGACCTCTGAAGACGG + Intergenic
1190199613 X:48349575-48349597 CTCTGAAGGACACCTGTATTGGG + Intronic
1195413503 X:104595126-104595148 CTCTCCTGGACCACTGCAGCAGG - Intronic
1201515772 Y:14817624-14817646 TTCTCAAGGACCAGTGTACCTGG + Intronic