ID: 1127435873

View in Genome Browser
Species Human (GRCh38)
Location 15:58957665-58957687
Sequence CTCTCGAAGCATTGGCTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127435873_1127435875 0 Left 1127435873 15:58957665-58957687 CCATAGAGCCAATGCTTCGAGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1127435875 15:58957688-58957710 AGAGAGAGAGAGAGAGACCAAGG 0: 12
1: 137
2: 1479
3: 7049
4: 14294
1127435873_1127435876 3 Left 1127435873 15:58957665-58957687 CCATAGAGCCAATGCTTCGAGAG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1127435876 15:58957691-58957713 GAGAGAGAGAGAGACCAAGGTGG 0: 1
1: 20
2: 242
3: 1436
4: 7360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127435873 Original CRISPR CTCTCGAAGCATTGGCTCTA TGG (reversed) Intronic
905031964 1:34890564-34890586 CTCTCAAAGCCTTTGCTCTGGGG + Intronic
911575833 1:99576947-99576969 CTCTCTCAGCATTGGGACTAGGG - Intergenic
920539166 1:206764566-206764588 CTCTTGCATCATTGGCTCTGGGG + Intergenic
921043255 1:211454156-211454178 CTCTGGAAGCTTTGTCTCTGAGG - Intergenic
1064431140 10:15270664-15270686 CTCTGGAAGCTTTGTCTCAAAGG - Intronic
1066157938 10:32697957-32697979 CTCTGGAAGCTTTGTCTCAAAGG - Intronic
1066588460 10:36964591-36964613 ATCTCAATGCATTGGCTCTGTGG - Intergenic
1069882277 10:71601175-71601197 TTCTAGAAGCATTGTTTCTAGGG + Intronic
1071563086 10:86658135-86658157 CTCTATAAGCAGTGGCTCTTTGG + Exonic
1072373777 10:94793713-94793735 CTCTGGAAGCTTTGTCTCAAAGG + Intronic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075394699 10:122118550-122118572 CTCTTGAACTATAGGCTCTAAGG + Intronic
1081070367 11:38603167-38603189 ATCTCCAAGCCTTGGCTCCATGG + Intergenic
1089610871 11:119667897-119667919 ATCTCAAACCATTGGCTCAAAGG + Intronic
1089764958 11:120756513-120756535 CTCTCTAAGACTTGGCTCAAAGG + Intronic
1091807738 12:3367754-3367776 CTCTGGAAGCTGTGGCTCTGGGG - Intergenic
1102534809 12:113573531-113573553 CTGTCACAACATTGGCTCTAGGG - Intergenic
1106670519 13:31899910-31899932 CTCTAGAAGCATTCCTTCTAAGG + Intergenic
1109932558 13:69234992-69235014 CTCGTGATGCAGTGGCTCTAGGG + Intergenic
1114796486 14:25720915-25720937 CTCTGGAAGCTTTGTCTCTCAGG + Intergenic
1115876207 14:37864867-37864889 CTCTGGAAACTTTGGCTTTAGGG + Intronic
1115949789 14:38708121-38708143 CTCTTGGAGCAGTGGCACTAAGG + Intergenic
1117086472 14:52206910-52206932 CTCAGGATGCATTGGCTCTCTGG - Intergenic
1119654463 14:76407368-76407390 CTCTGGAACCATGGGCTCTAGGG - Intronic
1120148897 14:81010739-81010761 CTCTAGAAGTATTGTCTTTAAGG - Intronic
1121798153 14:96752760-96752782 CTCTCAAAGCGTTGGAGCTATGG + Intergenic
1127379507 15:58418978-58419000 CTCTCTCAGCATGGGCTCCAGGG + Intronic
1127435873 15:58957665-58957687 CTCTCGAAGCATTGGCTCTATGG - Intronic
1133284618 16:4684817-4684839 CTCCCTAAGCAGTGGCTCTGGGG - Intronic
1133996232 16:10750713-10750735 CTTTCGAAGCCTTGGCTGTCTGG - Intronic
1135195584 16:20391744-20391766 CTCTCTCAGCATTCGCTATATGG - Intronic
1140222039 16:73050654-73050676 CTCTGGAAGCCCTGGCTCTTCGG + Intronic
1143530135 17:7497920-7497942 CTCTCGAAGCCTTGCCACTGAGG - Intronic
1145779216 17:27550976-27550998 ATCTGGAAGCATTGGCTGTGTGG + Intronic
1151364271 17:73606965-73606987 CTCAAGAAGCATTGGCTCTTGGG - Intronic
1158737422 18:60099010-60099032 CACAGGAAGCATAGGCTCTAGGG - Intergenic
928797312 2:35038159-35038181 CTCTCAAAGCATTGGTATTATGG + Intergenic
929191699 2:39146336-39146358 CTCTTGGATCATTTGCTCTAGGG - Intergenic
930331820 2:49994925-49994947 CTCTCGCAGCATTGGATGTGAGG - Intronic
937269324 2:120637990-120638012 CTTTCCAGGCACTGGCTCTAGGG + Intergenic
940488156 2:154323018-154323040 CCCTTGAAACATTTGCTCTAGGG - Intronic
945190961 2:207186975-207186997 TTCTTGCAGCATTTGCTCTAGGG - Intergenic
1173006494 20:39143280-39143302 CACTGGAAGCAGTGGCCCTAGGG + Intergenic
1175351820 20:58327530-58327552 CTCTTGAATCATTTGCTCTGTGG - Intronic
1180021564 21:45131682-45131704 CTCTCGAAGCCTTGACTGAAAGG + Intronic
1184704114 22:46198518-46198540 TTCTGGAAGCTTTGGCTTTACGG + Exonic
967311020 3:188106277-188106299 CTCTCCAGGCACTGGCTCCAGGG + Intergenic
970981485 4:22103814-22103836 CTCTGGGAGCCTTGGCTCTGAGG + Intergenic
973849733 4:54949079-54949101 CACTCCAATCATTGGCTCCATGG + Intergenic
974470272 4:62310032-62310054 CTCTGGAAGCTTTGTCTCAAAGG - Intergenic
978121075 4:105079969-105079991 GTCTATAAGCATTGGCCCTAAGG + Intergenic
980444009 4:132883588-132883610 ATCTCCAAGCCTTGGCTCTTTGG + Intergenic
986163841 5:5255568-5255590 CTCTGGAAGCAGTGGATGTAAGG - Intronic
988351420 5:30113050-30113072 CTGTCTAAACTTTGGCTCTAAGG - Intergenic
988587565 5:32521289-32521311 CTCCCCAAGCAGTGGGTCTAAGG + Intergenic
988893836 5:35650483-35650505 CTCTCTAACCATAGGCTCTGTGG + Intronic
991085609 5:62646006-62646028 TTCTCTAAGCATGGGCTCTAAGG - Intergenic
993586088 5:89730177-89730199 CTCTCAATGCATTGGCTTTGAGG - Intergenic
994305222 5:98195080-98195102 CTCTCTAAGCACTGGGTCTCTGG - Intergenic
997679382 5:135738607-135738629 CTCTCTAAGCCTTGGCTGTCTGG + Intergenic
1001594981 5:172892496-172892518 CTCTCGGAGCCTTGGGTCTCAGG + Intronic
1016488309 6:144567417-144567439 CTCTCAAAGAAATGGCTCTGTGG + Intronic
1018160656 6:161038996-161039018 CTCTCAAAACACTGGCTCTGAGG - Intronic
1021779137 7:24084727-24084749 CTCAGGAAGCTTTTGCTCTATGG + Intergenic
1023366441 7:39468937-39468959 TTCTCTAACCATTGACTCTAAGG + Intronic
1025034154 7:55582548-55582570 CTCTGGAAGCTTTGTCTCTGAGG + Intergenic
1030451327 7:109716450-109716472 TTCCTGAAGCATTGGCTGTAGGG + Intergenic
1032458969 7:132095239-132095261 CTCTGGAGACATTGCCTCTATGG - Intergenic
1035554593 8:556786-556808 CTCTGTAAGCATTGGCTCTTTGG + Intergenic
1055925946 9:81509880-81509902 CTCTTCTTGCATTGGCTCTAAGG - Intergenic
1060656792 9:125377473-125377495 CTCTGGAAGCATTCGCACGATGG + Intergenic
1062365465 9:136206191-136206213 CTATCGAATCATTGGCTTTTGGG - Intergenic
1187568174 X:20473846-20473868 CTCTTGAATCACTTGCTCTAAGG - Intergenic
1189018621 X:37310714-37310736 CTCTAGAATCCTTGACTCTATGG + Intergenic
1196844575 X:119888186-119888208 CTCTGGAAGCATCGGGACTATGG - Intergenic
1201952949 Y:19585809-19585831 CTCTGGAAGCTTTGTCTCTGAGG + Intergenic