ID: 1127449821

View in Genome Browser
Species Human (GRCh38)
Location 15:59105453-59105475
Sequence CGGGGAAAGGCGGGCCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 364}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127449821_1127449840 21 Left 1127449821 15:59105453-59105475 CCTCTCCGGCCCGCCTTTCCCCG 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1127449840 15:59105497-59105519 ACCCCTCCCTGCCCCGGGGTGGG 0: 1
1: 0
2: 2
3: 43
4: 323
1127449821_1127449834 15 Left 1127449821 15:59105453-59105475 CCTCTCCGGCCCGCCTTTCCCCG 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1127449834 15:59105491-59105513 CCCCTAACCCCTCCCTGCCCCGG 0: 1
1: 0
2: 6
3: 90
4: 662
1127449821_1127449836 16 Left 1127449821 15:59105453-59105475 CCTCTCCGGCCCGCCTTTCCCCG 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1127449836 15:59105492-59105514 CCCTAACCCCTCCCTGCCCCGGG 0: 1
1: 0
2: 5
3: 112
4: 748
1127449821_1127449838 17 Left 1127449821 15:59105453-59105475 CCTCTCCGGCCCGCCTTTCCCCG 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1127449838 15:59105493-59105515 CCTAACCCCTCCCTGCCCCGGGG 0: 1
1: 0
2: 1
3: 26
4: 337
1127449821_1127449839 20 Left 1127449821 15:59105453-59105475 CCTCTCCGGCCCGCCTTTCCCCG 0: 1
1: 0
2: 1
3: 31
4: 364
Right 1127449839 15:59105496-59105518 AACCCCTCCCTGCCCCGGGGTGG 0: 1
1: 0
2: 3
3: 57
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127449821 Original CRISPR CGGGGAAAGGCGGGCCGGAG AGG (reversed) Intronic
900299567 1:1969994-1970016 CTGGGAAAGGCGAGACTGAGCGG + Intronic
900582411 1:3415648-3415670 CGGAGCAAGCCGGGCGGGAGAGG + Intronic
900759290 1:4460351-4460373 CTGGGACAGGCTGGCCAGAGGGG - Intergenic
901016724 1:6236098-6236120 CGGGGAGGGGCGGGCGGGCGGGG - Intergenic
901051326 1:6427156-6427178 CTGGGCAAGGCGGGGCAGAGAGG + Intronic
901791302 1:11654848-11654870 CGGGGCCTGGCGGGCCGGGGCGG + Exonic
903643510 1:24876356-24876378 CGGGGAGGGGCGGGGCGGGGCGG + Intergenic
906063314 1:42962317-42962339 AGGGGAAAGGGGAGCAGGAGGGG + Intergenic
906168951 1:43707750-43707772 GGGGGAGGGGCGGGGCGGAGCGG - Intronic
906341733 1:44986722-44986744 GGAGGGAAGGCGGGCCGGAGGGG + Intronic
907069313 1:51519376-51519398 CGGGGCCAGGCGGGGCGGGGCGG - Intergenic
907357708 1:53889907-53889929 GGGAGAAGGGCGGGCGGGAGCGG - Intergenic
907364207 1:53946103-53946125 TGGGGAAAGGCGCACAGGAGTGG - Exonic
908862725 1:68507881-68507903 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
911085003 1:93968944-93968966 GGGGGATAGGTGGGCAGGAGTGG + Intergenic
911158746 1:94661490-94661512 AGGGGAAAAGTGGGCTGGAGGGG + Intergenic
911504536 1:98732355-98732377 AGGGGAAAAGTGGGCTGGAGGGG + Intronic
911591890 1:99758035-99758057 AGGGGAAAAGTGGGCTGGAGGGG + Intronic
912687058 1:111775980-111776002 TGGGGAAAGGGGGGAGGGAGTGG + Exonic
913232445 1:116751813-116751835 AGGGGAAAAGCTGGCCAGAGGGG - Intergenic
913356587 1:117929403-117929425 GGAGGGAAGGCGGGGCGGAGAGG - Intronic
913526986 1:119702993-119703015 CGGGGAAAAGTGGACTGGAGGGG - Intronic
915593814 1:156885102-156885124 CGGGGCAAGGAGGGGCAGAGAGG + Intergenic
916065527 1:161132673-161132695 AGGGGACAGGCGGGCGGGGGTGG + Intronic
916802142 1:168225859-168225881 GGGGGCGCGGCGGGCCGGAGGGG - Intergenic
919927446 1:202199572-202199594 GGGGGGAAGGCGGGGTGGAGTGG - Intronic
921325415 1:213983103-213983125 CTAGGAAGGGCGGGCCGGGGAGG + Intergenic
921708694 1:218352088-218352110 CAGGGGGAGGCGGGCTGGAGTGG - Intronic
921991596 1:221372883-221372905 GGGGGCATGGCGGGCCAGAGTGG + Intergenic
922314988 1:224434462-224434484 CGGGGTGAGGGGGGCCGGGGAGG + Intronic
922333883 1:224603061-224603083 AGGGGAAAAGCAGGCTGGAGGGG + Intronic
922612177 1:226938933-226938955 AGGGGAAAAGCAGGCTGGAGGGG + Intronic
922698100 1:227741725-227741747 AGGGGAATGGCTGGCCGGCGTGG + Intronic
923456308 1:234168516-234168538 CTTGGAACGGCGGCCCGGAGAGG - Intronic
924539853 1:244970634-244970656 CGGGGCGGGGCGGGGCGGAGCGG - Exonic
1063113071 10:3053487-3053509 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113079 10:3053505-3053527 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113100 10:3053559-3053581 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113108 10:3053577-3053599 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113116 10:3053595-3053617 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113124 10:3053613-3053635 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113145 10:3053667-3053689 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113153 10:3053685-3053707 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063113161 10:3053703-3053725 AGGGGAAGGGTGGGCTGGAGGGG - Intergenic
1063165188 10:3455330-3455352 CTGGGAAATGCGGTCCGGTGGGG + Intergenic
1063455256 10:6178432-6178454 AGGGGAAACGCAGGCAGGAGAGG + Intronic
1064011875 10:11742336-11742358 CGGGGAGGGGCGTGCCGGGGCGG + Intergenic
1065483593 10:26216676-26216698 CGGGGACCGGCGGGGCCGAGCGG - Exonic
1066220845 10:33335445-33335467 AGGGGAAAGCCGGGCTGGAGTGG + Intronic
1068196768 10:53727181-53727203 GGGAGAATGGCGGGCCAGAGTGG + Intergenic
1069329896 10:67279461-67279483 AGGGGGAAAGCGGGCTGGAGGGG + Intronic
1069635982 10:69925183-69925205 AGGGGAAAAGCAGGCTGGAGGGG + Intronic
1070206982 10:74273743-74273765 CGGGGAGAGGCCGGGCGCAGTGG - Intronic
1075871322 10:125774128-125774150 GGGGCGAAGGCGGGGCGGAGGGG + Exonic
1076402631 10:130193814-130193836 AGGGGGAAGGCGGGCGGGGGAGG - Intergenic
1076760551 10:132603951-132603973 CGGCGCAGGGCGGGACGGAGAGG - Intronic
1076895256 10:133308502-133308524 CGGGGCAAGGCGGACGGGAGAGG + Exonic
1077023438 11:429825-429847 GGGTGATAGGTGGGCCGGAGAGG + Intronic
1077083657 11:736496-736518 AGGGGAAAGCAGGGCCGGGGTGG + Intergenic
1077102210 11:827374-827396 CGGGCCACGGCGGCCCGGAGGGG - Intronic
1077240778 11:1509306-1509328 CGGGGTAAGGCTGGCCTCAGGGG - Intergenic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077505761 11:2929457-2929479 CGGGGAGGGGCGGGGCGGGGAGG - Intergenic
1077539397 11:3139481-3139503 CTGGGAAAGGCAGGGAGGAGTGG + Intronic
1077870657 11:6259442-6259464 CGGGGAAGGGAGGGTAGGAGGGG - Intergenic
1079413114 11:20208400-20208422 TTGGGAAAGGCGAGCCTGAGAGG + Intergenic
1079438238 11:20480036-20480058 GGGGGAAAGGCTGGGCGCAGTGG + Intronic
1081770693 11:45649145-45649167 CAGGCAAGGGCGGGCAGGAGGGG + Exonic
1082081998 11:48019352-48019374 CGGGGGAAGGTGGGGTGGAGGGG - Intronic
1083583255 11:63838845-63838867 CGGGGAAAGGCCGGTGGGCGTGG + Intergenic
1083958845 11:66002727-66002749 CGGGAAGGGGCGGGCCGCAGCGG + Intronic
1084042274 11:66549094-66549116 TGGTGAGAGGCAGGCCGGAGGGG - Intronic
1084079358 11:66810529-66810551 AGGGGAAACGCAGGCTGGAGAGG + Intronic
1084215539 11:67645237-67645259 CGGGGCCAGGAGGGCTGGAGGGG - Intronic
1084286970 11:68138136-68138158 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1084421861 11:69064299-69064321 CGGGGAAGGGCGGGGAGGGGCGG - Intronic
1085082860 11:73648333-73648355 TGGGGAAACGGGGGCCGGAAAGG - Intronic
1085318742 11:75561906-75561928 CGGGGAAAGGGGCGCCTGAAAGG + Intergenic
1087172697 11:95067106-95067128 CCGGGAAAGGCCGGGCGGAGAGG - Intergenic
1089309997 11:117551691-117551713 TGGGGAAAGGGGGTCTGGAGGGG + Intronic
1090404048 11:126466739-126466761 CAGGGAAGGGAGGGGCGGAGTGG - Intronic
1091741041 12:2960224-2960246 GGGGGAAAGGGAGGCCGGTGTGG + Intronic
1091759413 12:3077296-3077318 CGGGGAGGGGCGGGGCGGAGCGG - Intergenic
1092305637 12:7297860-7297882 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1092843238 12:12562551-12562573 GGGGGAAAGGCGGGGGGGTGGGG + Intergenic
1094240165 12:28213148-28213170 GGGGGAAAGGAGGGGCAGAGGGG - Intronic
1096127614 12:49131236-49131258 CAGGGAAAAGCGAGCCGGCGGGG - Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096466346 12:51849111-51849133 CCGGGAGAGGCGGGGCGGACGGG - Intergenic
1097090574 12:56501287-56501309 CGGGAAAGGGCGGGGCGGGGGGG - Intergenic
1097698559 12:62798201-62798223 AGGGGAAAAGTGGGCCGGAGGGG + Intronic
1099383882 12:81990173-81990195 GGGGGAAAAGTGGGCTGGAGGGG + Intergenic
1100146310 12:91681941-91681963 CGGGGTGGGGCGGGGCGGAGGGG - Intergenic
1100256269 12:92886470-92886492 AGGGGAAAGGAGGGGAGGAGAGG + Intronic
1100966517 12:100019173-100019195 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1102084362 12:110124213-110124235 CGGGGCGGGGCGGGGCGGAGCGG - Intergenic
1103730176 12:123022150-123022172 CGGGGAAGGGCGGTGAGGAGGGG + Intronic
1103738840 12:123078066-123078088 GGGAGAAAGGCAGGCCGGAGAGG + Intronic
1104429575 12:128705593-128705615 CGGGGGCAGGCTGGCAGGAGAGG + Exonic
1106108961 13:26760532-26760554 CGGGGACAGGCGGCCCGCGGGGG + Intronic
1106415670 13:29543854-29543876 CGGGGACATGCGGGGAGGAGAGG + Intronic
1106446155 13:29833229-29833251 CGGTGGAAGGCGGACCGCAGTGG + Intronic
1108579286 13:51815043-51815065 TGGGGAAAGGAGGGTGGGAGAGG + Intergenic
1111333629 13:86792599-86792621 CGGGGAAGGGTGGGGCGGTGGGG + Intergenic
1111418860 13:87983832-87983854 AGGGAAAATGCGGGCTGGAGGGG - Intergenic
1112621912 13:101061913-101061935 CGGGGCAGGGCGGGGCGGGGCGG + Intronic
1113024295 13:105923212-105923234 GGGGGAAAGGGGGGCGGGGGGGG + Intergenic
1113727455 13:112615652-112615674 CGGGGCAAGGCGGGGCAGTGCGG + Intergenic
1113893016 13:113746396-113746418 AGGGGAAATGCAGGCTGGAGGGG - Intergenic
1116013837 14:39382508-39382530 AGGGGAAAAGCAGGCTGGAGGGG + Intronic
1116075059 14:40100825-40100847 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1116075067 14:40100845-40100867 AGGGGAAGGGAGGGCAGGAGAGG - Intergenic
1120993384 14:90397631-90397653 TGGGGAGGGGCGGGCCGGGGGGG - Intronic
1121226101 14:92323095-92323117 GGGTGAGAGGCGGGCAGGAGGGG + Intronic
1122458862 14:101879157-101879179 CGGGGGAGGGCGGGCAAGAGGGG - Intronic
1122637897 14:103138799-103138821 CGGGGACAGGGCGGGCGGAGCGG + Intergenic
1122802371 14:104238092-104238114 GGAGGAAGGGCGGGCAGGAGAGG + Intergenic
1123162921 14:106297234-106297256 CGGGGAGTGGGGGGCTGGAGGGG - Intergenic
1123505227 15:20935654-20935676 CGGGGAAGGGGGGGCGGGGGCGG + Intergenic
1123562466 15:21509350-21509372 CGGGGAAGGGGGGGCGGGGGCGG + Intergenic
1123598711 15:21946637-21946659 CGGGGAAGGGGGGGCGGGGGCGG + Intergenic
1123950461 15:25267576-25267598 AGGGGAAAAGTGGGCTGGAGGGG + Intergenic
1125200849 15:37099755-37099777 GGGGGAAAGGAGGACCGAAGAGG - Exonic
1127449821 15:59105453-59105475 CGGGGAAAGGCGGGCCGGAGAGG - Intronic
1128836029 15:70809850-70809872 TGGGGAAAGGTGGGAAGGAGAGG + Intergenic
1129052807 15:72796899-72796921 CGGGAAGAGGCGGGCGGGCGGGG - Intergenic
1129221676 15:74135000-74135022 CGGGAATGGGCGGGCCGGACGGG - Exonic
1129710756 15:77819300-77819322 CGGGGGATGCCGGCCCGGAGCGG - Intronic
1129752688 15:78077161-78077183 CAGGGAAAGGCAGGCCGACGTGG + Intronic
1131008728 15:88999784-88999806 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1132195371 15:99910648-99910670 AGGGGAAAAGCGGGCTGGAGGGG + Intergenic
1132915353 16:2340832-2340854 CGGGGTTGGGCTGGCCGGAGCGG - Intergenic
1134104326 16:11475146-11475168 AGGGGAAAAGCGGGCTGGAGGGG - Intronic
1134134044 16:11668332-11668354 CGGGGCGGGGCGGGCCGGGGCGG - Intergenic
1136016864 16:27406046-27406068 TGGGGAAAGGAGGCCCAGAGAGG - Intronic
1136540114 16:30924073-30924095 TGGGGAGAGGCGGGGCGGGGTGG + Intronic
1136579293 16:31142306-31142328 CTGGGGAAGGCGGGTCCGAGTGG - Intronic
1136588419 16:31202378-31202400 AGGGGAAAGACGGGGTGGAGGGG + Intronic
1137767830 16:50991506-50991528 CGGGAAGAGGGGGGCAGGAGAGG + Intergenic
1141045837 16:80715569-80715591 GGAGGAAAGGGAGGCCGGAGGGG - Intronic
1141180965 16:81753151-81753173 CGGGGAGAGGCAGGGCCGAGGGG - Intronic
1142697822 17:1643405-1643427 CGGGGACAGGTGGGCTGGCGGGG - Intronic
1143613990 17:8038989-8039011 CGGGGAGGGGCGGGGCGGAGAGG - Intergenic
1143986690 17:10920714-10920736 CGGGGAAGGGGAGGGCGGAGAGG + Intergenic
1144705878 17:17367545-17367567 CGAGGGAAGGGAGGCCGGAGGGG + Intergenic
1144729810 17:17519831-17519853 CGGGGCAGGGCTGGCAGGAGGGG + Intronic
1144858128 17:18282028-18282050 CGGGGAAAGACGAGGTGGAGGGG - Intronic
1146001655 17:29133952-29133974 AGGGGAAAGGAGGGATGGAGTGG + Intronic
1146283337 17:31559152-31559174 GGGCGAAGGGCGGGCCGGGGCGG + Intergenic
1146809872 17:35894535-35894557 AGGTGAAAGGAGGGCAGGAGAGG + Intergenic
1146955009 17:36932366-36932388 CGGGGAAATGCGGGGAGAAGTGG - Intergenic
1147051904 17:37801381-37801403 CAGGAGAAGGGGGGCCGGAGGGG + Intergenic
1147266197 17:39236503-39236525 CGGGGAGAGGAGGGTAGGAGGGG - Intergenic
1147663554 17:42130486-42130508 CGGGCAATGGCGGGTCGGGGAGG - Exonic
1147742821 17:42678365-42678387 CGGGGAAGGGCGGGACGGGCGGG + Intergenic
1147967006 17:44199262-44199284 CGGGGCAGGGCCGGCCGGGGAGG - Intronic
1147967230 17:44199784-44199806 CCGGGAGAGGCGGGCTGGAGTGG - Intronic
1148113531 17:45161406-45161428 CGGGGAGAGGCCGGGCCGAGTGG - Intronic
1148195494 17:45709908-45709930 CTGGGAATGGCAGGCTGGAGTGG + Intergenic
1148859095 17:50594840-50594862 CGGGGAATGGGGGGGCAGAGAGG - Intronic
1149651269 17:58278070-58278092 CGGGGCAAGCCGGGCAGGAGCGG + Exonic
1150561916 17:66302310-66302332 CGGGGGAGGGCCGGCCCGAGTGG - Intergenic
1151553323 17:74834425-74834447 CGGGGACAGGAGGGGAGGAGGGG - Intronic
1151699651 17:75736537-75736559 CGGGGAAAGGCGGGGCAGACAGG - Intronic
1151816595 17:76474257-76474279 CTGGGAAAGGTGGGGCGGGGAGG + Intronic
1152208056 17:78986767-78986789 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1152521057 17:80857251-80857273 CTGGGAAAGGCAGGGAGGAGCGG - Intronic
1152835600 17:82528690-82528712 CGAGGAAAGCAGGGCCGCAGGGG - Intronic
1152843637 17:82586240-82586262 AGGTGAAAGGTGGGCCGGGGGGG + Intronic
1153024017 18:657615-657637 CGGGAAAAGGCGCGCGGAAGGGG + Exonic
1154299517 18:13180942-13180964 AGGGGAAAAGTGGGCTGGAGGGG - Intergenic
1155663546 18:28280180-28280202 AAGGGAAAGGCAGGCAGGAGAGG + Intergenic
1157280608 18:46344435-46344457 CGGGCACAGGCAGCCCGGAGGGG - Intronic
1157544807 18:48539915-48539937 CGGGGAAGGGAGGGGCGGCGTGG - Intronic
1159985935 18:74841028-74841050 AGGTGAAAGGTGGGCCTGAGAGG - Intronic
1160716271 19:578218-578240 CGGGGCACAGCGGGACGGAGAGG - Intronic
1160751443 19:736282-736304 CGGGGAAGCGTGGGCCGGCGTGG - Intronic
1160830698 19:1103843-1103865 CGGGGAAGGGGGGGCGGGACCGG - Intergenic
1160881366 19:1322223-1322245 CGGGGAAAGGAGGGGTGAAGGGG + Intergenic
1160947795 19:1651802-1651824 CGGGGCCGGGCGGGCCGGGGGGG - Intronic
1161204995 19:3036325-3036347 CGGGAGAGCGCGGGCCGGAGAGG - Intronic
1161233294 19:3186264-3186286 TGGGGATCGCCGGGCCGGAGTGG - Intronic
1161582921 19:5090640-5090662 GGGGGAAGGGGGGGCCGGAGGGG - Intronic
1162396464 19:10420461-10420483 CGGGGAGGGGCGGGACGGGGCGG + Intronic
1162798496 19:13098665-13098687 CGGGGCGGGGCGGGGCGGAGAGG - Intronic
1163442416 19:17328666-17328688 CGGGGGAAGGCGGGGAGGAGGGG - Exonic
1164643848 19:29844492-29844514 CGGGGAGACGCGGGGCGGGGCGG - Intergenic
1165152116 19:33766981-33767003 CTGGGGAAGGAGGGCAGGAGCGG - Intronic
1165172374 19:33903186-33903208 CGGGGAGGGGCGGGGCGGGGCGG + Intergenic
1165421630 19:35724911-35724933 GGGGGAAAGGCGGTGAGGAGAGG + Intronic
1165624289 19:37271589-37271611 CGGAGTAAGGGGGGCTGGAGCGG - Intergenic
1165625906 19:37279179-37279201 CGGAGTAAGGGGGGCTGGAGCGG - Intergenic
1166373144 19:42313515-42313537 CGGGGGCCGGCGGGCCGCAGAGG - Intronic
1166565600 19:43763638-43763660 GGGGGAAAGGCGGTCCAGAGAGG - Intergenic
1166959686 19:46490004-46490026 CGGGGAGAGGCGCGGCAGAGCGG - Intronic
1166984890 19:46653839-46653861 CGGGGAGAGGCTGGGCGCAGTGG - Intronic
926215999 2:10905696-10905718 TGGGGAAAGGAGGGCTGGAGAGG + Intergenic
926420147 2:12687807-12687829 AGGGGAAAAGAGGGCTGGAGGGG + Intergenic
927168779 2:20351017-20351039 CGGGGGAGGGCACGCCGGAGAGG - Intronic
928421203 2:31138683-31138705 TGGGGCAAGGCGGGGCGGGGCGG + Intronic
928604396 2:32932098-32932120 CGGGGGAAGGGGGACAGGAGAGG - Intergenic
930411261 2:51028376-51028398 AGGGGAAAGGCGGGAGTGAGAGG + Exonic
930847544 2:55922526-55922548 CGAGGAAAGGAGGGTGGGAGAGG + Intronic
930971859 2:57406150-57406172 CCTGGAAAGGCAGGCAGGAGTGG - Intergenic
931671767 2:64654001-64654023 CGGGGAGAGGCGGGCCGGGGCGG - Intronic
935106158 2:100045607-100045629 AGGGGAAAGGGAGGCAGGAGAGG - Intronic
937094125 2:119224512-119224534 TGGGGACAGGCTGCCCGGAGAGG + Intronic
937368915 2:121284708-121284730 GGGGGAGAGGAGGGCCGCAGGGG + Intronic
938413893 2:131088413-131088435 GGGGGAAAAGGGGGCGGGAGAGG + Intronic
939990672 2:148875188-148875210 CAGGGGAGGGCGGGGCGGAGGGG + Intergenic
940145684 2:150542508-150542530 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145694 2:150542526-150542548 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145704 2:150542544-150542566 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145714 2:150542562-150542584 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145724 2:150542580-150542602 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145734 2:150542598-150542620 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145744 2:150542616-150542638 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
940145754 2:150542634-150542656 CGGGGAGAGGCGGGGGGGCGGGG + Intergenic
941029425 2:160493862-160493884 GGGGGAAGGGCGGGCGGGGGCGG + Intergenic
946145144 2:217725026-217725048 AGGGGAAAGTCTGGCCTGAGGGG + Intronic
946312854 2:218892504-218892526 GCTGGAAAGGCGGGCAGGAGAGG + Intronic
947249115 2:228081275-228081297 AGGGGAAAAGCAGGCTGGAGGGG - Intronic
1169092560 20:2870656-2870678 AGGGGAAAGGAGGCCCCGAGAGG + Intronic
1169271897 20:4206703-4206725 AGGGGAAAAGTGGGCTGGAGAGG - Intergenic
1170578760 20:17682483-17682505 TGGGGAGAGGCGGGGCCGAGCGG + Intergenic
1171349631 20:24492645-24492667 CGGGGGAAGGAGGGGTGGAGGGG - Intronic
1171977683 20:31605854-31605876 CGGGGAAACGGAGGCCAGAGAGG + Intronic
1172284688 20:33732254-33732276 CGGGGAGAGCCAGGCCGGCGGGG + Intronic
1173377551 20:42501090-42501112 CGGGGAAAGGCGTGATGGGGTGG - Intronic
1174296696 20:49550373-49550395 GGGGGAAAAGTGGGCTGGAGGGG - Intronic
1175699585 20:61127398-61127420 CTGGGAAAGTCGGGGCTGAGTGG - Intergenic
1176148087 20:63574284-63574306 CGGGGCAGGGCGGGGCGGGGCGG - Intergenic
1176419265 21:6500747-6500769 AGGGGAAAAGTGGGCTGGAGGGG + Intergenic
1178414520 21:32393063-32393085 CGGGGAAAGGCCGGCGGAAGGGG + Intergenic
1178488575 21:33033747-33033769 CGGGGAAGCGAGGGCCGGAGAGG - Intergenic
1178824658 21:36005017-36005039 AGGGGAAAGGGGGGAGGGAGAGG + Intergenic
1179647539 21:42784764-42784786 CGGGGTAAGGTGGGTTGGAGTGG - Intergenic
1179694758 21:43109069-43109091 AGGGGAAAAGTGGGCTGGAGGGG + Intergenic
1179824111 21:43954420-43954442 TGGGGGCAGGCGGGCGGGAGAGG + Intronic
1179919133 21:44497989-44498011 AGGGGAAAAGCCGGCTGGAGGGG + Exonic
1179948895 21:44698568-44698590 CGGGGAAATGTGGGGCGGTGGGG - Intronic
1180201973 21:46229485-46229507 AGGGGGAGGGCGGGGCGGAGCGG + Intergenic
1180782831 22:18530227-18530249 GGGCGAAAGGCGGGCAGGTGGGG - Intronic
1181041435 22:20194441-20194463 CCGGGAAAGGCAGGGCAGAGGGG - Intergenic
1181113055 22:20613080-20613102 TGGGGAGAGGCGAGGCGGAGGGG + Intergenic
1181486209 22:23233285-23233307 AGGAGAAAGGCCGGCAGGAGTGG - Intronic
1181637553 22:24181391-24181413 CGGGGAGGGGCGGGGCGGGGCGG + Exonic
1182446450 22:30392564-30392586 AGGGGAGGGGAGGGCCGGAGGGG - Intronic
1183705072 22:39471031-39471053 CAGGAAAAGCCGGGCAGGAGGGG - Intronic
1184664353 22:45979263-45979285 CGGAGAAGGGCGGGGCTGAGCGG + Intergenic
1184712748 22:46262831-46262853 CGGGGAGACGCGGGCCGCGGGGG + Exonic
1184865422 22:47199434-47199456 CAGGGACAGGAGGGCCGGCGTGG - Intergenic
1185349468 22:50327008-50327030 CGGGGAAACGCGGGCGGGGGCGG + Exonic
950012293 3:9732046-9732068 CGGGGAAAGTCGGGCCGGGAAGG - Exonic
951080497 3:18445356-18445378 TGGGGGGCGGCGGGCCGGAGGGG + Intronic
952152477 3:30607307-30607329 CGGGGAGCAGCGGCCCGGAGCGG + Intronic
953142939 3:40246288-40246310 AGGGGAAAAGTGGGCAGGAGCGG + Intronic
953158707 3:40398378-40398400 CGTGGCAGGGCGGGCTGGAGTGG + Intronic
953979515 3:47406635-47406657 CGGGGCAGGGCGGGGCTGAGTGG + Intronic
954906278 3:54065816-54065838 CAGGGAAAGGAGAGACGGAGAGG + Intergenic
956761314 3:72447236-72447258 CGGGGGAAGGCGGGGCGTGGCGG + Intergenic
956913632 3:73847416-73847438 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
957039504 3:75326630-75326652 CGTGGAAAGGGAGGCTGGAGTGG + Intergenic
964526148 3:157616807-157616829 TGGGGAAAGCTGGGCCTGAGGGG - Intronic
965596977 3:170419643-170419665 CGGGGGAGGCCGGGCGGGAGCGG - Intronic
966945277 3:184773437-184773459 CGAGGGCAGGCGGGCCGGGGAGG - Intergenic
967236948 3:187394074-187394096 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
968047019 3:195630204-195630226 CGGGGAGGGGCGGCCCTGAGTGG + Intergenic
968178262 3:196569397-196569419 CGTGGAAAGGCGGGCTGGTGAGG - Intronic
968307632 3:197659840-197659862 CGGGGAGGGGCGGCCCTGAGTGG - Intergenic
968516592 4:1018118-1018140 CGGGGAAGGGCAGGCCGCAGGGG + Intronic
968803246 4:2756438-2756460 CGGGGAAGGGCGGGGCTGCGCGG - Intergenic
969267190 4:6072220-6072242 AGGGGAAAAGCGGGCTGGAGGGG - Intronic
969390240 4:6887365-6887387 AGGGGAAAAGTGGGCTGGAGGGG + Intergenic
970593352 4:17577867-17577889 CGGGGAAAGACGCGGCGGTGGGG + Intronic
970823759 4:20250968-20250990 GGGGGAAAGGGGGGCGAGAGAGG + Intergenic
972686897 4:41360723-41360745 CGGGGAGAGGCGGGGAGGGGAGG + Intronic
974833411 4:67216454-67216476 AGGGGAAAGGAGGGGGGGAGGGG + Intergenic
975756988 4:77580774-77580796 AGGGGAGAGGAGGGCAGGAGAGG - Intronic
978600188 4:110419248-110419270 TGGGGCAGGGCGGGGCGGAGGGG + Intronic
981528799 4:145733174-145733196 CGGGAAGAGGCGGACCGGGGAGG - Intronic
981532413 4:145765206-145765228 CGGGGAGAGGAGGGCAGGAGTGG + Intronic
982414620 4:155114857-155114879 AGGGGAAAAGTGGGCTGGAGGGG + Intergenic
982551222 4:156802075-156802097 AGGGGAAAGGTGGGCTAGAGGGG - Intronic
982790797 4:159589163-159589185 TGGGCAAAGGCAGGCTGGAGTGG + Intergenic
983172309 4:164549813-164549835 AGGGGAAAAGTGGGCTGGAGGGG - Intergenic
983528943 4:168790053-168790075 CGGAGAGAGGCAGGCCAGAGAGG - Intronic
984206583 4:176793122-176793144 CGGGGAGCGGGCGGCCGGAGGGG + Intergenic
984984915 4:185319056-185319078 AGGGGAAAAGTGGGCTGGAGGGG - Intronic
985034367 4:185823170-185823192 AGGGGAAAAGGAGGCCGGAGGGG - Intronic
985067024 4:186132591-186132613 AGGGGAAAAGCAGGCTGGAGGGG + Intronic
985639020 5:1054497-1054519 TGGGGAAACGCTGGGCGGAGGGG + Intronic
986451416 5:7869274-7869296 CTGGGAGAGGCGGCCCGGGGCGG + Intronic
987005657 5:13707003-13707025 CGGGGCATGGTGGGCCAGAGTGG - Intronic
987050212 5:14142908-14142930 CGGGGTGACGCGGGCCGGGGCGG - Intergenic
987051939 5:14154235-14154257 CGGGGAGAGGCTGGCCAGGGAGG + Intronic
987434737 5:17881307-17881329 GGGGGAAAGGTGGGACAGAGAGG - Intergenic
988577781 5:32444050-32444072 CCGGGCAAGGCGGGGCGGGGCGG + Intronic
991562094 5:67964612-67964634 AGGGGAAAAGCAGGCTGGAGAGG + Intergenic
991997010 5:72397952-72397974 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
992104204 5:73436813-73436835 CGGGGCCCGGCGGGGCGGAGAGG - Intergenic
996082172 5:119268627-119268649 CGGGGCATGGCGGGGCGGAGTGG - Intergenic
996405438 5:123098828-123098850 CGGGGACAGGTGGGGCGGGGTGG - Intronic
998130647 5:139649632-139649654 CTGGGAAAGGAGGGAGGGAGGGG - Intronic
998194749 5:140058705-140058727 GGTGGAAAGGCAGGCAGGAGAGG - Intergenic
998331836 5:141334474-141334496 CGGGGAGGGGCGGGGCGGGGCGG + Intronic
998366780 5:141637299-141637321 AGGGGACAGGCGGTCCGGCGTGG - Exonic
999154624 5:149449728-149449750 CAGGGAAGGGCTGGCCGGGGAGG - Intergenic
1000341547 5:160280741-160280763 GGAGGACAGGCGGGGCGGAGGGG + Intronic
1002654666 5:180735236-180735258 TGGGCAAAGGCGGCCCGGTGCGG - Intergenic
1003094459 6:3131645-3131667 CGGGGAGGGGCTGGCAGGAGGGG - Intronic
1003498742 6:6687042-6687064 CCTGGAAAGGCGGACTGGAGGGG - Intergenic
1006107265 6:31724117-31724139 GGGGGAAAGGCGTGGCGGGGAGG - Intronic
1008160366 6:48068767-48068789 CGGGGAAAGACCAGGCGGAGTGG - Intergenic
1008629329 6:53348591-53348613 CGGGGAAAGGGGTGCGGGTGCGG - Intronic
1009808697 6:68634979-68635001 GGGGGAGAGGCTGGCGGGAGGGG - Intergenic
1013514825 6:110875671-110875693 CGGGGAATGGAGGGCGGGAGCGG + Intronic
1013777282 6:113692368-113692390 CAGGGGAAGGCGGGCAGGTGTGG + Intergenic
1014814225 6:125917729-125917751 GGGGGAAAAGTGGGCTGGAGAGG + Intronic
1014867605 6:126551119-126551141 GGGGGCATGGCGGGCCAGAGTGG + Intergenic
1015315025 6:131807953-131807975 CGGGGAGGGGCGGGGCGGGGCGG + Intergenic
1017011974 6:150069247-150069269 CGGGGAAGGGCGGGACGGGGCGG - Intergenic
1018959944 6:168441110-168441132 GGGAGAGAGGCGGGCGGGAGGGG + Intergenic
1019309194 7:352052-352074 TGGGGAGAGCCGGGCAGGAGGGG - Intergenic
1019319526 7:409287-409309 CTGGGAAAGCCGGGCCTCAGTGG - Intergenic
1019472835 7:1230267-1230289 CGGGGAAGGGCGCGGGGGAGGGG + Intergenic
1019498970 7:1355013-1355035 TGGGGATAGGCGGGCCTGCGGGG - Intergenic
1019504733 7:1385255-1385277 CGGGGCAGGGCAGGCCGGGGCGG + Intergenic
1020106128 7:5423192-5423214 CCGGGCCAGGAGGGCCGGAGCGG + Intronic
1021231018 7:18086641-18086663 CCGGGAGGCGCGGGCCGGAGGGG - Intergenic
1023021020 7:36011807-36011829 AGGGGAAGGGCCGGCAGGAGCGG - Intergenic
1023177428 7:37448086-37448108 GGGGGCCAGGAGGGCCGGAGAGG - Intronic
1025697885 7:63789616-63789638 CGGGGCCAGGCGGGCCAGCGCGG - Intergenic
1027189571 7:75989062-75989084 CGGGGGAAGGCTGGGTGGAGGGG + Intronic
1029110471 7:98211146-98211168 TGGGGAGAGGCGGGCGGGGGTGG + Intergenic
1029110498 7:98211209-98211231 TGGGGAGAGGCGGGCGGGGGAGG + Intergenic
1029735818 7:102465230-102465252 CGGGGACAAGCGGGCCGTTGGGG - Intronic
1030636629 7:111956729-111956751 AGGGAAAAGGCAGGCTGGAGGGG - Intronic
1031620201 7:123926270-123926292 AGGGGAAAAGCAGGCCGGCGGGG - Intronic
1031765599 7:125773139-125773161 CGGGGCATTGCGGGCCAGAGTGG - Intergenic
1033053695 7:138030309-138030331 AGGGGAAAAGTGGGCTGGAGGGG - Intronic
1033299744 7:140176150-140176172 GGGGCAGCGGCGGGCCGGAGAGG - Intronic
1033656843 7:143380872-143380894 CGGGTAACGGCAGGCCCGAGAGG + Intergenic
1034439977 7:151081439-151081461 CGGGAAGAGGCAGGCCGGAGAGG + Exonic
1034628450 7:152512226-152512248 AGGGGAAAGGCTGGGCGCAGTGG + Intergenic
1034829581 7:154297822-154297844 TGGGAAAAGGCGGGAAGGAGAGG + Intronic
1035321478 7:158032341-158032363 CGGGGAAGGAGGGGCAGGAGAGG - Intronic
1035403543 7:158584389-158584411 CAGAGAAAGGCGGGCCGGTCGGG + Intronic
1036386494 8:8286264-8286286 CGGGGAGAGGCTGGCAGAAGGGG + Intergenic
1036565390 8:9933884-9933906 CGAGGAGAGGCGTGCCGGGGTGG - Intergenic
1037788915 8:21919731-21919753 GGGGGGAGGGGGGGCCGGAGAGG + Exonic
1039516529 8:38138303-38138325 AGGGGAAATGCGGGCTGGAGGGG + Intronic
1044857926 8:96494655-96494677 AGGGGAAAGGGTGGCAGGAGGGG + Intronic
1049322725 8:142005602-142005624 CGGTGAAAGGTGGGAGGGAGTGG + Intergenic
1049488285 8:142877639-142877661 CAGGGAAGGGCGGGGAGGAGAGG - Intronic
1049493174 8:142915663-142915685 CGGGGAAGGGTGGGGAGGAGAGG - Intronic
1049541731 8:143211771-143211793 CAGGGAAGGGCGGGGCGGGGCGG + Intergenic
1049577595 8:143396932-143396954 CGGGACAGGGCAGGCCGGAGTGG - Intergenic
1049936335 9:504673-504695 CGGGGAAGGGCGGGGCGCAGGGG - Exonic
1050092338 9:2027683-2027705 AGTGGAATGGCGGGCTGGAGGGG - Intronic
1050304986 9:4298239-4298261 CGGGGACCGGGGGGCCGGCGTGG - Intronic
1050442025 9:5674758-5674780 AGGGGAAAAGTGGGCTGGAGGGG - Intronic
1052037962 9:23704883-23704905 CAGGGAAAGACTGTCCGGAGTGG + Intronic
1053293342 9:36896572-36896594 CAGGGAAGGGAGGGCTGGAGAGG - Intronic
1054870616 9:70044471-70044493 GGGGGAAAGACGAGCGGGAGGGG - Intronic
1055959499 9:81807150-81807172 TGGTGAAAGGCTGGCCGCAGTGG + Intergenic
1056827878 9:89889468-89889490 AGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1057174986 9:92989610-92989632 AGGGGAAAAGTGGGCTGGAGGGG + Intronic
1057586267 9:96331518-96331540 AGGGGAAAGGGTGGCAGGAGGGG - Intronic
1060024072 9:120156378-120156400 GGGGCAAAGGGTGGCCGGAGAGG + Intergenic
1060896939 9:127224581-127224603 ATGGGAAAGGAGGGCCCGAGGGG + Intronic
1061134411 9:128724942-128724964 TGTGGAAAGGCGGGGCTGAGTGG - Intergenic
1061190426 9:129079573-129079595 CGGGCAAAGTAGGGCAGGAGAGG + Intergenic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1062022670 9:134326700-134326722 CGGGGGCCGGCGGGCGGGAGGGG + Intronic
1062050539 9:134444499-134444521 CGGGGGAAGGAGGGAAGGAGGGG - Intergenic
1062050562 9:134444550-134444572 GGGGGAAAGGAGGGAGGGAGGGG - Intergenic
1062393238 9:136342374-136342396 AAGGAAAAGGGGGGCCGGAGTGG + Intronic
1062535255 9:137018503-137018525 AGGGGAAAGGTGGGCAGAAGTGG + Intronic
1185459817 X:328840-328862 AGGGGAGAGGTGGGGCGGAGAGG - Intergenic
1188478282 X:30610610-30610632 AGGGGAAAAGCAGGCTGGAGGGG - Intergenic
1189321563 X:40090448-40090470 CGGGGAGGGGCGGGGCGGGGCGG + Intronic
1189323456 X:40099221-40099243 CGGGGGCAGGCGGGAGGGAGGGG + Intronic
1189662180 X:43311775-43311797 TGGGCAATGGCGGGCGGGAGTGG + Intergenic
1189694907 X:43654476-43654498 CGGGGAGGGGCGGGGAGGAGCGG - Intergenic
1189694917 X:43654496-43654518 CGGGGAGGGGCGGGGAGGAGCGG - Intergenic
1189694927 X:43654516-43654538 CGGGGAGGGGCGGGGAGGAGCGG - Intergenic
1190010257 X:46778534-46778556 AGGGGAAAAGCAGGCTGGAGGGG - Intergenic
1190121030 X:47659218-47659240 TGGGGAGGGGCGGGCCTGAGTGG + Intergenic
1190712259 X:53079344-53079366 CCTGGAAAGGCAGGCCAGAGTGG + Exonic
1192437726 X:71153241-71153263 CGGGGCAAGGCGGTGCAGAGAGG + Intronic
1194750966 X:97683402-97683424 TGGGGAGAGGCGGGCCTGGGAGG + Intergenic
1195581022 X:106502789-106502811 AGGGGAAAAGCAGGCTGGAGGGG - Intergenic
1197854799 X:130903090-130903112 CGCGGAAAATCGGGCCGGCGCGG + Exonic
1197946137 X:131841319-131841341 TGGGGAAAGGGTGGCCAGAGAGG - Intergenic
1199827259 X:151512805-151512827 TGGGGAAAAGCAGGCTGGAGGGG + Intergenic
1199846306 X:151695014-151695036 GCGGGCAAGCCGGGCCGGAGGGG - Intergenic